>MTRNR2L10|NM_001190708|3'UTR
   1 ACAAATAAGACGAGAAGACCCTATGTATGGAGCTTTAATTTATTAATGCAAATAAAAACTTAAGCCTACAGGCCCTAGCC
  81 TACTATCCCTGCATTAAAATTTTTGGTTGGGGTGACCTCAGAGCATAATTCAACCTCCGAGCAACCTAAACTAAGACTGC
 161 ACTAGCCTAAGCAAGTTAATATATATTGACCCGATAATTTGATCAACGGAGTAAGTTACCCTAGGGATAACAGCGCAATC
 241 CTATTCTAGAGTCCATATCAACAATAGGGTTTACAATCTCGATGTTGGATCAGGACATCCTAATGGTGTCACCGCTATTA
 321 GGGGTTCGTTTGTTCAACAATTAAAGTCCTACGTGATGTGAGTTCAGACCAGAGTAATCCAGGTCGGTTTCTATCTATTT
 401 AACATTTCCCCTAGTATGAAAGGACAAGAGAAATAGGGCCCACTTCATAAAGTGCCCTCGCTCCACAGATGATGCTATCT
 481 CAATCTAACAAATCATCACATACCCTACCCAAGAACAGGGTTTGTTAAG

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uuGGGUUAUAGUUUGUAUAGu 5' |:|| ||| |||| ||| Target 5' atCTCA--ATCTAACAAATCa 3'	477 - 495	131.00	-9.50
2	miRNA 3' uuGGGUUAUAGUUUGUAUAGu 5' :|:|: :|| |||||| Target 5' atTCTAGAGTC---CATATCa 3'	243 - 260	123.00	-9.30
3	miRNA 3' uuGGGUUA-----UAGU-UUGUAuagu 5' |:|:|| |||| :|||| Target 5' atCTCGATGTTGGATCAGGACATccta 3'	276 - 302	99.00	-8.76

Mutant ID	Mutant Position	Mutant Source
rs1220214422	2	dbSNP
rs1324419942	3	dbSNP
rs1294621693	8	dbSNP
rs753966712	9	dbSNP
rs764344566	11	dbSNP
rs186016507	12	dbSNP
rs748208942	18	dbSNP
rs1033235157	22	dbSNP
rs1329392845	33	dbSNP
rs1461049899	44	dbSNP
rs996035552	64	dbSNP
rs1243595605	65	dbSNP
rs747903287	71	dbSNP
rs1485213804	72	dbSNP
rs781329817	79	dbSNP
rs1268156071	87	dbSNP
rs1309962211	88	dbSNP
rs1481438039	90	dbSNP
rs1174577776	94	dbSNP
rs1428918037	99	dbSNP
rs1008856519	105	dbSNP
rs781144231	109	dbSNP
rs886100826	110	dbSNP
rs1047401446	111	dbSNP
rs1445361295	120	dbSNP
rs527992637	126	dbSNP
rs1370579733	131	dbSNP
rs1294869495	138	dbSNP
rs754936496	139	dbSNP
rs1349591063	151	dbSNP
rs1301668351	154	dbSNP
rs149160326	166	dbSNP
rs755125460	175	dbSNP
rs180767302	181	dbSNP
rs868459787	185	dbSNP
rs10521478	192	dbSNP
rs1315438091	193	dbSNP
rs1215748228	195	dbSNP
rs1266501480	198	dbSNP
rs1417358901	203	dbSNP
rs1197415050	204	dbSNP
rs373436446	207	dbSNP
rs938169664	208	dbSNP
rs1488282732	210	dbSNP
rs1440594144	211	dbSNP
rs928161205	221	dbSNP
rs764257563	231	dbSNP
rs1267121101	234	dbSNP
rs1418236441	235	dbSNP
rs562551311	240	dbSNP
rs1367414015	242	dbSNP
rs775806985	243	dbSNP
rs1411289874	245	dbSNP
rs1277371165	246	dbSNP
rs1371665103	251	dbSNP
rs75194172	275	dbSNP
rs111384380	276	dbSNP
rs77988349	277	dbSNP
rs1046623551	278	dbSNP
rs1239362010	281	dbSNP
rs1314552720	285	dbSNP
rs1362302487	292	dbSNP
rs574967656	313	dbSNP
rs1302767220	314	dbSNP
rs76243789	321	dbSNP
rs77862174	322	dbSNP
rs1483400139	323	dbSNP
rs945638069	328	dbSNP
rs1231440936	333	dbSNP
rs76449964	339	dbSNP
rs1480410713	343	dbSNP
rs1219370148	345	dbSNP
rs1366446719	346	dbSNP
rs1386840645	351	dbSNP
rs892342792	353	dbSNP
rs75459765	358	dbSNP
rs1281030647	369	dbSNP
rs76365251	371	dbSNP
rs768048981	372	dbSNP
rs913852788	379	dbSNP
rs5960403	385	dbSNP
rs773967357	386	dbSNP
rs989513921	394	dbSNP
rs373514350	397	dbSNP
rs191438385	399	dbSNP
rs1244460793	400	dbSNP
rs1314901645	403	dbSNP
rs921343219	404	dbSNP
rs1216442530	414	dbSNP
rs1270964077	415	dbSNP
rs1427436149	423	dbSNP
rs750817191	440	dbSNP
rs975517615	455	dbSNP
rs762456736	457	dbSNP
rs5960402	459	dbSNP
rs917554411	460	dbSNP
rs1182938700	482	dbSNP
rs1248623312	484	dbSNP
rs1476334647	491	dbSNP
rs1165720770	494	dbSNP
rs757722034	499	dbSNP
rs111749202	506	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- PLoS pathogens, 2012

KSHV is the etiological agent of Kaposi's sarcoma (KS), primary effusion lymphoma (PEL), and a subset of multicentricCastleman's disease (MCD). The fact that KSHV-encoded miRNAs are readily detectable in all KSHV-associated tumors suggests a potential role in viral pathogenesis and tumorigenesis. MiRNA-mediated regulation of gene expression is a complex network with each miRNA having many potential targets, and to date only few KSHV miRNA targets have been experimentally determined. A detailed understanding of KSHV miRNA functions requires high-through putribonomics to globally analyze putative miRNA targets in a cell type-specific manner. We performed Ago HITS-CLIP to identify viral and cellular miRNAs and their cognate targets in two latently KSHV-infected PEL cell lines. Ago HITS-CLIP recovered 1170 and 950 cellular KSHV miRNA targets from BCBL-1 and BC-3, respectively. Importantly, enriched clusters contained KSHV miRNA seed matches in the 3'UTRs of numerous well characterized targets, among them THBS1, BACH1, and C/EBPbeta. KSHV miRNA targets were strongly enriched for genes involved in multiple pathways central for KSHV biology, such as apoptosis, cell cycle regulation, lymphocyte proliferation, and immune evasion, thus further supporting a role in KSHV pathogenesis and potentially tumorigenesis. A limited number of viral transcripts were also enriched by HITS-CLIP including vIL-6 expressed only in a subset of PEL cells during latency. Interestingly, Ago HITS-CLIP revealed extremely high levels of Ago-associated KSHV miRNAs especially in BC-3 cells where more than 70% of all miRNAs are of viral origin. This suggests that in addition to seed match-specific targeting of cellular genes, KSHV miRNAs may also function by hijacking RISCs, thereby contributing to a global de-repression of cellular gene expression due to the loss of regulation by human miRNAs. In summary, we provide an extensive list of cellular and viral miRNA targets representing an important resource to decipher KSHV miRNA function.

- Cell, 2013

The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.

- Nucleic acids research, 2016

MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.