>PTCH2|NM_001166292|3'UTR
   1 CCTCTGCCTCCCACCCCAGCACCCCCTCATCAGACACACGGAGCGCCACTGTCTGGACAGGCTGAATTGGTCTTCGGGTC
  81 CCTAATTTCTCATACGCCATTCCCTCTGCCTAGAACACTTTCTCACCTCCCCTTGATGTGACCCCATATCACCCTTCGAG
 161 GTGAATTGGATCGGATGCCATCTCCTCCAGGAGGGGTGGGGTCGTGCCTCCTGTGAGGTCCCAGTGCCCCTGAGTGTCTG
 241 TGCCCGTCTGTTTCCCCGTCCCTCTCTCTAAGCCCGGAGGCTTACTGCGGGTAAGGACGGCGGGACAGGACCTTAACCCC
 321 TGGGACGAACACCAGCTCCGCAAAGGACTCCGCACCCGGCGCCGCCCACGGGGTGCGGGTCCCAGGAGGACCAGCAGAGA
 401 GGAGCATAGGAGAGCAAAGGAGATCAGTGACCCATGGCTTCCCCGGTGGCGCGGAACAGCCCGGAGCCGCCTGTGATTTG
 481 CATACCCATGGTGCACCACGAAAAGATACCCTCAAGATGCTTGCACTCCCTCTGTGCGCGCATTTCTGCACTGTTTTAGA
 561 GCATGATGCCTCTTACACGCATCTGTGTGCATAAACTACATATAGGGAGTGCGTACCACGCAGGCATCCAACAACCATAA
 641 GTGTGTTAAGTGTTAGTTCTCCCTGCGAGGTTCGAAGCGGAAGTCACGAATATACTCGGGTTTCTCTTCAAAGCGCATAA
 721 ATCTTTCGCCTTTTACTAAAGATTTCCGTGGAGAGAAAGTTGTGAGTTTTTATTCAATTTTTTGAGGCCTCTTATTTCCT
 801 GAGGCTACATTTTTAAGTATTAAAAGTTAGGCAACTACAACCAAG

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gaCCCCGUGUCCCUCCUCUCc 5' || |||: ||||||| Target 5' gaGGAGCAT----AGGAGAGc 3'	399 - 415	149.00	-15.34
2	miRNA 3' gaCCCCGUGUCC---CUCCUCUcc 5' ||||::|:|| |||||: Target 5' acGGGGTGCGGGTCCCAGGAGGac 3'	368 - 391	127.00	-21.90
3	miRNA 3' gaccccgugucccUCCUCUCc 5' |||||:| Target 5' tgccatctcctccAGGAGGGg 3'	176 - 196	124.00	-13.50

Mutant ID	Mutant Position	Mutant Source
COSN30757690	75	COSMIC
COSN6036545	136	COSMIC
COSN1104786	260	COSMIC
COSN8638358	353	COSMIC
COSN28734222	370	COSMIC
COSN26814489	543	COSMIC
COSN17117828	587	COSMIC
COSN17452112	593	COSMIC
COSN20774236	641	COSMIC
COSN1446396	712	COSMIC
COSN5741512	756	COSMIC
COSN28201960	780	COSMIC
COSN21960984	830	COSMIC
rs188241457	746	GWAS

Mutant ID	Mutant Position	Mutant Source
rs777079047	1	dbSNP
rs1471438206	5	dbSNP
rs1367237036	7	dbSNP
rs1438657353	11	dbSNP
rs1186546731	15	dbSNP
rs949019496	17	dbSNP
rs917513311	22	dbSNP
rs1231891204	23	dbSNP
rs1259059745	24	dbSNP
rs560944695	25	dbSNP
rs1446128465	26	dbSNP
rs747435195	28	dbSNP
rs371688861	31	dbSNP
rs11573603	32	dbSNP
rs1442051682	33	dbSNP
rs1031089818	35	dbSNP
rs1264815042	37	dbSNP
rs189756125	39	dbSNP
rs947482386	40	dbSNP
rs915093655	41	dbSNP
rs558442200	45	dbSNP
rs1462773059	50	dbSNP
rs549549303	53	dbSNP
rs1167592465	55	dbSNP
rs1320213031	61	dbSNP
rs1398822490	62	dbSNP
rs1407170200	64	dbSNP
rs1326654204	68	dbSNP
rs1370204845	69	dbSNP
rs1383689540	75	dbSNP
rs769009116	76	dbSNP
rs1299664852	82	dbSNP
rs964861460	84	dbSNP
rs1382980121	85	dbSNP
rs1226332450	89	dbSNP
rs1028945696	99	dbSNP
rs1209984992	104	dbSNP
rs1018871281	106	dbSNP
rs1468465620	109	dbSNP
rs901709546	119	dbSNP
rs1250406035	142	dbSNP
rs987318862	146	dbSNP
rs1371619256	157	dbSNP
rs1191677637	160	dbSNP
rs1473877932	161	dbSNP
rs1393857474	172	dbSNP
rs545293102	173	dbSNP
rs1322469701	181	dbSNP
rs950404176	183	dbSNP
rs1446911892	184	dbSNP
rs1442775481	189	dbSNP
rs1025916137	190	dbSNP
rs1381496181	193	dbSNP
rs994573127	194	dbSNP
rs1341936481	210	dbSNP
rs866542297	213	dbSNP
rs1295253305	227	dbSNP
rs1398364794	228	dbSNP
rs185397548	232	dbSNP
rs1319311519	234	dbSNP
rs1248599696	235	dbSNP
rs931342354	237	dbSNP
rs1402817923	243	dbSNP
rs1389158602	245	dbSNP
rs1164799959	246	dbSNP
rs771943530	250	dbSNP
rs373328320	251	dbSNP
rs1462477383	256	dbSNP
rs1419377274	257	dbSNP
rs1167999604	260	dbSNP
rs752347446	261	dbSNP
rs1223488668	265	dbSNP
rs1486474394	266	dbSNP
rs12079597	268	dbSNP
rs767173269	272	dbSNP
rs1045329698	273	dbSNP
rs1260055469	276	dbSNP
rs948216599	281	dbSNP
rs754821728	282	dbSNP
rs181152082	285	dbSNP
rs766379252	286	dbSNP
rs895946007	289	dbSNP
rs1336925356	290	dbSNP
rs1275117096	291	dbSNP
rs763119836	293	dbSNP
rs1057408841	299	dbSNP
rs1216878167	301	dbSNP
rs1338914437	302	dbSNP
rs139116635	310	dbSNP
rs1433207078	312	dbSNP
rs1329693208	317	dbSNP
rs1325724496	318	dbSNP
rs1404115224	318	dbSNP
rs371774515	319	dbSNP
rs1397330943	320	dbSNP
rs1167848215	321	dbSNP
rs1408886793	324	dbSNP
rs903214770	327	dbSNP
rs935096358	335	dbSNP
rs1325752859	340	dbSNP
rs1043071355	344	dbSNP
rs1303282880	345	dbSNP
rs1238982473	346	dbSNP
rs1259444437	348	dbSNP
rs1347583345	349	dbSNP
rs1211971401	351	dbSNP
rs1484810860	355	dbSNP
rs979495916	357	dbSNP
rs1426026732	358	dbSNP
rs947498433	369	dbSNP
rs1379231714	372	dbSNP
rs189882698	377	dbSNP
rs546590868	378	dbSNP
rs1162538700	379	dbSNP
rs1429926412	392	dbSNP
rs1028905034	396	dbSNP
rs547050695	399	dbSNP
rs1372015856	402	dbSNP
rs534001733	405	dbSNP
rs571832195	408	dbSNP
rs527422532	411	dbSNP
rs1280021891	414	dbSNP
rs1292642731	415	dbSNP
rs1346054306	420	dbSNP
rs943228931	421	dbSNP
rs1207588123	422	dbSNP
rs1247827539	423	dbSNP
rs1008283348	427	dbSNP
rs911702561	432	dbSNP
rs569986267	434	dbSNP
rs1269450707	435	dbSNP
rs1489882090	436	dbSNP
rs750618325	437	dbSNP
rs551635493	441	dbSNP
rs538546910	442	dbSNP
rs1454655146	443	dbSNP
rs186548203	444	dbSNP
rs987370651	447	dbSNP
rs950621632	453	dbSNP
rs1431356128	458	dbSNP
rs1206211508	459	dbSNP
rs549831093	460	dbSNP
rs527500657	462	dbSNP
rs1212564057	466	dbSNP
rs12079506	471	dbSNP
rs1294770175	485	dbSNP
rs973087910	486	dbSNP
rs963341934	491	dbSNP
rs146658804	494	dbSNP
rs1283883311	495	dbSNP
rs1369284644	496	dbSNP
rs1406620887	496	dbSNP
rs1013058864	506	dbSNP
rs546992971	508	dbSNP
rs896011750	509	dbSNP
rs560834132	510	dbSNP
rs746055680	511	dbSNP
rs1202608309	513	dbSNP
rs1301971978	524	dbSNP
rs781373183	537	dbSNP
rs1213000972	540	dbSNP
rs999143636	543	dbSNP
rs181872399	549	dbSNP
rs1355902533	559	dbSNP
rs1186868612	566	dbSNP
rs1043291741	567	dbSNP
rs1045256536	569	dbSNP
rs948310526	575	dbSNP
rs896631186	576	dbSNP
rs947417398	578	dbSNP
rs1430340360	579	dbSNP
rs527352099	582	dbSNP
rs1460405855	585	dbSNP
rs866865902	595	dbSNP
rs935544872	596	dbSNP
rs899803168	597	dbSNP
rs41269089	599	dbSNP
rs544869419	601	dbSNP
rs757079857	606	dbSNP
rs753656371	616	dbSNP
rs1335586631	617	dbSNP
rs1051537723	620	dbSNP
rs1271251882	622	dbSNP
rs1231415988	625	dbSNP
rs866249659	629	dbSNP
rs921598784	630	dbSNP
rs974632197	632	dbSNP
rs929262276	636	dbSNP
rs41269087	641	dbSNP
rs113960979	644	dbSNP
rs562791589	645	dbSNP
rs995557680	646	dbSNP
rs1429016921	651	dbSNP
rs1282147132	659	dbSNP
rs35144044	664	dbSNP
rs759279007	664	dbSNP
rs1356315126	665	dbSNP
rs962647416	667	dbSNP
rs1291509401	668	dbSNP
rs1352823150	670	dbSNP
rs542643672	670	dbSNP
rs1283389586	671	dbSNP
rs1374828927	673	dbSNP
rs1314941370	676	dbSNP
rs1445562189	676	dbSNP
rs376784866	678	dbSNP
rs1012427555	679	dbSNP
rs1185245179	679	dbSNP
rs573710480	680	dbSNP
rs752745338	681	dbSNP
rs776112446	682	dbSNP
rs115899954	683	dbSNP
rs534304002	684	dbSNP
rs369237595	685	dbSNP
rs760119847	686	dbSNP
rs375558597	687	dbSNP
rs189101437	688	dbSNP
rs759096648	689	dbSNP
rs761691944	690	dbSNP
rs1445448130	691	dbSNP
rs368827055	692	dbSNP
rs1040095238	693	dbSNP
rs1303988012	693	dbSNP
rs1008343502	694	dbSNP
rs561199379	695	dbSNP
rs1047094413	696	dbSNP
rs12036829	697	dbSNP
rs1254132833	697	dbSNP
rs532496087	698	dbSNP
rs560397178	699	dbSNP
rs140180112	700	dbSNP
rs1383029310	701	dbSNP
rs184653286	701	dbSNP
rs527424987	702	dbSNP
rs1320042247	703	dbSNP
rs12132510	704	dbSNP
rs1326719076	704	dbSNP
rs1336347976	704	dbSNP
rs1468402933	705	dbSNP
rs1264280620	706	dbSNP
rs551187137	706	dbSNP
rs531385686	707	dbSNP
rs753230933	708	dbSNP
rs113598000	709	dbSNP
rs1417165634	709	dbSNP
rs542534618	710	dbSNP
rs573551566	711	dbSNP
rs781327865	711	dbSNP
rs1414910456	712	dbSNP
rs41269085	713	dbSNP
rs1243267182	714	dbSNP
rs540254924	714	dbSNP
rs150681043	715	dbSNP
rs192626269	716	dbSNP
rs79027712	717	dbSNP
rs1047404827	718	dbSNP
rs544685386	719	dbSNP
rs867688106	720	dbSNP
rs188051405	721	dbSNP
rs866977985	722	dbSNP
rs141950484	723	dbSNP
rs1022545436	725	dbSNP
rs964835222	726	dbSNP
rs567045658	727	dbSNP
rs183639735	728	dbSNP
rs533529607	729	dbSNP
rs74485107	730	dbSNP
rs1307629094	731	dbSNP
rs1382511973	731	dbSNP
rs867231647	734	dbSNP
rs755939838	735	dbSNP
rs559156897	736	dbSNP
rs115827181	737	dbSNP
rs990718389	738	dbSNP
rs148551547	739	dbSNP
rs779305541	740	dbSNP
rs1429917572	741	dbSNP
rs192524658	741	dbSNP
rs754188893	742	dbSNP
rs751034233	743	dbSNP
rs994248780	744	dbSNP
rs1026057568	745	dbSNP
rs188241457	746	dbSNP
rs540658149	747	dbSNP
rs184930641	748	dbSNP
rs894281328	749	dbSNP
rs144745590	750	dbSNP
rs1420737766	751	dbSNP
rs763942102	751	dbSNP
rs576900913	752	dbSNP
rs567801023	753	dbSNP
rs775169423	754	dbSNP
rs1295192386	755	dbSNP
rs193075289	755	dbSNP
rs187608069	756	dbSNP
rs201444688	756	dbSNP
rs772331828	757	dbSNP
rs748246961	758	dbSNP
rs573505698	759	dbSNP
rs963083174	759	dbSNP
rs183280839	760	dbSNP
rs1025641250	761	dbSNP
rs972711406	762	dbSNP
rs564955524	763	dbSNP
rs191094224	764	dbSNP
rs1314931100	765	dbSNP
rs1404611627	765	dbSNP
rs572881320	766	dbSNP
rs1224196369	767	dbSNP
rs555010282	767	dbSNP
rs1308239361	768	dbSNP
rs775822251	768	dbSNP
rs894322684	769	dbSNP
rs1207382035	770	dbSNP
rs1034171316	771	dbSNP
rs139560838	772	dbSNP
rs1471437918	772	dbSNP
rs41269083	772	dbSNP
rs182864574	773	dbSNP
rs1414018634	774	dbSNP
rs1480714352	774	dbSNP
rs1041614399	775	dbSNP
rs552412145	776	dbSNP
rs41269081	777	dbSNP
rs1217035246	778	dbSNP
rs532422394	778	dbSNP
rs942454051	779	dbSNP
rs568602036	780	dbSNP
rs1456758382	781	dbSNP
rs1051204217	782	dbSNP
rs756468604	783	dbSNP
rs745579203	784	dbSNP
rs981353522	784	dbSNP
rs1421743619	785	dbSNP
rs1466170615	785	dbSNP
rs548811131	785	dbSNP
rs190972044	786	dbSNP
rs566625888	787	dbSNP
rs186502463	788	dbSNP
rs959476531	789	dbSNP
rs181420462	790	dbSNP
rs540615118	791	dbSNP
rs942168431	792	dbSNP
rs530255931	793	dbSNP
rs139076008	794	dbSNP
rs1020224744	795	dbSNP
rs561362432	796	dbSNP
rs531077110	797	dbSNP
rs146347925	798	dbSNP
rs116205686	799	dbSNP
rs1007094457	800	dbSNP
rs561678205	801	dbSNP
rs190420749	802	dbSNP
rs375688837	803	dbSNP
rs185960645	804	dbSNP
rs546181243	805	dbSNP
rs1456238799	806	dbSNP
rs577425751	807	dbSNP
rs748004237	808	dbSNP
rs142939610	809	dbSNP
rs1396055921	810	dbSNP
rs887917653	810	dbSNP
rs959594086	811	dbSNP
rs537444387	813	dbSNP
rs1284090430	814	dbSNP
rs1201081796	815	dbSNP
rs1486724549	815	dbSNP
rs1255472196	816	dbSNP
rs138929510	817	dbSNP
rs982161799	818	dbSNP
rs945671040	819	dbSNP
rs150155835	820	dbSNP
rs553388855	821	dbSNP
rs368781041	822	dbSNP
rs533536389	822	dbSNP
rs1010605747	823	dbSNP
rs1384670275	824	dbSNP
rs535505182	825	dbSNP
rs1307403187	826	dbSNP
rs1333874496	826	dbSNP
rs371388317	826	dbSNP
rs181782534	827	dbSNP
rs1030796252	828	dbSNP
rs368132498	830	dbSNP
rs779476471	831	dbSNP
rs189325432	832	dbSNP
rs537658937	833	dbSNP
rs888012499	834	dbSNP
rs548244957	835	dbSNP
rs907377273	836	dbSNP
rs746651037	837	dbSNP
rs530908612	838	dbSNP
rs562025324	839	dbSNP
rs185730820	840	dbSNP
rs757919440	841	dbSNP
rs777185172	842	dbSNP
rs528537055	843	dbSNP
rs559705439	844	dbSNP
rs546367337	845	dbSNP
rs764973796	845	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.