miRTarBase - #MIRT499098


—
pre-miRNA Information
pre-miRNA hsa-mir-5590   
Genomic Coordinates chr2: 134857820 - 134857873
Description Homo sapiens miR-5590 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-5590-5p
Sequence 1| UUGCCAUACAUAGACUUUAUU |21
Evidence Not_experimental
Experiments
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs553031425 1 dbSNP
rs1255264134 4 dbSNP
rs1205476379 9 dbSNP
rs1387316331 10 dbSNP
rs1031241138 11 dbSNP
rs1465409255 12 dbSNP
rs1227248415 18 dbSNP
rs1334861447 19 dbSNP
Putative Targets

Gene Information
Gene Symbol DENND4C   
Synonyms C9orf55, C9orf55B, RAB10GEF, bA513M16.3
Description DENN domain containing 4C
Transcript NM_017925   
Expression
Putative miRNA Targets on DENND4C
3'UTR of DENND4C
(miRNA target sites are highlighted)		 
>DENND4C|NM_017925|3'UTR
   1 ATAGAGATTCACTAGAATGTTGACACACAAGGCTTGGGGATTAGATTTCATCTGGAAACATTCAAGTTTTTTTTTCCAAA
  81 TCGTAAGAACTGGTGAATACGGAATTGAAGTAACTCTTGGGGACAATATATAATGAATTATGATTCATATTGCATTACCT
 161 TGAAATATGAAGTGCCATTTGAATGTCCCAGGGCTTATTAATATTGAAGATTTTCAACCCCTGAACTGCTTTTCTGCCTC
 241 TGTGGAAAACTACTTTGGGATTCTTCAGTATTTGTAGTAGTTTGATAGAAATAATGAGGAACCATATTCATTCTAGGCAT
 321 TGTTTATATTTGAAGTTACTGAGTTTGAGGAATGGCAAATTAAATTTGCCTAACCCCCAAAACAAATGAAATATCTCAAT
 401 TATAAAAGCAACATGGCCGGGCACGGTGGCTCAGGCCTGTAATCCCAGCACTTTGGGAGGCTGAGCAAGGTGGGTGGATC
 481 ACTTGAGGCCAGGAGTTCGAGACCAGCCTGGCCAACACGGTGAGACCCTGTCTTTACTAAAAATACAAAAATTAGCCAGG
 561 CGCACCACTGTAGTCCCAGCTACTCAGGCTGAGGCAGGAGAATCGCTTGAACTGAGGCAGAGGCTACAGTGAGTGGAGAT
 641 CACGCCACTGCAACTCCAGCTTGGGTGACAGAGTGAGACCGTCTCAAAAAAAAAAAAAAAAAAAAAAGAGAGCAACATAT
 721 TTGTGTAAGTTTGTATATGTGTAGGGCTGTGTAGGTATGTGTATATACAGCCATATTCTAAGTGTATATTTATTAAAATA
 801 GATTGCATGTTGCAATACGGTTTTCTGAAAGGGGTCTCATTGACTATTAAATAAATGACTACTACTAAACTTGTCTGTAG
 881 TCATTAATCTTAAAATTACCTGAAAATCTGATGACAGCTGCCTTCCCTAACTTTAATGTATTAGGTTGGCACAAAATTAA
 961 TTGTAGTTTTTGCCACTATTAATGGCAAAAACCGCAATTATTTTTGTACCAACATAATACACCTTTCATATTATGTATTA
1041 TCTTGCTTAATGGGTTTTATCTTGATTATCCAGTTACTTCCATCCTCTTCCCAATGTTAATTTGCAATAGTTTTAAAATG
1121 GGAACAAATGAATCAATCATCAGATAGTTAAAATGAAATTAAATCAGCTGCCTAATAATTTATGGAATTCATTGGAATGT
1201 GCTTAAAATGCTAAAGTGTATGTCATTGAACATGAAATCTTTTTTCAGGCACATACATTGTTGGTATTGATGACTTTTTA
1281 AAACCTGTGGGATAAACTTGCACTGCACACGGAAGTTTTATTCTTGTATATTTAGATTTGTATGCTTGTGAGTAAAAATG
1361 TGCATTTGTAAATACTGTGTTTTTAGGTTGAATCAATTAAGTCTTAAAACTGTAAATTTATTAAGCTTGTTGCCAGTAGG
1441 TTTAAGAAAATCATGATCTCACATGCCTCACTTTGACATTTATCATGCCTTTTATTAAAAATATCCCTTAGGAACAGTAA
1521 GTTTGCCTTAACTCTCTGCATGGTTTAAAAAGCCATTGGTTTTGTGTGTGTTTACAGTAATTATGCAGATGACTAAATGA
1601 GTTGACACAGTAAAATTACTTCCATATGGTACAGTAACAACCTAACTCCCTTCTACCTGATGTAACCATTTACAAATTAT
1681 AGTTATTGTACCAGTCTTTCAACATTTCAGGGTTAATCTGACCTATGCAGAATTCTAGTGTGAATTTATTGTGAAAATGC
1761 TAAATGAAACAATTTGTCAGAAATTATGTACAATTTTCATTACCTTCAAAATGGATCTTTTGCACTGTCTGAGAGTATAT
1841 ATTTTTGCAACTCAAGACTTGGTACTAGTTTTAATACTTAACACTTACTGACCCAACAGAAGTTTGGAATTACCTTGCAT
1921 ATAAAAATTGAGGTTGAATAAAATGAAAAATTGTTGTTTTCTGTTACATTAAGCCTCTTGAAATCTGTAATCTTTAGAAT
2001 CCCAATATTTTGTTTTTTCCATTCCTTCACTCGTAACTTGAACTCAAGTTTTCACTTACTGACGCGCTTCCCATTAAAAA
2081 AAATCTGTAAAGATCAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuAUUUCA-GAU---ACAUACCGUu 5'
            |||| | |||   |||||| || 
Target 5' ctTAAAATGCTAAAGTGTATGTCAt 3'
 1202 - 1226 135.00 -7.70
2 
miRNA  3' uuAUUUCA---GAUACAUACCGUu 5'
            |||| |   :|   |||||:| 
Target 5' agTAAAATTACTTCCATATGGTAc 3'
 1609 - 1632 131.00 -5.30
3 
miRNA  3' uuauUUCAGA-UACAUACCGUu 5'
              :|||:| | | |||||| 
Target 5' tactGAGTTTGAGGAATGGCAa 3'
 337 - 358 129.00 -12.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26973188 5 COSMIC
COSN30193215 7 COSMIC
COSN30477302 35 COSMIC
COSN30467857 50 COSMIC
COSN20065274 76 COSMIC
COSN30157643 136 COSMIC
COSN30157673 137 COSMIC
COSN31599600 173 COSMIC
COSN31554752 263 COSMIC
COSN32048415 274 COSMIC
COSN16431028 361 COSMIC
COSN16437927 365 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs554637682 3 dbSNP
rs767514157 3 dbSNP
rs1355593613 5 dbSNP
rs766804046 7 dbSNP
rs760196569 8 dbSNP
rs1352397811 9 dbSNP
rs1223938447 12 dbSNP
rs930052633 14 dbSNP
rs760712921 16 dbSNP
rs1424566725 20 dbSNP
rs375313331 22 dbSNP
rs1215147199 23 dbSNP
rs1260216253 28 dbSNP
rs140821869 29 dbSNP
rs1056438116 30 dbSNP
rs368328156 33 dbSNP
rs1461311844 35 dbSNP
rs765767106 39 dbSNP
rs1361133781 40 dbSNP
rs1161174958 41 dbSNP
rs765042685 50 dbSNP
rs752599924 53 dbSNP
rs560736360 55 dbSNP
rs751026744 58 dbSNP
rs1201902088 61 dbSNP
rs1479098298 63 dbSNP
rs954714932 66 dbSNP
rs1266042680 67 dbSNP
rs370771934 67 dbSNP
rs910606674 67 dbSNP
rs1263684924 74 dbSNP
rs1444780136 76 dbSNP
rs903752741 80 dbSNP
rs1219469923 83 dbSNP
rs1170888713 84 dbSNP
rs914066393 84 dbSNP
rs945566448 87 dbSNP
rs754559641 88 dbSNP
rs1222720157 93 dbSNP
rs1030831419 102 dbSNP
rs1290630792 103 dbSNP
rs41270105 105 dbSNP
rs906799398 106 dbSNP
rs1334864725 107 dbSNP
rs1471097831 108 dbSNP
rs1427516885 110 dbSNP
rs1175951973 111 dbSNP
rs1422007795 115 dbSNP
rs997270139 115 dbSNP
rs1185296754 117 dbSNP
rs1485797401 118 dbSNP
rs1241047563 141 dbSNP
rs1030061288 142 dbSNP
rs1462251631 147 dbSNP
rs879690890 149 dbSNP
rs1202635814 151 dbSNP
rs1359695388 152 dbSNP
rs187251120 154 dbSNP
rs1212760794 160 dbSNP
rs1015329935 165 dbSNP
rs1284824857 169 dbSNP
rs1454697552 174 dbSNP
rs1345740321 175 dbSNP
rs1336322823 176 dbSNP
rs1466283518 184 dbSNP
rs896979643 187 dbSNP
rs1168727050 190 dbSNP
rs998450415 192 dbSNP
rs369206170 194 dbSNP
rs1029552092 204 dbSNP
rs954106809 216 dbSNP
rs1446002968 219 dbSNP
rs1240655575 221 dbSNP
rs1272542345 227 dbSNP
rs1018965812 240 dbSNP
rs962987711 241 dbSNP
rs1252889179 246 dbSNP
rs1353535468 248 dbSNP
rs986111201 250 dbSNP
rs1306687574 251 dbSNP
rs1285882280 253 dbSNP
rs1017616169 254 dbSNP
rs974244110 261 dbSNP
rs1487520294 262 dbSNP
rs958060832 263 dbSNP
rs1447831555 265 dbSNP
rs755885474 269 dbSNP
rs1269952354 274 dbSNP
rs918761039 279 dbSNP
rs989553731 285 dbSNP
rs777616174 286 dbSNP
rs1166023400 290 dbSNP
rs1196907390 296 dbSNP
rs1423229709 297 dbSNP
rs930104724 300 dbSNP
rs1365624519 314 dbSNP
rs992218324 316 dbSNP
rs571013002 319 dbSNP
rs917998765 333 dbSNP
rs948075219 341 dbSNP
rs1045070428 347 dbSNP
rs1382879313 357 dbSNP
rs1419123882 359 dbSNP
rs373391004 375 dbSNP
rs1470528802 380 dbSNP
rs547074001 388 dbSNP
rs945543965 392 dbSNP
rs936581722 395 dbSNP
rs1224653932 402 dbSNP
rs565697252 405 dbSNP
rs1304729302 411 dbSNP
rs1290904824 414 dbSNP
rs534209944 419 dbSNP
rs1241023526 420 dbSNP
rs386733366 423 dbSNP
rs192587078 424 dbSNP
rs892321540 425 dbSNP
rs184533662 426 dbSNP
rs1368767191 433 dbSNP
rs1239057051 435 dbSNP
rs1309248961 438 dbSNP
rs1403674382 449 dbSNP
rs538442448 450 dbSNP
rs888853472 452 dbSNP
rs1453925242 454 dbSNP
rs1365029995 464 dbSNP
rs1007675073 469 dbSNP
rs1015920895 471 dbSNP
rs888104301 475 dbSNP
rs188194598 478 dbSNP
rs150125454 499 dbSNP
rs138416695 500 dbSNP
rs1438482657 504 dbSNP
rs1489788541 506 dbSNP
rs1268163201 511 dbSNP
rs555712542 512 dbSNP
rs1486892991 513 dbSNP
rs1051374492 514 dbSNP
rs1238633857 517 dbSNP
rs546355268 519 dbSNP
rs770843041 520 dbSNP
rs1345263721 523 dbSNP
rs866857048 528 dbSNP
rs889666449 528 dbSNP
rs1386518862 529 dbSNP
rs1006805582 530 dbSNP
rs573970686 531 dbSNP
rs1429614145 532 dbSNP
rs918035506 533 dbSNP
rs1479372011 536 dbSNP
rs958008505 537 dbSNP
rs1193827521 542 dbSNP
rs1406775249 552 dbSNP
rs1430186927 553 dbSNP
rs1451932268 555 dbSNP
rs1259782568 558 dbSNP
rs1204673086 561 dbSNP
rs1461811307 562 dbSNP
rs756534542 563 dbSNP
rs1202009099 564 dbSNP
rs981230322 569 dbSNP
rs925311490 573 dbSNP
rs542481415 578 dbSNP
rs1325237574 579 dbSNP
rs1161100550 587 dbSNP
rs1381215540 589 dbSNP
rs1406166472 605 dbSNP
rs967201769 606 dbSNP
rs1467850606 610 dbSNP
rs1052363925 619 dbSNP
rs1168243881 627 dbSNP
rs544854096 634 dbSNP
rs531358081 635 dbSNP
rs991018109 636 dbSNP
rs910158887 637 dbSNP
rs1330052973 644 dbSNP
rs933164177 645 dbSNP
rs1461005371 658 dbSNP
rs1273935254 660 dbSNP
rs1197975090 661 dbSNP
rs1337838793 665 dbSNP
rs1251307480 666 dbSNP
rs1247266637 668 dbSNP
rs1455072933 668 dbSNP
rs1382903465 670 dbSNP
rs1314009341 672 dbSNP
rs562849973 674 dbSNP
rs1450052479 681 dbSNP
rs1321499001 682 dbSNP
rs1250224444 685 dbSNP
rs1394068418 685 dbSNP
rs1036664117 686 dbSNP
rs1160527457 686 dbSNP
rs1279844426 686 dbSNP
rs1307132323 686 dbSNP
rs1333785008 686 dbSNP
rs1355023724 686 dbSNP
rs1367424102 686 dbSNP
rs1404905825 686 dbSNP
rs1405292071 686 dbSNP
rs1408724986 686 dbSNP
rs1443844297 686 dbSNP
rs1468752854 686 dbSNP
rs368857837 686 dbSNP
rs79889954 686 dbSNP
rs1363616890 687 dbSNP
rs1200652636 689 dbSNP
rs1253364079 689 dbSNP
rs1340322800 690 dbSNP
rs918303199 697 dbSNP
rs1051601399 703 dbSNP
rs1256214351 703 dbSNP
rs1450547731 704 dbSNP
rs1462673085 705 dbSNP
rs1185381383 706 dbSNP
rs888894970 706 dbSNP
rs1007315138 707 dbSNP
rs1281301820 707 dbSNP
rs1491390801 707 dbSNP
rs1320323174 708 dbSNP
rs1345882310 708 dbSNP
rs1398992549 708 dbSNP
rs1491485399 708 dbSNP
rs868585537 709 dbSNP
rs1423041426 710 dbSNP
rs549575282 710 dbSNP
rs1016386427 711 dbSNP
rs114547466 712 dbSNP
rs1006749932 713 dbSNP
rs1465797213 714 dbSNP
rs1169454240 715 dbSNP
rs1397538813 717 dbSNP
rs1054348025 718 dbSNP
rs993113016 719 dbSNP
rs1444763148 721 dbSNP
rs79845784 724 dbSNP
rs1021378341 727 dbSNP
rs951630731 727 dbSNP
rs966777296 728 dbSNP
rs1362610558 730 dbSNP
rs1013741404 736 dbSNP
rs1315457205 738 dbSNP
rs542393774 738 dbSNP
rs28650045 744 dbSNP
rs1337714164 745 dbSNP
rs1341417743 755 dbSNP
rs1404420047 766 dbSNP
rs1175754510 771 dbSNP
rs749490666 774 dbSNP
rs1422293652 775 dbSNP
rs980898318 776 dbSNP
rs1185223915 782 dbSNP
rs1447209615 783 dbSNP
rs1462354992 787 dbSNP
rs910107826 787 dbSNP
rs1256352607 788 dbSNP
rs925329900 789 dbSNP
rs146921243 793 dbSNP
rs972998651 796 dbSNP
rs376805080 798 dbSNP
rs1275030676 799 dbSNP
rs1212730128 803 dbSNP
rs933699828 804 dbSNP
rs1315790365 805 dbSNP
rs988122180 813 dbSNP
rs913858643 816 dbSNP
rs1051268152 818 dbSNP
rs541895799 819 dbSNP
rs1129101 820 dbSNP
rs1478001063 829 dbSNP
rs549649833 831 dbSNP
rs774594513 831 dbSNP
rs1445869254 834 dbSNP
rs1192483570 839 dbSNP
rs1054296320 841 dbSNP
rs1480873719 841 dbSNP
rs910386755 846 dbSNP
rs893022835 848 dbSNP
rs560355169 849 dbSNP
rs1359140264 854 dbSNP
rs1464966690 857 dbSNP
rs567967200 858 dbSNP
rs538575784 860 dbSNP
rs1037486533 865 dbSNP
rs1224530111 884 dbSNP
rs1399712520 889 dbSNP
rs1003571756 890 dbSNP
rs1347607761 898 dbSNP
rs1366760000 900 dbSNP
rs1305430096 903 dbSNP
rs556795677 906 dbSNP
rs898902904 911 dbSNP
rs1163703859 913 dbSNP
rs1366196476 913 dbSNP
rs1419277333 915 dbSNP
rs993165272 917 dbSNP
rs1035492268 918 dbSNP
rs181056489 923 dbSNP
rs538744155 935 dbSNP
rs1269529939 939 dbSNP
rs895452076 940 dbSNP
rs1287985996 942 dbSNP
rs1013840022 943 dbSNP
rs1025625978 947 dbSNP
rs962884433 949 dbSNP
rs1216825697 954 dbSNP
rs969597308 955 dbSNP
rs1318988705 957 dbSNP
rs1129102 958 dbSNP
rs1215605606 964 dbSNP
rs1346471128 964 dbSNP
rs1285823363 974 dbSNP
rs770069253 979 dbSNP
rs1388007555 987 dbSNP
rs554258280 989 dbSNP
rs774244827 993 dbSNP
rs527656271 994 dbSNP
rs572323978 995 dbSNP
rs1490730676 999 dbSNP
rs1025917029 1002 dbSNP
rs1346619160 1004 dbSNP
rs546520571 1009 dbSNP
rs1472182878 1010 dbSNP
rs1423888362 1011 dbSNP
rs1201570848 1012 dbSNP
rs1431340131 1015 dbSNP
rs986494227 1019 dbSNP
rs958106592 1021 dbSNP
rs1486856904 1023 dbSNP
rs910926705 1024 dbSNP
rs942432104 1027 dbSNP
rs764362345 1032 dbSNP
rs1381412906 1038 dbSNP
rs988174545 1039 dbSNP
rs1240725358 1041 dbSNP
rs748288508 1042 dbSNP
rs989939749 1046 dbSNP
rs1382308084 1047 dbSNP
rs1363452707 1054 dbSNP
rs1318205355 1055 dbSNP
rs1456360699 1055 dbSNP
rs913910798 1055 dbSNP
rs1178365508 1057 dbSNP
rs1406597692 1057 dbSNP
rs77383966 1058 dbSNP
rs143344345 1060 dbSNP
rs1193727632 1061 dbSNP
rs1430445615 1065 dbSNP
rs1246248855 1066 dbSNP
rs773562777 1073 dbSNP
rs1188221170 1074 dbSNP
rs374260370 1078 dbSNP
rs910431031 1084 dbSNP
rs1245152502 1088 dbSNP
rs1199112494 1091 dbSNP
rs943242138 1095 dbSNP
rs1037937544 1104 dbSNP
rs920382365 1108 dbSNP
rs1311440488 1109 dbSNP
rs929065771 1119 dbSNP
rs1343743064 1123 dbSNP
rs1047430366 1126 dbSNP
rs939319368 1131 dbSNP
rs1056475796 1133 dbSNP
rs895190546 1137 dbSNP
rs543340071 1138 dbSNP
rs1338230692 1142 dbSNP
rs867801538 1144 dbSNP
rs1283599412 1148 dbSNP
rs1401228265 1154 dbSNP
rs1168482029 1166 dbSNP
rs564914636 1169 dbSNP
rs1463439460 1171 dbSNP
rs1388441506 1172 dbSNP
rs1168068054 1173 dbSNP
rs1014310447 1175 dbSNP
rs1323239227 1178 dbSNP
rs560022371 1183 dbSNP
rs1221893927 1187 dbSNP
rs905424291 1189 dbSNP
rs1185689384 1190 dbSNP
rs1245702990 1197 dbSNP
rs1487227905 1199 dbSNP
rs1442269227 1200 dbSNP
rs1251665074 1209 dbSNP
rs1179958277 1212 dbSNP
rs1198124649 1212 dbSNP
rs1017002657 1214 dbSNP
rs540739561 1215 dbSNP
rs143810329 1216 dbSNP
rs184346673 1217 dbSNP
rs1032503561 1219 dbSNP
rs893942372 1220 dbSNP
rs1439597916 1227 dbSNP
rs761918185 1240 dbSNP
rs760166280 1243 dbSNP
rs1387506041 1244 dbSNP
rs1026285790 1246 dbSNP
rs1425383089 1250 dbSNP
rs1164358160 1251 dbSNP
rs955655667 1254 dbSNP
rs1021024845 1255 dbSNP
rs1472575541 1255 dbSNP
rs1364562297 1257 dbSNP
rs1348343935 1258 dbSNP
rs767119114 1259 dbSNP
rs148150711 1262 dbSNP
rs1479656755 1265 dbSNP
rs752317427 1270 dbSNP
rs1223875568 1273 dbSNP
rs1377624632 1274 dbSNP
rs1017953266 1277 dbSNP
rs963742796 1287 dbSNP
rs771835759 1292 dbSNP
rs1355244287 1293 dbSNP
rs1279717564 1298 dbSNP
rs113538393 1302 dbSNP
rs1348319169 1307 dbSNP
rs1287716508 1308 dbSNP
rs117992873 1311 dbSNP
rs1351730263 1311 dbSNP
rs528157613 1312 dbSNP
rs1404791226 1315 dbSNP
rs1385965500 1316 dbSNP
rs1160446523 1324 dbSNP
rs377655982 1334 dbSNP
rs928509351 1336 dbSNP
rs1411672886 1337 dbSNP
rs1200840667 1339 dbSNP
rs1481686432 1346 dbSNP
rs938615055 1349 dbSNP
rs1056150491 1351 dbSNP
rs752893320 1359 dbSNP
rs78305399 1360 dbSNP
rs1319550294 1365 dbSNP
rs1210201845 1368 dbSNP
rs1038392259 1374 dbSNP
rs929118460 1376 dbSNP
rs983178023 1378 dbSNP
rs1267230698 1380 dbSNP
rs1456899250 1380 dbSNP
rs560179922 1381 dbSNP
rs994707650 1384 dbSNP
rs1047227326 1385 dbSNP
rs550486832 1391 dbSNP
rs1327098377 1395 dbSNP
rs1473362152 1395 dbSNP
rs189969462 1399 dbSNP
rs1388417451 1408 dbSNP
rs1018569023 1409 dbSNP
rs963690764 1410 dbSNP
rs1423698972 1411 dbSNP
rs546402087 1411 dbSNP
rs1477445590 1416 dbSNP
rs867655486 1424 dbSNP
rs1021357117 1428 dbSNP
rs1411847949 1430 dbSNP
rs777303490 1433 dbSNP
rs1190158408 1435 dbSNP
rs1171597060 1441 dbSNP
rs1399689492 1442 dbSNP
rs949769656 1448 dbSNP
rs370487073 1456 dbSNP
rs1044450917 1464 dbSNP
rs1448570233 1466 dbSNP
rs1276502251 1476 dbSNP
rs773558976 1482 dbSNP
rs1340207577 1483 dbSNP
rs1299879010 1486 dbSNP
rs757031802 1489 dbSNP
rs1337568445 1502 dbSNP
rs539244401 1505 dbSNP
rs1376635080 1508 dbSNP
rs1357778161 1510 dbSNP
rs928480249 1510 dbSNP
rs531882722 1511 dbSNP
rs960173044 1513 dbSNP
rs938270264 1527 dbSNP
rs1169965247 1530 dbSNP
rs1447072718 1531 dbSNP
rs1389174653 1532 dbSNP
rs767572462 1532 dbSNP
rs1484146744 1533 dbSNP
rs553930264 1534 dbSNP
rs1053999853 1535 dbSNP
rs1196192376 1537 dbSNP
rs1276628951 1541 dbSNP
rs893994390 1551 dbSNP
rs915845713 1557 dbSNP
rs1341460940 1559 dbSNP
rs755926075 1563 dbSNP
rs546405384 1564 dbSNP
rs1377493564 1565 dbSNP
rs10117044 1569 dbSNP
rs878883486 1583 dbSNP
rs1443328292 1588 dbSNP
rs1372964738 1589 dbSNP
rs536388682 1590 dbSNP
rs1008935498 1592 dbSNP
rs1047627660 1594 dbSNP
rs1165104758 1594 dbSNP
rs1369389202 1594 dbSNP
rs1478985764 1596 dbSNP
rs1472762703 1598 dbSNP
rs1253888738 1601 dbSNP
rs1018032823 1602 dbSNP
rs1423114087 1603 dbSNP
rs1476916778 1611 dbSNP
rs1174387211 1613 dbSNP
rs752109598 1619 dbSNP
rs891283864 1620 dbSNP
rs1414991861 1625 dbSNP
rs964705368 1627 dbSNP
rs1312214301 1632 dbSNP
rs1333384095 1634 dbSNP
rs554521206 1642 dbSNP
rs1409730136 1643 dbSNP
rs41270107 1643 dbSNP
rs1039957274 1645 dbSNP
rs867696524 1649 dbSNP
rs950583784 1650 dbSNP
rs1298490927 1655 dbSNP
rs753485120 1660 dbSNP
rs1293637878 1667 dbSNP
rs983228747 1674 dbSNP
rs781245953 1676 dbSNP
rs1458949031 1678 dbSNP
rs917044103 1681 dbSNP
rs1339437413 1685 dbSNP
rs543276899 1689 dbSNP
rs1457629464 1690 dbSNP
rs979842565 1691 dbSNP
rs967487963 1692 dbSNP
rs998601833 1693 dbSNP
rs528890812 1694 dbSNP
rs1487510372 1697 dbSNP
rs1265151676 1698 dbSNP
rs1035870599 1705 dbSNP
rs558834333 1707 dbSNP
rs1331721467 1709 dbSNP
rs959876377 1710 dbSNP
rs1469224031 1711 dbSNP
rs576915731 1717 dbSNP
rs1346719122 1721 dbSNP
rs181229830 1723 dbSNP
rs1054051513 1726 dbSNP
rs1364866398 1727 dbSNP
rs1489485146 1736 dbSNP
rs1435331525 1737 dbSNP
rs1390609327 1739 dbSNP
rs770004989 1741 dbSNP
rs945568324 1742 dbSNP
rs1262828154 1743 dbSNP
rs1378144050 1743 dbSNP
rs1042573636 1760 dbSNP
rs890597455 1768 dbSNP
rs186165493 1770 dbSNP
rs1189501399 1773 dbSNP
rs1266733859 1773 dbSNP
rs1201156437 1778 dbSNP
rs919933045 1779 dbSNP
rs1378310775 1784 dbSNP
rs150642113 1790 dbSNP
rs900515422 1791 dbSNP
rs1309978128 1795 dbSNP
rs1302022763 1796 dbSNP
rs1228437631 1800 dbSNP
rs994784760 1805 dbSNP
rs1318047267 1807 dbSNP
rs1393178756 1811 dbSNP
rs1402628818 1812 dbSNP
rs11557562 1813 dbSNP
rs1304565802 1815 dbSNP
rs1027553260 1816 dbSNP
rs1421353188 1818 dbSNP
rs1298543057 1821 dbSNP
rs1359554505 1822 dbSNP
rs1380189504 1824 dbSNP
rs1325070862 1825 dbSNP
rs773331228 1829 dbSNP
rs866415995 1831 dbSNP
rs944159536 1831 dbSNP
rs1451345744 1832 dbSNP
rs1273644001 1834 dbSNP
rs541976768 1838 dbSNP
rs1241382141 1839 dbSNP
rs1285730524 1843 dbSNP
rs1258673538 1848 dbSNP
rs1351910943 1849 dbSNP
rs976065752 1850 dbSNP
rs550804968 1852 dbSNP
rs1275906402 1854 dbSNP
rs1343679719 1860 dbSNP
rs547498176 1860 dbSNP
rs1043357042 1862 dbSNP
rs1226213180 1863 dbSNP
rs1340886935 1866 dbSNP
rs190446935 1870 dbSNP
rs530537633 1873 dbSNP
rs1196836229 1876 dbSNP
rs1251102340 1880 dbSNP
rs998944473 1880 dbSNP
rs1035416105 1884 dbSNP
rs895560890 1887 dbSNP
rs550181741 1889 dbSNP
rs140055182 1890 dbSNP
rs771175549 1891 dbSNP
rs181946148 1892 dbSNP
rs1164655023 1893 dbSNP
rs757941366 1894 dbSNP
rs551589125 1898 dbSNP
rs957053722 1910 dbSNP
rs1390990218 1912 dbSNP
rs1356643430 1914 dbSNP
rs989795536 1915 dbSNP
rs760111236 1919 dbSNP
rs915532504 1920 dbSNP
rs768139360 1929 dbSNP
rs1042608012 1930 dbSNP
rs1411556406 1934 dbSNP
rs1348747873 1937 dbSNP
rs912067547 1940 dbSNP
rs963213982 1940 dbSNP
rs1405974955 1941 dbSNP
rs1393156317 1942 dbSNP
rs944864765 1944 dbSNP
rs1413138672 1945 dbSNP
rs141972898 1945 dbSNP
rs1185023724 1950 dbSNP
rs566703509 1951 dbSNP
rs1309082257 1954 dbSNP
rs900567058 1957 dbSNP
rs1180489873 1959 dbSNP
rs1451611803 1960 dbSNP
rs994836106 1961 dbSNP
rs1049042823 1968 dbSNP
rs1333955771 1969 dbSNP
rs1268487971 1974 dbSNP
rs1229955536 1976 dbSNP
rs1247424868 1977 dbSNP
rs1266327969 1982 dbSNP
rs1278821880 1989 dbSNP
rs1437366171 1990 dbSNP
rs565981273 1993 dbSNP
rs186555025 1997 dbSNP
rs1355865188 2002 dbSNP
rs536330388 2004 dbSNP
rs1004759298 2006 dbSNP
rs1458236319 2008 dbSNP
rs1024199751 2009 dbSNP
rs1455925584 2009 dbSNP
rs1411877822 2011 dbSNP
rs1247925016 2013 dbSNP
rs191947037 2013 dbSNP
rs1417146938 2016 dbSNP
rs1189357150 2022 dbSNP
rs1001360482 2025 dbSNP
rs1472249435 2033 dbSNP
rs146294439 2034 dbSNP
rs1401848210 2035 dbSNP
rs921425386 2043 dbSNP
rs957102681 2045 dbSNP
rs745906120 2046 dbSNP
rs569685449 2049 dbSNP
rs1273187733 2056 dbSNP
rs1233597698 2058 dbSNP
rs1322734375 2059 dbSNP
rs1366218716 2059 dbSNP
rs1433431721 2059 dbSNP
rs989866044 2060 dbSNP
rs1331327866 2061 dbSNP
rs112683111 2063 dbSNP
rs967014575 2064 dbSNP
rs1171221213 2065 dbSNP
rs558529252 2066 dbSNP
rs763760150 2067 dbSNP
rs1190098467 2071 dbSNP
rs934308578 2074 dbSNP
rs1057202746 2076 dbSNP
rs112638758 2077 dbSNP
rs1444090140 2078 dbSNP
rs182958765 2083 dbSNP
rs1210262821 2084 dbSNP
rs1342956089 2085 dbSNP
rs1300166345 2086 dbSNP
rs1226426342 2094 dbSNP
rs541011517 2097 dbSNP
rs1361742245 2098 dbSNP
rs1318714140 2101 dbSNP
rs1022701147 2102 dbSNP
rs1198078603 2105 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 55667.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 "HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase "PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 55667.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A PAR-CLIP data was present in SRX1760591. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_B PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A PAR-CLIP data was present in SRX1760641. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_B ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000380432.2 | 3UTR | GCAAAAACCGCAAUUAUUUUUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714643
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000380432.2 | 3UTR | CAAAAACCGCAAUUAUUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000380432.2 | 3UTR | CAAAAACCGCAAUUAUUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000380432.2 | 3UTR | CAAAAACCGCAAUUAUUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000380432.2 | 3UTR | CAAAAACCGCAAUUAUUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000380432.2 | 3UTR | UUAAUGGCAAAAACCGCAAUUAUUUUUGUACCAACAUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000380432.2 | 3UTR | CAAAAACCGCAAUUAUUUUUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000380432.2 | 3UTR | AUGGCAAAAACCGCAAUUAUUUUUGUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM714647
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repB
Location of target site ENST00000380432.2 | 3UTR | UGGCAAAAACCGCAAUUAUUUUUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000380432.2 | 3UTR | AUGGCAAAAACCGCAAUUAUUUUUGUACCAACAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000380432.2 | 3UTR | CAAAAACCGCAAUUAUUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000380432.2 | 3UTR | CAAAAACCGCAAUUAUUUUUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000380432.2 | 3UTR | GCAAAAACCGCAAUUAUUUUUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 14 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000380432.2 | 3UTR | CAAAAACCGCAAUUAUUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
69 hsa-miR-5590-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT056313 WAC WW domain containing adaptor with coiled-coil 2 6
MIRT066181 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 2 2
MIRT095612 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT099166 MYLIP myosin regulatory light chain interacting protein 2 2
MIRT107578 VLDLR very low density lipoprotein receptor 2 2
MIRT179602 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 2 8
MIRT241303 ZC3H12C zinc finger CCCH-type containing 12C 2 8
MIRT244620 MCM4 minichromosome maintenance complex component 4 2 2
MIRT270705 SBNO1 strawberry notch homolog 1 2 4
MIRT453616 SNRPE small nuclear ribonucleoprotein polypeptide E 2 4
MIRT453653 RAB6C RAB6C, member RAS oncogene family 2 2
MIRT464159 VMP1 vacuole membrane protein 1 2 15
MIRT477720 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 2 2
MIRT484301 ENDOD1 endonuclease domain containing 1 2 4
MIRT496069 GLCCI1 glucocorticoid induced 1 2 2
MIRT496338 TMEM81 transmembrane protein 81 2 2
MIRT496653 PITPNM3 PITPNM family member 3 2 2
MIRT499098 DENND4C DENN domain containing 4C 2 8
MIRT499862 SVOP SV2 related protein 2 12
MIRT504913 CD38 CD38 molecule 2 4
MIRT515401 WDR72 WD repeat domain 72 2 4
MIRT518156 TMEM133 transmembrane protein 133 2 2
MIRT518558 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT518636 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT518724 ABCG8 ATP binding cassette subfamily G member 8 2 2
MIRT524301 CTC1 CST telomere replication complex component 1 2 4
MIRT524472 CHRM3 cholinergic receptor muscarinic 3 2 4
MIRT527562 ADCY7 adenylate cyclase 7 2 2
MIRT532694 TCN2 transcobalamin 2 2 4
MIRT534640 RNF6 ring finger protein 6 2 2
MIRT537163 GGCX gamma-glutamyl carboxylase 2 2
MIRT539360 AFF4 AF4/FMR2 family member 4 2 2
MIRT547023 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT548155 FRAT2 FRAT2, WNT signaling pathway regulator 2 2
MIRT550127 ZNF138 zinc finger protein 138 2 2
MIRT558473 DBN1 drebrin 1 2 2
MIRT566862 LRRC58 leucine rich repeat containing 58 2 2
MIRT567246 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT572848 BRPF3 bromodomain and PHD finger containing 3 2 2
MIRT574914 Vmp1 vacuole membrane protein 1 2 9
MIRT606849 RAB7A RAB7A, member RAS oncogene family 2 2
MIRT611274 RBMXL1 RNA binding motif protein, X-linked like 1 2 2
MIRT612328 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT612415 SP1 Sp1 transcription factor 2 2
MIRT614791 RRAGC Ras related GTP binding C 2 2
MIRT618449 SERPINA3 serpin family A member 3 2 2
MIRT621154 MICALCL MICAL C-terminal like 2 2
MIRT622141 SOX4 SRY-box 4 2 2
MIRT623504 KCNK5 potassium two pore domain channel subfamily K member 5 2 2
MIRT623598 IPO9 importin 9 2 2
MIRT624075 EBF1 early B-cell factor 1 2 2
MIRT639792 MVK mevalonate kinase 2 2
MIRT641109 ZNF274 zinc finger protein 274 2 2
MIRT641579 RFX1 regulatory factor X1 2 2
MIRT643095 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT645141 CUBN cubilin 2 2
MIRT646461 PRDM10 PR/SET domain 10 2 2
MIRT650815 HMOX1 heme oxygenase 1 2 2
MIRT653073 ST8SIA4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 2 2
MIRT657675 GPR26 G protein-coupled receptor 26 2 2
MIRT665824 TIMM8B translocase of inner mitochondrial membrane 8 homolog B 2 2
MIRT695592 TMEM199 transmembrane protein 199 2 2
MIRT698039 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT701015 PCGF5 polycomb group ring finger 5 2 2
MIRT701357 NR4A3 nuclear receptor subfamily 4 group A member 3 2 2
MIRT707114 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT718661 HNF4A hepatocyte nuclear factor 4 alpha 2 2
MIRT719901 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT720564 C1RL complement C1r subcomponent like 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-5590-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)

Error report submission