miRTarBase - #MIRT499175


—
pre-miRNA Information
pre-miRNA hsa-mir-4271   
Genomic Coordinates chr3: 49274120 - 49274186
Description Homo sapiens miR-4271 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4271
Sequence 39| GGGGGAAGAAAAGGUGGGG |57
Evidence Experimental
Experiments SOLiD
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30481495 1 COSMIC
COSN31532060 5 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760829741 1 dbSNP
rs1277951968 2 dbSNP
rs189148716 3 dbSNP
rs757021935 4 dbSNP
rs1285201145 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RBPJL   
Synonyms RBPL, RBPSUHL, SUHL
Description recombination signal binding protein for immunoglobulin kappa J region like
Transcript NM_014276   
Expression
Putative miRNA Targets on RBPJL
3'UTR of RBPJL
(miRNA target sites are highlighted)		 
>RBPJL|NM_014276|3'UTR
   1 GCGCGCCCGGTAGCCCCGGCTGCCCACCCTGGAGGGCTGCGCCCGCGCCAGGCGCGGGGACGTGTTTCTGGGTTCTAGGC
  81 CCTGCTTCCTTGCCCCTTTGCTGCAGAAGGGCAGCTGAAGGCTCACCCTAGAAACCGGGCCTGGTGGGTCTTACCCGGCT
 161 CACTCCCTCCCTTGTCCTTACACATACAGGAAGACAAGACCTGAGTGGTGCTGTCTTTGTGTCCGTCGTGTATGGCTCTC
 241 CCTGTCTTCATTTCTTCTCACTCTGTCTCTAAACCTCTCTCTCTCTCCCTTCCCCCTCAGTACTTAGTCTACAGACCTAT
 321 GTGCGTGTCCCTATCCTTCTGTCCTTTTCTCTCTTCAGCTCTCCCTGCCTCTCACACACAATTTTACATGCCCCGAGGAG
 401 CCAAGTTTGGGACATTTACCCTCCAGGCATCTGTGTCCCCTCTTGAAGAGAAAACACACAGCTTCACACATCCAGGCATA
 481 GGGGGCAAGCTCTTGGGGCATCAGGACCCTGGAGCACCAGGTCCTTCCTGGAATATTAGATCCACCTGGAGCACCGGGTC
 561 TCTCTAAGTCTCACCTGGGGAATTCGGTCCCACCTGGGGCACCAGTTCCCACCTAGAGCACTGTGTCCTGCCCTAGAGCA
 641 CAAAGACCTGCTCCTCCCGAGACTCTCTCTGACTGCAGCCAGGCATAGTACCTTTGCCTGTGTTTGCTCCCTGGTCCACA
 721 GATTTGGTGGCTGGGCAGGTGCCTGGACAGTGATGAGGTCTTGCCGCCTTAACTGTCCCCCCCAGTCACTTCTCCCACAG
 801 GCCCAGCAGGACGCAGTCCTGAGGATCAGGGATTCTACAGCTGCATTAAAATCAATCCTATCCAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggGGUGGAAAAGAAGGGGg 5'
            :| |: |  ||||||| 
Target 5' tcTCTCTCTCCCTTCCCCc 3'
 278 - 296 145.00 -20.30
2 
miRNA  3' ggGGUGGAAAAGA-AGGGGg 5'
            ||:||||  || ||||| 
Target 5' tgCCGCCTTAACTGTCCCCc 3'
 762 - 781 133.00 -23.80
3 
miRNA  3' ggGGUGGAAAAGAAGGGgg 5'
            :| :| |||||||:|  
Target 5' tgTCTTCATTTCTTCTCac 3'
 243 - 261 125.00 -12.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30190371 7 COSMIC
COSN30115686 9 COSMIC
COSN31614151 27 COSMIC
COSN30482454 33 COSMIC
COSN20079737 42 COSMIC
COSN30495673 46 COSMIC
COSN31614282 52 COSMIC
COSN30495185 56 COSMIC
COSN26991823 57 COSMIC
COSN30501412 101 COSMIC
COSN30178166 109 COSMIC
COSN30675001 126 COSMIC
COSN9130127 225 COSMIC
COSN29636973 287 COSMIC
COSN1249373 323 COSMIC
COSN17183728 573 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1305428088 3 dbSNP
rs1354002190 4 dbSNP
rs1232879836 5 dbSNP
rs1379580175 7 dbSNP
rs1229852321 8 dbSNP
rs765578435 9 dbSNP
rs773897367 10 dbSNP
rs1356797975 14 dbSNP
rs141143704 18 dbSNP
rs567427124 19 dbSNP
rs770239125 21 dbSNP
rs752255340 23 dbSNP
rs1239856225 24 dbSNP
rs755609666 28 dbSNP
rs60565951 30 dbSNP
rs775956017 30 dbSNP
rs746635547 32 dbSNP
rs753708797 35 dbSNP
rs2743338 38 dbSNP
rs757019467 41 dbSNP
rs778725048 44 dbSNP
rs879697571 44 dbSNP
rs1167129265 45 dbSNP
rs746111042 47 dbSNP
rs1419007118 48 dbSNP
rs549794658 51 dbSNP
rs763061513 51 dbSNP
rs758690415 52 dbSNP
rs1193296454 53 dbSNP
rs1209928521 54 dbSNP
rs570009280 57 dbSNP
rs947270863 58 dbSNP
rs538601085 60 dbSNP
rs1187206423 62 dbSNP
rs1294506865 63 dbSNP
rs558804252 72 dbSNP
rs2743340 76 dbSNP
rs1215469497 78 dbSNP
rs1335312161 81 dbSNP
rs977665171 86 dbSNP
rs1257196019 93 dbSNP
rs1043180504 96 dbSNP
rs924768158 97 dbSNP
rs960170179 103 dbSNP
rs1295800774 108 dbSNP
rs2743341 116 dbSNP
rs1385775840 117 dbSNP
rs1364853707 123 dbSNP
rs924396858 125 dbSNP
rs565794061 127 dbSNP
rs1463475121 137 dbSNP
rs1395775902 138 dbSNP
rs534814616 146 dbSNP
rs554776269 147 dbSNP
rs947806100 156 dbSNP
rs1171359243 157 dbSNP
rs1044728600 160 dbSNP
rs919631347 167 dbSNP
rs1485329974 172 dbSNP
rs1208038437 181 dbSNP
rs768389074 183 dbSNP
rs79587050 185 dbSNP
rs887041381 190 dbSNP
rs1468869437 193 dbSNP
rs559572904 194 dbSNP
rs1427104946 204 dbSNP
rs905344080 205 dbSNP
rs1006410841 207 dbSNP
rs1232055516 213 dbSNP
rs1310003172 216 dbSNP
rs1304999873 224 dbSNP
rs1440934899 225 dbSNP
rs1016298661 226 dbSNP
rs1008021232 227 dbSNP
rs1390069077 228 dbSNP
rs368071002 229 dbSNP
rs899904630 231 dbSNP
rs1311104202 234 dbSNP
rs997376161 237 dbSNP
rs962111528 242 dbSNP
rs2741499 244 dbSNP
rs1175624602 254 dbSNP
rs767612933 261 dbSNP
rs1030309597 275 dbSNP
rs146222644 280 dbSNP
rs186143687 297 dbSNP
rs968717766 305 dbSNP
rs1199601797 306 dbSNP
rs2743342 310 dbSNP
rs998827184 312 dbSNP
rs1482081001 313 dbSNP
rs968955397 317 dbSNP
rs1301745393 321 dbSNP
rs576770809 325 dbSNP
rs924322116 329 dbSNP
rs934400219 330 dbSNP
rs780065768 334 dbSNP
rs190665926 335 dbSNP
rs1287467203 336 dbSNP
rs1329984530 336 dbSNP
rs1395757315 342 dbSNP
rs1373901933 343 dbSNP
rs1314964777 358 dbSNP
rs992979320 360 dbSNP
rs1488324862 361 dbSNP
rs1214538118 362 dbSNP
rs1435466983 369 dbSNP
rs1359962028 373 dbSNP
rs565583797 382 dbSNP
rs1239975347 388 dbSNP
rs916930452 392 dbSNP
rs1193238662 395 dbSNP
rs116771043 396 dbSNP
rs1421793680 397 dbSNP
rs749513921 419 dbSNP
rs969163506 426 dbSNP
rs980954240 430 dbSNP
rs549498670 433 dbSNP
rs1487709701 440 dbSNP
rs867262213 470 dbSNP
rs541251282 472 dbSNP
rs561128811 486 dbSNP
rs139170557 487 dbSNP
rs1280606667 497 dbSNP
rs1244564265 498 dbSNP
rs144105431 509 dbSNP
rs760963814 517 dbSNP
rs943987455 518 dbSNP
rs78503204 522 dbSNP
rs112467781 540 dbSNP
rs1238251961 542 dbSNP
rs1473903777 543 dbSNP
rs932737481 546 dbSNP
rs1043092458 547 dbSNP
rs1326255372 553 dbSNP
rs552240636 554 dbSNP
rs1369994130 555 dbSNP
rs998774876 556 dbSNP
rs3092510 557 dbSNP
rs534881319 561 dbSNP
rs1419746576 564 dbSNP
rs1354377119 568 dbSNP
rs896064242 569 dbSNP
rs1260527977 576 dbSNP
rs1017931826 578 dbSNP
rs1447045171 584 dbSNP
rs77589182 586 dbSNP
rs1023116250 587 dbSNP
rs1333230819 588 dbSNP
rs1275442815 592 dbSNP
rs11477569 593 dbSNP
rs970659896 599 dbSNP
rs568239279 603 dbSNP
rs1234226509 604 dbSNP
rs924457384 606 dbSNP
rs973584998 610 dbSNP
rs1433033169 617 dbSNP
rs992562420 625 dbSNP
rs115527805 631 dbSNP
rs6032112 640 dbSNP
rs1165407223 648 dbSNP
rs982436180 654 dbSNP
rs1416997092 660 dbSNP
rs908241075 662 dbSNP
rs1475487004 664 dbSNP
rs943949042 665 dbSNP
rs1196045127 666 dbSNP
rs1467540267 668 dbSNP
rs977101094 669 dbSNP
rs1255394462 671 dbSNP
rs576825447 676 dbSNP
rs1214744604 682 dbSNP
rs1317650394 690 dbSNP
rs2741497 694 dbSNP
rs932454288 699 dbSNP
rs1042875150 711 dbSNP
rs904584165 726 dbSNP
rs934782946 740 dbSNP
rs774612016 756 dbSNP
rs1445835488 759 dbSNP
rs556244895 766 dbSNP
rs145987882 767 dbSNP
rs904414714 773 dbSNP
rs1423955926 777 dbSNP
rs1014496023 781 dbSNP
rs1390830989 782 dbSNP
rs1000519809 783 dbSNP
rs541300845 784 dbSNP
rs906116287 785 dbSNP
rs1394110591 796 dbSNP
rs1031620196 798 dbSNP
rs1231527660 809 dbSNP
rs1206981493 811 dbSNP
rs561192236 813 dbSNP
rs1333178868 814 dbSNP
rs139623856 824 dbSNP
rs952436822 827 dbSNP
rs1350116462 833 dbSNP
rs1441433304 839 dbSNP
rs543610936 840 dbSNP
rs1277197755 844 dbSNP
rs1239328867 846 dbSNP
rs1003985619 857 dbSNP
rs1233432953 861 dbSNP
rs1024465320 866 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggGGUGGAAAAGAAGGGGg 5'
            :| |: |  ||||||| 
Target 5' ucUCUCUCUCCCUUCCCC- 3'
 		6 - 23
Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM4903825
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_NS
Location of target site NM_014276 | 3UTR | CUCCCUUCCCCCUCAGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000372741.3 | 3UTR | ACCUCUCUCUCUCUCCCUUCCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
181 hsa-miR-4271 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066209 MARCH9 membrane associated ring-CH-type finger 9 2 2
MIRT079367 CCDC137 coiled-coil domain containing 137 2 2
MIRT081183 MIDN midnolin 2 4
MIRT083278 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT086207 HOXD13 homeobox D13 2 2
MIRT133713 SKI SKI proto-oncogene 2 4
MIRT150653 SLC27A1 solute carrier family 27 member 1 2 2
MIRT159166 NRBP1 nuclear receptor binding protein 1 2 2
MIRT160059 TET3 tet methylcytosine dioxygenase 3 2 4
MIRT180856 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT181931 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT190628 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT190654 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT196107 MPRIP myosin phosphatase Rho interacting protein 2 2
MIRT263248 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT321168 EIF4H eukaryotic translation initiation factor 4H 2 2
MIRT338624 SHMT2 serine hydroxymethyltransferase 2 2 2
MIRT366301 GDI1 GDP dissociation inhibitor 1 2 4
MIRT375172 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT441488 NCEH1 neutral cholesterol ester hydrolase 1 2 2
MIRT442333 WNT9B Wnt family member 9B 2 2
MIRT443889 CNKSR3 CNKSR family member 3 2 2
MIRT445880 WBP1L WW domain binding protein 1 like 2 2
MIRT449312 MRO maestro 2 2
MIRT449844 BCL2L13 BCL2 like 13 2 2
MIRT450304 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT450515 EMX1 empty spiracles homeobox 1 2 2
MIRT451243 ZNF444 zinc finger protein 444 2 2
MIRT451713 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT451792 TLR5 toll like receptor 5 2 2
MIRT451823 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT451906 ILK integrin linked kinase 2 2
MIRT452181 KIAA1456 KIAA1456 2 4
MIRT452242 TRAM1 translocation associated membrane protein 1 2 2
MIRT452544 ZNF467 zinc finger protein 467 2 2
MIRT452605 REPIN1 replication initiator 1 2 2
MIRT454505 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT454657 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT455354 KDM5C lysine demethylase 5C 2 2
MIRT455452 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT455587 TAF12 TATA-box binding protein associated factor 12 2 2
MIRT456501 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 2 2
MIRT456815 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT457425 NOL10 nucleolar protein 10 2 2
MIRT457468 SLC35F6 solute carrier family 35 member F6 2 2
MIRT457660 SERINC1 serine incorporator 1 2 2
MIRT458231 NXPH3 neurexophilin 3 2 2
MIRT458374 ITM2C integral membrane protein 2C 2 2
MIRT458667 GPR35 G protein-coupled receptor 35 2 2
MIRT459665 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT459825 TPP1 tripeptidyl peptidase 1 2 2
MIRT460564 FEM1A fem-1 homolog A 2 2
MIRT460725 ASXL3 additional sex combs like 3, transcriptional regulator 2 2
MIRT461121 RAB36 RAB36, member RAS oncogene family 2 2
MIRT461529 C14orf1 ergosterol biosynthesis 28 homolog 2 2
MIRT461750 DDX11 DEAD/H-box helicase 11 2 2
MIRT462570 STS steroid sulfatase 2 2
MIRT462798 NTN1 netrin 1 2 2
MIRT463030 ZNF689 zinc finger protein 689 2 2
MIRT463991 WDTC1 WD and tetratricopeptide repeats 1 2 2
MIRT464684 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT465439 TP53 tumor protein p53 2 2
MIRT465512 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT465649 TNPO2 transportin 2 2 10
MIRT465947 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT466028 TMEM189 transmembrane protein 189 2 2
MIRT468076 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT468131 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT468498 SESN2 sestrin 2 2 2
MIRT468879 RREB1 ras responsive element binding protein 1 2 2
MIRT469318 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT469558 RARA retinoic acid receptor alpha 2 2
MIRT469793 RAB15 RAB15, member RAS oncogene family 2 2
MIRT469896 PTRF caveolae associated protein 1 2 2
MIRT470235 PRRC2A proline rich coiled-coil 2A 2 2
MIRT470808 PLXND1 plexin D1 2 2
MIRT471597 PAQR5 progestin and adipoQ receptor family member 5 2 10
MIRT471710 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT471752 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 2
MIRT472978 MRRF mitochondrial ribosome recycling factor 2 2
MIRT473538 MAX MYC associated factor X 2 2
MIRT473581 MAT2A methionine adenosyltransferase 2A 2 2
MIRT473970 LRRC58 leucine rich repeat containing 58 2 2
MIRT474223 LCOR ligand dependent nuclear receptor corepressor 2 4
MIRT474553 KLHDC3 kelch domain containing 3 2 2
MIRT474777 KIAA0895L KIAA0895 like 2 2
MIRT476042 GRSF1 G-rich RNA sequence binding factor 1 2 2
MIRT476438 GBA2 glucosylceramidase beta 2 2 2
MIRT477773 E2F3 E2F transcription factor 3 2 4
MIRT477946 DPM2 dolichyl-phosphate mannosyltransferase subunit 2, regulatory 2 2
MIRT478782 CRTC2 CREB regulated transcription coactivator 2 2 2
MIRT479320 VPS72 vacuolar protein sorting 72 homolog 2 2
MIRT480405 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT480593 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT480963 BBC3 BCL2 binding component 3 2 2
MIRT481127 AZIN1 antizyme inhibitor 1 2 4
MIRT481444 ARRB2 arrestin beta 2 2 2
MIRT481687 AR androgen receptor 2 2
MIRT481730 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT482386 AEN apoptosis enhancing nuclease 2 2
MIRT482564 ABHD2 abhydrolase domain containing 2 2 2
MIRT482605 ABHD14B abhydrolase domain containing 14B 2 2
MIRT483256 CITED4 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 4 2 4
MIRT483531 TAGLN2 transgelin 2 2 2
MIRT483840 UNC5B unc-5 netrin receptor B 2 4
MIRT483935 LENG8 leukocyte receptor cluster member 8 2 4
MIRT484414 SNX19 sorting nexin 19 2 2
MIRT484487 SLC9A1 solute carrier family 9 member A1 2 2
MIRT484609 SIX3 SIX homeobox 3 2 6
MIRT484703 RNF11 ring finger protein 11 2 2
MIRT485244 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT485607 FOSL1 FOS like 1, AP-1 transcription factor subunit 2 4
MIRT485965 RTBDN retbindin 2 2
MIRT487308 GLTSCR1 BRD4 interacting chromatin remodeling complex associated protein 2 2
MIRT487329 SREBF1 sterol regulatory element binding transcription factor 1 2 4
MIRT487410 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT487607 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT487689 CDK14 cyclin dependent kinase 14 2 2
MIRT487787 GPR20 G protein-coupled receptor 20 2 4
MIRT488026 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT488476 B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 2 2
MIRT488761 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT489161 MRPL12 mitochondrial ribosomal protein L12 2 4
MIRT489529 MRE11A MRE11 homolog, double strand break repair nuclease 2 8
MIRT489774 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT489878 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT490094 FN3K fructosamine 3 kinase 2 2
MIRT490202 PKNOX2 PBX/knotted 1 homeobox 2 2 2
MIRT490283 ISL2 ISL LIM homeobox 2 2 2
MIRT490377 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT491035 ALPK3 alpha kinase 3 2 2
MIRT491186 JUND JunD proto-oncogene, AP-1 transcription factor subunit 2 4
MIRT491766 ZNF385A zinc finger protein 385A 2 2
MIRT491888 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 2
MIRT491981 UNK unkempt family zinc finger 2 2
MIRT492400 SDK1 sidekick cell adhesion molecule 1 2 2
MIRT493647 HDLBP high density lipoprotein binding protein 2 2
MIRT494010 DUSP9 dual specificity phosphatase 9 2 2
MIRT494167 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 2
MIRT495712 PADI1 peptidyl arginine deiminase 1 2 2
MIRT496873 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT499175 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT501652 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT506645 MAPK1 mitogen-activated protein kinase 1 2 4
MIRT510590 TUBB2A tubulin beta 2A class IIa 2 6
MIRT511907 FKBP1A FK506 binding protein 1A 2 2
MIRT513063 ANKRD45 ankyrin repeat domain 45 2 2
MIRT513104 DYNAP dynactin associated protein 2 2
MIRT521804 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT523520 GLUL glutamate-ammonia ligase 2 2
MIRT525085 FRK fyn related Src family tyrosine kinase 2 2
MIRT530930 SCIN scinderin 2 2
MIRT533501 TRIM71 tripartite motif containing 71 2 2
MIRT538560 CECR2 CECR2, histone acetyl-lysine reader 2 2
MIRT544556 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT555912 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT560405 TMEM69 transmembrane protein 69 2 2
MIRT560664 RTN3 reticulon 3 2 2
MIRT564061 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT565504 SP1 Sp1 transcription factor 2 2
MIRT570014 COL1A2 collagen type I alpha 2 chain 2 2
MIRT572321 HSPB6 heat shock protein family B (small) member 6 2 2
MIRT573229 TRIM21 tripartite motif containing 21 2 2
MIRT573487 IQSEC3 IQ motif and Sec7 domain 3 2 2
MIRT574137 MARVELD1 MARVEL domain containing 1 2 2
MIRT574323 ZNF703 zinc finger protein 703 2 2
MIRT620939 OSMR oncostatin M receptor 2 2
MIRT650080 MTL5 testis expressed metallothionein like protein 2 2
MIRT684553 ZNF708 zinc finger protein 708 2 2
MIRT685841 ANGEL1 angel homolog 1 2 2
MIRT688551 DCAF16 DDB1 and CUL4 associated factor 16 2 2
MIRT701985 MIER3 MIER family member 3 2 2
MIRT703899 EPT1 selenoprotein I 2 2
MIRT706388 MC2R melanocortin 2 receptor 2 2
MIRT707487 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT711885 INSIG2 insulin induced gene 2 2 2
MIRT719164 KIF6 kinesin family member 6 2 2
MIRT721294 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT721775 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT723763 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 2
MIRT725485 GPR26 G protein-coupled receptor 26 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miR-4271 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-miR-4271 Platinum-based doublet chemotherapy sensitive High Lung Adenocarcinoma tissue
hsa-miR-4271 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4271 Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PATU8988)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant Low Tongue Squamous Cell Carcinoma cell line (CAL-27, SCC-9)
hsa-miR-4271 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H460)
hsa-miR-4271 Anlotinib 25017411 NSC832523 sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Icotinib 22024915 NSC800770 sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Erlotinib 176870 NSC718781 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-4271 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-4271 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-4271 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-4271 Platinum-based doublet chemotherapy sensitive tissue (lung adenocarcinoma)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4271 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-4271 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4271 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4271 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission