pre-miRNA Information
pre-miRNA hsa-mir-4781   
Genomic Coordinates chr1: 54054079 - 54054154
Description Homo sapiens miR-4781 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4781-3p
Sequence 46| AAUGUUGGAAUCCUCGCUAGAG |67
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs968609764 2 dbSNP
rs899910686 3 dbSNP
rs74085143 4 dbSNP
rs550946107 8 dbSNP
rs747064911 10 dbSNP
rs1352517651 13 dbSNP
rs1436072914 22 dbSNP
Putative Targets

Gene Information
Gene Symbol ZNF485   
Synonyms -
Description zinc finger protein 485
Transcript NM_145312   
Expression
Putative miRNA Targets on ZNF485
3'UTR of ZNF485
(miRNA target sites are highlighted)
>ZNF485|NM_145312|3'UTR
   1 TGTGGCAAATTGTGCAGAGTAGTTTATTCCTTCTGACCATCATAGAGGAGACATTAAATAAATTATGCATTTAACAGAAA
  81 TACTCTGTACTTCTGAGAGAACACATCACTTGTGAGGATATTCATTGTGAGGTTCTACTAGTGAAATATTTGAAGAAACT
 161 AAATGTATGTCAGTATGGAAGTAGTTATAGCATACTGTGTGCTAATTGAAAAGAATGAGGTGGAGCTGTAAATACTGTAC
 241 AAAGCCAGGCATGGTGGCATATGCCTGTAGTCCCAGTTACTTGGGAGGCTGAGACAGGATTGCTTAAGCCCAGGAGTTTG
 321 AGTCTGTAATGCACTATGATTGTGCATGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCAAGACTCCATCTCTAA
 401 GTAAAAAAATACAACAGTAGAAATATACCCATGATAATATACCCAATATACCCTTGTTAAAGAAGCAAGTTTCAGGAAAT
 481 CTATATTATATGCATTCAAAAAGACCTGGACAAATAAAGACCAATCTTAACAGCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gagAUCGCUCCUA----A--GGUUGUAa 5'
             || | | |||    |  ||||:|| 
Target 5' ataTACCCATGATAATATACCCAATATa 3'
423 - 450 131.00 -6.00
2
miRNA  3' gaGAUCGCUCCUAAGGUUGUAa 5'
            | |||  ||:   |||||| 
Target 5' ctCCAGCCTGGG---CAACATa 3'
364 - 382 124.00 -12.30
3
miRNA  3' gaGAUCGCUCCUA-AGGUUGUAa 5'
            || |:|||||| |:|| ::| 
Target 5' caCTTGTGAGGATATTCATTGTg 3'
107 - 129 100.00 -14.13
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31610701 3 COSMIC
COSN31612514 18 COSMIC
COSN30447073 46 COSMIC
COSN30129341 51 COSMIC
COSN30639236 59 COSMIC
COSN31492325 72 COSMIC
COSN13273305 78 COSMIC
COSN30147955 86 COSMIC
COSN31482106 96 COSMIC
COSN18734920 185 COSMIC
COSN16016523 267 COSMIC
COSN5285997 325 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs753090584 2 dbSNP
rs1404480891 3 dbSNP
rs1323665180 4 dbSNP
rs1422244578 8 dbSNP
rs961264811 17 dbSNP
rs1402270491 18 dbSNP
rs375139316 20 dbSNP
rs368148555 30 dbSNP
rs750125584 38 dbSNP
rs79911570 39 dbSNP
rs952489793 49 dbSNP
rs779823048 51 dbSNP
rs1027364897 54 dbSNP
rs916335607 60 dbSNP
rs1266640652 63 dbSNP
rs949529016 66 dbSNP
rs954330632 67 dbSNP
rs1297864467 75 dbSNP
rs1276156751 86 dbSNP
rs1339759499 88 dbSNP
rs982234405 94 dbSNP
rs1367757345 100 dbSNP
rs1219005289 104 dbSNP
rs986085492 106 dbSNP
rs912751730 109 dbSNP
rs761115762 118 dbSNP
rs1165007931 123 dbSNP
rs1456595429 124 dbSNP
rs1384908394 128 dbSNP
rs762427461 137 dbSNP
rs1319523363 150 dbSNP
rs935582415 154 dbSNP
rs1451141207 157 dbSNP
rs528221222 159 dbSNP
rs1192405926 160 dbSNP
rs988963729 161 dbSNP
rs1452065942 162 dbSNP
rs1268863618 172 dbSNP
rs1265689814 175 dbSNP
rs1207617212 178 dbSNP
rs893774041 179 dbSNP
rs41313824 185 dbSNP
rs1050503532 190 dbSNP
rs1213832137 191 dbSNP
rs1268749194 207 dbSNP
rs947121067 221 dbSNP
rs1478468577 236 dbSNP
rs754188548 239 dbSNP
rs571183710 243 dbSNP
rs1365001301 245 dbSNP
rs937293430 246 dbSNP
rs1057002335 247 dbSNP
rs1423627350 250 dbSNP
rs895725834 264 dbSNP
rs374059175 268 dbSNP
rs1388118654 273 dbSNP
rs538275932 296 dbSNP
rs994063456 298 dbSNP
rs1379369541 303 dbSNP
rs1014709770 311 dbSNP
rs1251849828 317 dbSNP
rs1490058273 317 dbSNP
rs897243306 323 dbSNP
rs1400587402 330 dbSNP
rs557197089 343 dbSNP
rs1026998450 370 dbSNP
rs1214407854 375 dbSNP
rs970434450 382 dbSNP
rs1277158272 387 dbSNP
rs954158197 388 dbSNP
rs1344988571 404 dbSNP
rs924105559 407 dbSNP
rs1411899862 413 dbSNP
rs1353039672 414 dbSNP
rs1328435437 417 dbSNP
rs1414867570 423 dbSNP
rs985457801 437 dbSNP
rs1174215457 438 dbSNP
rs1019906029 446 dbSNP
rs145148417 454 dbSNP
rs1183640667 467 dbSNP
rs1227548740 467 dbSNP
rs1471315900 470 dbSNP
rs559676272 473 dbSNP
rs1232019126 477 dbSNP
rs114462640 482 dbSNP
rs1361240683 484 dbSNP
rs535453673 491 dbSNP
rs1237310014 494 dbSNP
rs1202356567 512 dbSNP
rs1323364766 522 dbSNP
rs932281005 532 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 220992.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 220992.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gaGAUCGCUCCUAAGGUUGUAa 5'
            | |||  ||:   |||||| 
Target 5' cuCCAGCCUGGG---CAACAUa 3'
18 - 36
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gaGAUCGCUCCUAAGGUUGUAa 5'
            | |||  ||:   |||||| 
Target 5' cuCCAGCCUGGG---CAACAUa 3'
14 - 32
Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_145312 | 3UTR | CAACAUAGCAAGACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714643
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000361807.3 | 3UTR | GCAUGUGAAUAGCCACUGCACUCCAGCCUGGGCAACAUAGCAAGACUCCAUCUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000361807.3 | 3UTR | UGCAUGUGAAUAGCCACUGCACUCCAGCCUGGGCAACAUAGCAAGACUCCAUCUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000361807.3 | 3UTR | GUGAAUAGCCACUGCACUCCAGCCUGGGCAACAUAGCAAGACUCCAUCUCUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000361807.3 | 3UTR | UGUGAAUAGCCACUGCACUCCAGCCUGGGCAACAUAGCAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000361807.3 | 3UTR | AAUAGCCACUGCACUCCAGCCUGGGCAACAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
204 hsa-miR-4781-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT071728 CCNK cyclin K 2 2
MIRT184858 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT205881 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT218699 ANKS1A ankyrin repeat and sterile alpha motif domain containing 1A 2 2
MIRT223783 OXR1 oxidation resistance 1 2 2
MIRT242435 GAN gigaxonin 2 2
MIRT306825 NCBP2 nuclear cap binding protein subunit 2 2 2
MIRT334170 CCND1 cyclin D1 2 6
MIRT339617 TMPO thymopoietin 2 2
MIRT400371 C2ORF68 chromosome 2 open reading frame 68 2 2
MIRT445533 KIF1B kinesin family member 1B 2 4
MIRT450273 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT450701 RORA RAR related orphan receptor A 2 2
MIRT451160 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT453775 NUCB1 nucleobindin 1 2 10
MIRT453884 IFRD1 interferon related developmental regulator 1 2 12
MIRT454238 OSBPL10 oxysterol binding protein like 10 2 9
MIRT458661 PAGR1 PAXIP1 associated glutamate rich protein 1 2 12
MIRT466948 STAU1 staufen double-stranded RNA binding protein 1 2 2
MIRT470278 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 2
MIRT471144 PHF19 PHD finger protein 19 2 2
MIRT471873 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT476739 FOXN2 forkhead box N2 2 2
MIRT480453 C16orf72 chromosome 16 open reading frame 72 2 6
MIRT482107 AKT3 AKT serine/threonine kinase 3 2 4
MIRT483374 CYP4A22 cytochrome P450 family 4 subfamily A member 22 2 2
MIRT484063 CYP4A11 cytochrome P450 family 4 subfamily A member 11 2 2
MIRT496329 SH3BGRL SH3 domain binding glutamate rich protein like 2 2
MIRT498659 AP3B2 adaptor related protein complex 3 beta 2 subunit 2 4
MIRT498711 PGAM5 PGAM family member 5, mitochondrial serine/threonine protein phosphatase 2 10
MIRT499322 ZNF485 zinc finger protein 485 2 6
MIRT499711 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 2 10
MIRT499767 CIRH1A UTP4, small subunit processome component 2 6
MIRT499912 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 8
MIRT504946 ZSWIM6 zinc finger SWIM-type containing 6 2 4
MIRT505377 TMEM154 transmembrane protein 154 2 4
MIRT508778 GSG1 germ cell associated 1 2 2
MIRT509793 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT512421 LAYN layilin 2 4
MIRT513321 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT513592 DCTN6 dynactin subunit 6 2 2
MIRT514785 RBM4B RNA binding motif protein 4B 2 2
MIRT514859 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 2
MIRT515122 LMOD3 leiomodin 3 2 2
MIRT515271 CSNK1E casein kinase 1 epsilon 2 2
MIRT515594 FBXL13 F-box and leucine rich repeat protein 13 2 2
MIRT515880 PLXDC2 plexin domain containing 2 2 2
MIRT515908 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT515960 C9orf156 tRNA methyltransferase O 2 2
MIRT517210 OTUD6A OTU deubiquitinase 6A 2 2
MIRT517330 ZNF347 zinc finger protein 347 2 2
MIRT517480 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT517594 ZNF579 zinc finger protein 579 2 4
MIRT517676 TRIM72 tripartite motif containing 72 2 2
MIRT518215 TRMT10B tRNA methyltransferase 10B 2 2
MIRT518583 ATP8B1 ATPase phospholipid transporting 8B1 2 2
MIRT518777 ZFP14 ZFP14 zinc finger protein 2 2
MIRT519094 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 4
MIRT519112 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT519400 DNASE2 deoxyribonuclease 2, lysosomal 2 4
MIRT519446 GLA galactosidase alpha 2 2
MIRT519476 SPTLC2 serine palmitoyltransferase long chain base subunit 2 2 2
MIRT519711 ZNF584 zinc finger protein 584 2 4
MIRT521409 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 2 2
MIRT521522 QSOX1 quiescin sulfhydryl oxidase 1 2 2
MIRT522652 MANEAL mannosidase endo-alpha like 2 2
MIRT523505 GMPS guanine monophosphate synthase 2 4
MIRT523795 FAM63B MINDY lysine 48 deubiquitinase 2 2 2
MIRT524062 DNAJC8 DnaJ heat shock protein family (Hsp40) member C8 2 2
MIRT524136 DMXL1 Dmx like 1 2 2
MIRT524192 DENND4C DENN domain containing 4C 2 4
MIRT525925 KIAA0391 KIAA0391 2 2
MIRT528021 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT528685 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT528769 CD1D CD1d molecule 2 2
MIRT529373 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT529469 ZNF546 zinc finger protein 546 2 2
MIRT529641 ZNF621 zinc finger protein 621 2 2
MIRT530681 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT530752 GPR82 G protein-coupled receptor 82 2 2
MIRT531628 TM4SF5 transmembrane 4 L six family member 5 2 4
MIRT531649 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT532179 SEC14L5 SEC14 like lipid binding 5 2 4
MIRT532219 CCDC117 coiled-coil domain containing 117 2 2
MIRT534238 SLC25A16 solute carrier family 25 member 16 2 4
MIRT539952 SLC30A5 solute carrier family 30 member 5 2 2
MIRT540179 MB21D1 Mab-21 domain containing 1 2 2
MIRT540466 ZNF71 zinc finger protein 71 2 2
MIRT540560 PPIC peptidylprolyl isomerase C 2 2
MIRT543265 ZNF662 zinc finger protein 662 2 2
MIRT543596 KIAA1549 KIAA1549 2 2
MIRT543971 RNF20 ring finger protein 20 2 2
MIRT544053 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT544605 DCAF5 DDB1 and CUL4 associated factor 5 2 2
MIRT544679 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT547627 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT550668 TRAF1 TNF receptor associated factor 1 2 2
MIRT551533 EMB embigin 2 2
MIRT552443 ZNF449 zinc finger protein 449 2 2
MIRT559265 BAG4 BCL2 associated athanogene 4 2 4
MIRT562479 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT564211 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT565973 RPP14 ribonuclease P/MRP subunit p14 2 2
MIRT570524 SHH sonic hedgehog 2 2
MIRT575307 Osbpl10 oxysterol binding protein-like 10 2 6
MIRT618212 C22orf39 chromosome 22 open reading frame 39 2 2
MIRT620115 HARBI1 harbinger transposase derived 1 2 2
MIRT624062 EIF4E eukaryotic translation initiation factor 4E 2 2
MIRT626083 CWF19L1 CWF19 like 1, cell cycle control (S. pombe) 2 2
MIRT629868 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT630750 COG6 component of oligomeric golgi complex 6 2 2
MIRT631002 ZNF573 zinc finger protein 573 2 2
MIRT631100 UQCRB ubiquinol-cytochrome c reductase binding protein 2 2
MIRT631290 SGSM1 small G protein signaling modulator 1 2 2
MIRT631337 CD300E CD300e molecule 2 2
MIRT631532 MYO6 myosin VI 2 2
MIRT631644 WDR91 WD repeat domain 91 2 4
MIRT632788 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT633282 FGFR1OP2 FGFR1 oncogene partner 2 2 2
MIRT633593 ABRACL ABRA C-terminal like 2 2
MIRT634074 PLIN3 perilipin 3 2 2
MIRT634163 YME1L1 YME1 like 1 ATPase 2 2
MIRT634257 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT634679 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT638384 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT638687 GCLM glutamate-cysteine ligase modifier subunit 2 2
MIRT640311 PRR13 proline rich 13 2 2
MIRT641132 NPHP3 nephrocystin 3 2 2
MIRT642315 FPR1 formyl peptide receptor 1 2 2
MIRT643703 KIAA0586 KIAA0586 2 2
MIRT644322 NFKBID NFKB inhibitor delta 2 2
MIRT645741 POLR3A RNA polymerase III subunit A 2 2
MIRT646975 CYP2W1 cytochrome P450 family 2 subfamily W member 1 2 2
MIRT648064 TRMT10C tRNA methyltransferase 10C, mitochondrial RNase P subunit 2 2
MIRT648536 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 2 2
MIRT649294 NEK8 NIMA related kinase 8 2 2
MIRT650014 KLB klotho beta 2 2
MIRT650551 YIPF4 Yip1 domain family member 4 2 2
MIRT651796 UTP6 UTP6, small subunit processome component 2 2
MIRT652647 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT653548 SLC38A7 solute carrier family 38 member 7 2 2
MIRT653895 SGK3 serum/glucocorticoid regulated kinase family member 3 2 2
MIRT655470 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT657764 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT659118 DENND6A DENN domain containing 6A 2 2
MIRT659377 CREG2 cellular repressor of E1A stimulated genes 2 2 2
MIRT659836 CARHSP1 calcium regulated heat stable protein 1 2 2
MIRT659954 C8orf44-SGK3 C8orf44-SGK3 readthrough 2 2
MIRT660258 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT663268 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 2 2
MIRT663766 ZNF285 zinc finger protein 285 2 2
MIRT666198 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT669763 ZNF101 zinc finger protein 101 2 4
MIRT669933 LRPAP1 LDL receptor related protein associated protein 1 2 2
MIRT670007 GPR156 G protein-coupled receptor 156 2 4
MIRT670465 RSBN1L round spermatid basic protein 1 like 2 2
MIRT670868 IFNAR1 interferon alpha and beta receptor subunit 1 2 4
MIRT671313 RABGAP1L RAB GTPase activating protein 1 like 2 2
MIRT671959 SPPL3 signal peptide peptidase like 3 2 2
MIRT672281 SHE Src homology 2 domain containing E 2 2
MIRT673654 CYCS cytochrome c, somatic 2 2
MIRT674063 ATXN3 ataxin 3 2 2
MIRT674423 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT674438 MIOX myo-inositol oxygenase 2 4
MIRT674483 BCL2L15 BCL2 like 15 2 2
MIRT675478 NUBPL nucleotide binding protein like 2 2
MIRT675648 TTPAL alpha tocopherol transfer protein like 2 2
MIRT675981 FAM126B family with sequence similarity 126 member B 2 2
MIRT676251 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT677652 HAUS2 HAUS augmin like complex subunit 2 2 2
MIRT682718 KIAA1456 KIAA1456 2 2
MIRT687545 MOB1B MOB kinase activator 1B 2 2
MIRT689620 AKAP6 A-kinase anchoring protein 6 2 2
MIRT690035 CCDC90B coiled-coil domain containing 90B 2 2
MIRT691449 CXorf36 chromosome X open reading frame 36 2 2
MIRT691549 FLYWCH2 FLYWCH family member 2 2 2
MIRT691737 LARS leucyl-tRNA synthetase 2 2
MIRT692638 SUSD1 sushi domain containing 1 2 2
MIRT693866 IYD iodotyrosine deiodinase 2 2
MIRT693979 ZNF70 zinc finger protein 70 2 2
MIRT694150 CYP27C1 cytochrome P450 family 27 subfamily C member 1 2 2
MIRT695492 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT695547 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT696023 TYRO3 TYRO3 protein tyrosine kinase 2 2
MIRT696402 CORO7 coronin 7 2 2
MIRT703028 HEATR5A HEAT repeat containing 5A 2 2
MIRT703559 FKBP14 FK506 binding protein 14 2 2
MIRT705036 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT705120 C4orf29 abhydrolase domain containing 18 2 2
MIRT706611 CYB5B cytochrome b5 type B 2 2
MIRT706635 PNPT1 polyribonucleotide nucleotidyltransferase 1 2 2
MIRT706730 RFK riboflavin kinase 2 2
MIRT706868 MAFF MAF bZIP transcription factor F 2 2
MIRT707020 RRP36 ribosomal RNA processing 36 2 2
MIRT707036 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707125 ZNF154 zinc finger protein 154 2 2
MIRT707390 SLC35F6 solute carrier family 35 member F6 2 2
MIRT708664 LYRM7 LYR motif containing 7 2 2
MIRT713010 BBX BBX, HMG-box containing 2 2
MIRT717314 TRAF3IP1 TRAF3 interacting protein 1 2 2
MIRT721912 C6orf201 chromosome 6 open reading frame 201 2 2
MIRT723050 YTHDC1 YTH domain containing 1 2 2
MIRT725038 NDUFAF7 NADH:ubiquinone oxidoreductase complex assembly factor 7 2 2
MIRT755316 SMAD5 SMAD family member 5 4 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4781-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4781-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-4781-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4781-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)

Error report submission