>RAB25|NM_020387|3'UTR
   1 CCTTGGCCAGCACCACCTGCCCCCACTGGCTTTTTGGTGCCCCTTGTCCCCACTTCAGCCCCAGGACCTTTCCTTGCCCT
  81 TTGGTTCCAGATATCAGACTGTTCCCTGTTCACAGCACCCTCAGGGTCTTAAGGTCTTCATGCCCTATCACAAATACCTC
 161 TTTTATCTGTCCACCCCTCACAGACTAGGACCCTCAAATAAAGCTGTTTTATATCAATGCCTGGTCAAAAAAAAAAAAAA
 241 AAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' aggguCCUUGGUACUAUAGUgu 5' || ||| ||||||| Target 5' cctttGGTTCCA-GATATCAga 3'	78 - 98	136.00	-16.10
2	miRNA 3' aggguccuugguacuAUAGUGu 5' |||||| Target 5' aaggtcttcatgcccTATCACa 3'	131 - 152	120.00	-14.80
3	miRNA 3' agGGUC---CUUGGUAC---UAUAGUGU 5' :||| | || || | | ||| Target 5' taTCAGACTGTTCCCTGTTCACAGCACC 3'	92 - 119	84.00	-9.50

Mutant ID	Mutant Position	Mutant Source
COSN13476145	11	COSMIC
COSN30144704	12	COSMIC
COSN30127471	17	COSMIC
COSN30461665	42	COSMIC
COSN30514319	52	COSMIC
COSN30488854	61	COSMIC
COSN30171433	80	COSMIC
COSN31503442	85	COSMIC
COSN30177410	146	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1325746340	2	dbSNP
rs758849548	3	dbSNP
rs1430406464	4	dbSNP
rs1299190199	17	dbSNP
rs749886270	20	dbSNP
rs956793477	20	dbSNP
rs1022098799	25	dbSNP
rs780520506	28	dbSNP
rs747341860	33	dbSNP
rs1421795452	38	dbSNP
rs1293260912	41	dbSNP
rs1421420557	57	dbSNP
rs1386895883	80	dbSNP
rs1475847805	90	dbSNP
rs969717745	95	dbSNP
rs896604468	105	dbSNP
rs773920911	108	dbSNP
rs1023806719	109	dbSNP
rs927883097	119	dbSNP
rs1320239407	125	dbSNP
rs527735830	128	dbSNP
rs939049091	133	dbSNP
rs971687770	141	dbSNP
rs1432473748	158	dbSNP
rs1442386410	172	dbSNP
rs952363479	175	dbSNP
rs1292825989	177	dbSNP
rs1456312179	178	dbSNP
rs930382269	179	dbSNP
rs1170875524	187	dbSNP
rs1409217146	203	dbSNP
rs1006487741	204	dbSNP
rs1049048910	214	dbSNP

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.