>DNAJA1|NM_001539|3'UTR
   1 TGGGCCAGTGAATAACACTCACTGCTGGCATTTAATGTGCAGTAGTGAATGAGTGAAGGACTGTAATCATAATATGCTCA
  81 CTACTTGCTCTTGTTTTTGTTTTAATAAACTATAGTAGTGTTTTAAAAAGTTAAATGAAGAATAAACGCAAATATAAAAG
 161 CTCTGATTTTGCCCTGTATGTATGATGACTTCAGTGTGCAAGATGAAGTTTAATACCTGTAAAAACTACAAAGAAGTTCC
 241 CCTAGCATTTCTAGGCCAAACCTTGTAATTGACTTCAGCTATGTACGTGGACAAGCTTAGACTGAAATGCTAGGTATATG
 321 TATTGGCTTCAGTGTATGACCCTTCATTGTTAAGCTATGAAAGTAAAACTCTGTATTTAACTGGCAATGAGGAAAAAAAA
 401 ATTTTGTAGAGAAGTGTTGGTCTGTATAGTTCTTTATATTAAGTGGGATTCATTGTAATGCCTCTGCATTTATTCTGTTG
 481 CCTCAGCTGTTACTTGAAGATGGCGTAATATATAATTTATCCTGTGGTATCAGTGATAAAAATGATACCTTTCTGTAGGA
 561 GGGGTTTATCATAATATGCTGCTTCTTGAAGGCTTGCACTTCCAGAATTGTGTTTCCTTCTGCTGTGCCATTCATATATA
 641 TATACATATATATATATAATCTTGACCAGTCCTGGTCATTTGCTCCCCTCCTTGTCTGTGGACCATGATAAGCCCAAGTA
 721 GTGACTTCAGAGCTGGGTAACAGAAATTAAAGTGAAAAGACCTTTACGTGGAGAATTTGCATGCGTAATATAGGAAGGTG
 801 TTCTTTAGGTATGTTACAGGATTACTTTAAACCATTTGACTTTCGCTCCAAAGTTATGTTGGTAGTATAGCAAATTATGA
 881 TGAATAGCTTTAATTGTATGTTTAAAAGTCTCATATGTTCACATGCTTAAATCTGGGTATCAGAATTTAAGCAATTCTTG
 961 AAATGTATTGTCTCCTTAATATACTAATTACAAAGCATCTCCAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' acaaUUACGAU---UAUACAUCCUc 5' |||| || | ||||||| Target 5' taaaAATGATACCTTTCTGTAGGAg 3'	537 - 561	154.00	-12.26
2	miRNA 3' acAAU-UACG-AUUAUACAUCCUc 5' ||: |||| || || ||||| Target 5' atTTGCATGCGTA--ATATAGGAa 3'	775 - 796	128.00	-8.20
3	miRNA 3' acaAUUACGAUUA--UACAUCCUc 5' ||:|| ||| :|| |||| Target 5' cagTAGTG--AATGAGTGAAGGAc 3'	40 - 61	125.00	-7.60

Mutant ID	Mutant Position	Mutant Source
COSN31482200	21	COSMIC
COSN6389584	26	COSMIC
COSN31581448	73	COSMIC
COSN28875445	127	COSMIC
COSN23629191	410	COSMIC
COSN17021155	646	COSMIC
COSN21313385	760	COSMIC
COSN21485422	788	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1375108142	1	dbSNP
rs770904664	2	dbSNP
rs1304746476	3	dbSNP
rs776768067	7	dbSNP
rs781143779	10	dbSNP
rs745449469	12	dbSNP
rs1275915125	13	dbSNP
rs1311169512	15	dbSNP
rs747015712	17	dbSNP
rs769521508	19	dbSNP
rs774816290	20	dbSNP
rs1183968380	21	dbSNP
rs762575235	23	dbSNP
rs1456257632	33	dbSNP
rs1004514057	34	dbSNP
rs1234672839	35	dbSNP
rs1177794678	36	dbSNP
rs1330186885	38	dbSNP
rs1247171442	40	dbSNP
rs772428402	47	dbSNP
rs1170834464	51	dbSNP
rs773775893	56	dbSNP
rs1321123173	58	dbSNP
rs1466245286	60	dbSNP
rs1161559011	62	dbSNP
rs755505219	62	dbSNP
rs1385041317	64	dbSNP
rs1413215585	69	dbSNP
rs1398406414	70	dbSNP
rs1446457620	71	dbSNP
rs761015443	72	dbSNP
rs766672756	73	dbSNP
rs754232780	75	dbSNP
rs759627222	76	dbSNP
rs765543456	80	dbSNP
rs1343627660	82	dbSNP
rs752685836	83	dbSNP
rs1386719761	85	dbSNP
rs1259531668	91	dbSNP
rs1376182287	91	dbSNP
rs1477876197	91	dbSNP
rs758568855	93	dbSNP
rs374511744	95	dbSNP
rs1337735657	103	dbSNP
rs759112229	104	dbSNP
rs11542818	115	dbSNP
rs990381230	122	dbSNP
rs7296	124	dbSNP
rs1211363540	128	dbSNP
rs1373584184	132	dbSNP
rs945405184	134	dbSNP
rs114496815	141	dbSNP
rs1277020589	148	dbSNP
rs1397544630	149	dbSNP
rs1300604073	155	dbSNP
rs1313997421	158	dbSNP
rs1414298151	161	dbSNP
rs1346535318	172	dbSNP
rs1400513759	175	dbSNP
rs1169928352	176	dbSNP
rs1211421197	180	dbSNP
rs534448067	181	dbSNP
rs1475872695	183	dbSNP
rs554132326	185	dbSNP
rs1423101434	190	dbSNP
rs1191644135	191	dbSNP
rs1476201856	197	dbSNP
rs1469864602	205	dbSNP
rs911868218	209	dbSNP
rs577470498	226	dbSNP
rs1435813321	229	dbSNP
rs1441686706	240	dbSNP
rs1276257349	243	dbSNP
rs1339696084	245	dbSNP
rs944691471	247	dbSNP
rs1042345	252	dbSNP
rs900750633	253	dbSNP
rs539421217	265	dbSNP
rs1447930084	274	dbSNP
rs1339166591	282	dbSNP
rs556610012	287	dbSNP
rs1192052048	288	dbSNP
rs1049187204	294	dbSNP
rs1463117678	296	dbSNP
rs1394498307	297	dbSNP
rs1454768367	298	dbSNP
rs1472427031	303	dbSNP
rs886206422	311	dbSNP
rs1183751617	317	dbSNP
rs1004558138	319	dbSNP
rs1196360296	327	dbSNP
rs1023992639	330	dbSNP
rs971107715	337	dbSNP
rs767886244	342	dbSNP
rs1227182436	351	dbSNP
rs1354903006	369	dbSNP
rs1281737045	370	dbSNP
rs1001605446	372	dbSNP
rs1376589749	374	dbSNP
rs759928022	376	dbSNP
rs1443392478	379	dbSNP
rs1329931014	391	dbSNP
rs1323003368	393	dbSNP
rs1356698609	393	dbSNP
rs1443848379	396	dbSNP
rs1403628419	399	dbSNP
rs1411598344	401	dbSNP
rs576537888	402	dbSNP
rs757519062	402	dbSNP
rs957480914	402	dbSNP
rs542317825	403	dbSNP
rs1469538433	412	dbSNP
rs966799090	416	dbSNP
rs1220219950	417	dbSNP
rs978200512	422	dbSNP
rs911961620	425	dbSNP
rs1241505227	427	dbSNP
rs944766159	428	dbSNP
rs1305053866	437	dbSNP
rs778814654	441	dbSNP
rs1236895172	454	dbSNP
rs1368596492	463	dbSNP
rs758807285	468	dbSNP
rs975144598	468	dbSNP
rs1347033975	469	dbSNP
rs1320273309	474	dbSNP
rs1420247447	474	dbSNP
rs1213983538	476	dbSNP
rs1359748553	477	dbSNP
rs1156647387	478	dbSNP
rs1455383374	483	dbSNP
rs1273430348	496	dbSNP
rs1425494519	499	dbSNP
rs1190244605	505	dbSNP
rs922217104	506	dbSNP
rs1216613192	512	dbSNP
rs930852886	513	dbSNP
rs1213527668	515	dbSNP
rs1284436936	515	dbSNP
rs1211986839	523	dbSNP
rs190382879	534	dbSNP
rs1252646744	537	dbSNP
rs1468932651	541	dbSNP
rs1195562099	544	dbSNP
rs1240475587	545	dbSNP
rs1475364194	546	dbSNP
rs1169007505	549	dbSNP
rs1422009564	550	dbSNP
rs1460231220	551	dbSNP
rs1162284279	553	dbSNP
rs1421150238	562	dbSNP
rs1193776149	566	dbSNP
rs1477195000	571	dbSNP
rs1261704989	574	dbSNP
rs1049230870	577	dbSNP
rs796515746	582	dbSNP
rs574675150	585	dbSNP
rs1441231581	591	dbSNP
rs1327326226	598	dbSNP
rs1309519491	603	dbSNP
rs780530305	604	dbSNP
rs534901083	609	dbSNP
rs146021760	611	dbSNP
rs1270704379	613	dbSNP
rs1341165197	615	dbSNP
rs1231255824	618	dbSNP
rs1272375390	620	dbSNP
rs1335694585	626	dbSNP
rs1302075856	632	dbSNP
rs1445475698	632	dbSNP
rs906938513	632	dbSNP
rs537309585	633	dbSNP
rs1245559024	634	dbSNP
rs1275145216	634	dbSNP
rs1322277608	634	dbSNP
rs201643498	634	dbSNP
rs1311886323	636	dbSNP
rs541836605	636	dbSNP
rs1378830124	638	dbSNP
rs1446502180	638	dbSNP
rs893072377	640	dbSNP
rs1294807798	642	dbSNP
rs768269278	642	dbSNP
rs1457927891	644	dbSNP
rs146004118	644	dbSNP
rs560140690	645	dbSNP
rs1042376	646	dbSNP
rs1165577892	646	dbSNP
rs1255062311	647	dbSNP
rs1419115000	647	dbSNP
rs1488178886	650	dbSNP
rs552224366	650	dbSNP
rs1264862009	651	dbSNP
rs1238670765	653	dbSNP
rs562122994	653	dbSNP
rs1309719717	654	dbSNP
rs1355694485	654	dbSNP
rs1239111291	655	dbSNP
rs755027166	656	dbSNP
rs1019065931	658	dbSNP
rs1215783765	658	dbSNP
rs1389386518	659	dbSNP
rs74178844	659	dbSNP
rs1292355535	660	dbSNP
rs1361662317	661	dbSNP
rs1197371387	662	dbSNP
rs1158438972	668	dbSNP
rs1461627512	670	dbSNP
rs1379627887	672	dbSNP
rs1164651009	676	dbSNP
rs1432732872	686	dbSNP
rs1265374624	692	dbSNP
rs1382060895	697	dbSNP
rs1206904681	706	dbSNP
rs1489247968	716	dbSNP
rs1399649043	717	dbSNP
rs112767677	721	dbSNP
rs974775828	722	dbSNP
rs1257463424	726	dbSNP
rs1342273158	731	dbSNP
rs553570205	736	dbSNP
rs1292448530	742	dbSNP
rs547875231	743	dbSNP
rs568639901	749	dbSNP
rs1355865850	750	dbSNP
rs1298568394	762	dbSNP
rs1401264163	763	dbSNP
rs921897474	768	dbSNP
rs1259214171	769	dbSNP
rs1418325564	773	dbSNP
rs756709286	779	dbSNP
rs567827643	785	dbSNP
rs534088291	786	dbSNP
rs985028850	790	dbSNP
rs1376091600	792	dbSNP
rs908130383	795	dbSNP
rs1478176527	799	dbSNP
rs529924885	807	dbSNP
rs1192851866	808	dbSNP
rs1445128251	809	dbSNP
rs1280493806	816	dbSNP
rs1200756873	818	dbSNP
rs1343897754	819	dbSNP
rs1253858749	822	dbSNP
rs1219974022	826	dbSNP
rs1317993343	827	dbSNP
rs1210867978	829	dbSNP
rs369360190	837	dbSNP
rs1398708442	840	dbSNP
rs940895707	844	dbSNP
rs540399833	845	dbSNP
rs1400397349	849	dbSNP
rs571019678	858	dbSNP
rs1466271838	863	dbSNP
rs1168556505	865	dbSNP
rs1422995865	865	dbSNP
rs1474389854	867	dbSNP
rs1361729687	870	dbSNP
rs937062634	874	dbSNP
rs1441597813	877	dbSNP
rs1240956208	878	dbSNP
rs1055478202	883	dbSNP
rs892823425	897	dbSNP
rs1256872865	907	dbSNP
rs1011228545	913	dbSNP
rs1361984658	917	dbSNP
rs1436983857	917	dbSNP
rs540106753	919	dbSNP
rs1285280336	924	dbSNP
rs1339075588	925	dbSNP
rs560649342	925	dbSNP
rs1333686063	933	dbSNP
rs1375791057	936	dbSNP
rs1399750097	937	dbSNP
rs903095933	946	dbSNP
rs138583305	958	dbSNP
rs1415920931	959	dbSNP
rs1163764240	961	dbSNP
rs1472375717	961	dbSNP
rs1383167765	964	dbSNP
rs1019829157	967	dbSNP
rs1457956681	975	dbSNP
rs1397583636	980	dbSNP
rs1304660316	983	dbSNP
rs1452804735	994	dbSNP
rs1291309090	999	dbSNP
rs1209756023	1005	dbSNP
rs1357853103	1005	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.