pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6737 |
Genomic Coordinates | chr1: 153962351 - 153962420 |
Description | Homo sapiens miR-6737 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6737-5p | |||||||||||||||||||||
Sequence | 6| UUGGGGUGGUCGGCCCUGGAG |26 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Meta-analysis | |||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | USH1G | ||||||||||||||||||||
Synonyms | ANKS4A, SANS | ||||||||||||||||||||
Description | USH1 protein network component sans | ||||||||||||||||||||
Transcript | NM_173477 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on USH1G | |||||||||||||||||||||
3'UTR of USH1G (miRNA target sites are highlighted) |
>USH1G|NM_173477|3'UTR 1 CCGGGGGCTCCTCTCCCCAGACCAAAATGAATTGCAAGTTGCCACAACCTATGGTGGGGTCTCGAGGTCCTCACAGTTGC 81 CAGCCCTGCAGCCCCCTTCCCCAGGAGCAAGGACCAGTTGGGGCGACTCCTTTGAAAGTCTGTCTGCACCTTGAAGCTGA 161 GGGTGTGGCCTGGAGGCACCAGAGGGGCAAGAGAATGTTCCGGAACTCCAGTTCTGAGGGGTCTTGAAGGCCCTGAGCCA 241 CCCATTCTGAGCAGCCGTAAAGGACATGTAGACTTGGGGGAGGCCTGCCCCAGAGGGAGGGCAGGGGCATCGGAACTGGA 321 TGAGAGTGTGGGAGGTGGATGCGGGAGGGTGCACCTGTCCCGGGCGCCGTGGCCTCTCCCACCCCTCCCCTGATGGTCTT 401 GTTCTCTTGTGCTCAGGCCAGAGACTTGCTCACTTCCTGCATTGTTGTGAAGGGAAGAGTTTGGGCTGCCTCCCCTCCTC 481 CCGTCCACCCCAGAGGGGAAGTTCCTCAGCCAGACTCTTCAGCCAAATGCCCCAACTTTCAGTCTGTACCCCATCCCAAG 561 CATAGCCAGCTCCCCCTCCTTCACCTAGTGGTCAAGGCCCGGAGCTGGAAAGCCGGGTTGGGGTGGGGTGGGGGTACTGA 641 CGCCCTTCCCAGCTCATCCAGGGGTGGAGCCTGGCCTGTCTTCCTCCAACCTCCCCCTTTTTCGTTGTGCAGCCTGGCCC 721 CCCAGGGACCCCAGAGGGCCAGGGCGCTAGATGCAAGGTGCTAGACCAATGGGCTGCAGTATTATAGCCCCCAGGCCTGG 801 CAGGCATGCGCTGGGCTAGAGAAAGGTGTCCGCCAACCTCCTCAGTCTCCCAGGCCTGGGACAGGCAGAACAGGGTGTGG 881 CTGGGTGTCAGGCCTGGGGTGGGTAAGTCCTGCGATGTGGACACTGGAGAAAGTGGATCCTCTAAACTGCAGATTGTCCC 961 CAGGTCACCAGGGCTGTGTGCGTGTGCATGTTTGTGTGCATGTATGCGTGTGTGCATGCATGTGTGTGTAAGTATGTGGT 1041 ATGTGTGAGCACGGGTGTGTGCTTGGGTGTGTGTGTTCTTGCATACATGTGTGCGTGTGTGTGCACGTGAACGCGTGCGT 1121 GTTTGTGTGTGTGCATGCATGTGTGTGCATGTGTGTGTGTGCATGCATGTGTGTGTGTGTGCATGTGTGCGTGTGTGCAC 1201 ACTCACGTTGGGTGGTGTTTGGTAGGTTTCCCTCCAGGTCTGGTAGGGACTGGGCTGTTGCGTGATTCTGCGTGGATCGG 1281 GGGTAAGAGAGCTCACCTGTGTCCCAGCCCTCTGATGGTGGTGAGACCAGGGGAAAGGCCAGCTCAGAGGGTGGTCACAG 1361 CATGTGTCCTCTGACGTATGCCCCCAAAGCTCTCCAGCCAGACTGAGGTCACAGATGTGGGAGAGTCCCTGATGAGCCCG 1441 CTGACACGTGTGCGCCCCTTTGCACCCCATGCAGAGGTGCTCTCCTCCTTTCTCAGCCATGGCCCCCCATCCCTGACCTC 1521 AGCTTGGGAAGCAGCTCCTGCTGGGAGCATGGCCTCAGCCCCCAGCATCTCCTGGGGCCCCCATGGCTGGGGCAGGGGAA 1601 AGAGAGCCCTCAAAGGCCTCTTTCTGGTCTGTCTGGGGGTTCCCATTCCCACACATGTGCCCAGAGTAGGGGGCATGGAG 1681 GAGATGGTCCCTGTCCTACTGCAGGACACTGAGGGCTTGGCTGCCTGCCACCGCCATCTGGAGCCCACCACAGCTCTTCT 1761 CCCTGTTCTCTGGGCCTGAGCCTGGGGCCACCCCCAAGTGCCGACTTGTTTCTCCCAGAGCCCCAGGTGCTGCCCCTTCT 1841 CTCCTGTTCCTCGTCCGTTTACTGCCGCAGCCCCTCCTGGTTCTTCTGGTGCTGGGGTGGAGCAGGCTCTGTGCTCCCAC 1921 CACTGTACCCCGAATCCCTCCTGCAGGCTCATTGCCACTTTTGTAGAGAATGTTCTCTATCAGTATCGT Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | MCF7 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
CLIP-seq Support 1 for dataset GSM545215 | |
---|---|
Method / RBP | PAR-CLIP / AGO4 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000319642.1 | 3UTR | CUGCCUCCCCUCCUCCCGUCCACCCC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset SRR1045082 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | MCF7 / Untreated |
Location of target site | ENST00000319642.1 | 3UTR | CUGCCUCCCCUCCUCCCGUCCACCCC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24398324 / SRX388831 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
67 hsa-miR-6737-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT066215 | MARCH9 | membrane associated ring-CH-type finger 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT074413 | TNRC6A | trinucleotide repeat containing 6A | ![]() |
![]() |
2 | 2 | ||||||
MIRT125300 | MID1IP1 | MID1 interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT153951 | NCOA3 | nuclear receptor coactivator 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452776 | FAM136A | family with sequence similarity 136 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT452977 | CABP4 | calcium binding protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454128 | FOXRED2 | FAD dependent oxidoreductase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455242 | DDX39B | DExD-box helicase 39B | ![]() |
![]() |
2 | 10 | ||||||
MIRT459007 | UQCRH | ubiquinol-cytochrome c reductase hinge protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT459463 | MUC17 | mucin 17, cell surface associated | ![]() |
![]() |
2 | 4 | ||||||
MIRT460871 | UBE2S | ubiquitin conjugating enzyme E2 S | ![]() |
![]() |
2 | 2 | ||||||
MIRT461264 | COX10 | COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT464540 | UBTF | upstream binding transcription factor, RNA polymerase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT465268 | TRIM28 | tripartite motif containing 28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465871 | TMEM43 | transmembrane protein 43 | ![]() |
![]() |
2 | 4 | ||||||
MIRT466228 | TMED10 | transmembrane p24 trafficking protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468417 | SETD1B | SET domain containing 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT468684 | SEC22C | SEC22 homolog C, vesicle trafficking protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT473399 | MDM4 | MDM4, p53 regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT473517 | MAX | MYC associated factor X | ![]() |
![]() |
2 | 2 | ||||||
MIRT474511 | KLHDC8A | kelch domain containing 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT475801 | HDGF | heparin binding growth factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT479493 | CDH6 | cadherin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480770 | BMP2 | bone morphogenetic protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT481418 | ASB6 | ankyrin repeat and SOCS box containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482966 | CSTF2 | cleavage stimulation factor subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT483380 | SPATA6 | spermatogenesis associated 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT483677 | CYP11A1 | cytochrome P450 family 11 subfamily A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484328 | EPN1 | epsin 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT484963 | UCK1 | uridine-cytidine kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT485908 | PGPEP1 | pyroglutamyl-peptidase I | ![]() |
![]() |
2 | 4 | ||||||
MIRT488149 | PRRC2B | proline rich coiled-coil 2B | ![]() |
![]() |
2 | 4 | ||||||
MIRT488943 | CYP2W1 | cytochrome P450 family 2 subfamily W member 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT491835 | ZBTB7A | zinc finger and BTB domain containing 7A | ![]() |
![]() |
2 | 4 | ||||||
MIRT493026 | NAA50 | N(alpha)-acetyltransferase 50, NatE catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT499374 | PLCG2 | phospholipase C gamma 2 | ![]() |
![]() |
2 | 11 | ||||||
MIRT499723 | USH1G | USH1 protein network component sans | ![]() |
![]() |
2 | 4 | ||||||
MIRT500349 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 2 | ||||||
MIRT509574 | HIST2H2AB | histone cluster 2 H2A family member b | ![]() |
![]() |
2 | 4 | ||||||
MIRT512794 | GLRX | glutaredoxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT513291 | SETBP1 | SET binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT515697 | ZNF321P | zinc finger protein 321, pseudogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT518255 | LEAP2 | liver enriched antimicrobial peptide 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522026 | PAQR3 | progestin and adipoQ receptor family member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT523169 | HIST3H3 | histone cluster 3 H3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524036 | DNAJC8 | DnaJ heat shock protein family (Hsp40) member C8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533476 | TRIM71 | tripartite motif containing 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541488 | ADM | adrenomedullin | ![]() |
![]() |
2 | 2 | ||||||
MIRT553987 | SRPR | SRP receptor alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT571445 | YKT6 | YKT6 v-SNARE homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT574889 | Plcg2 | phospholipase C, gamma 2 | ![]() |
![]() |
2 | 7 | ||||||
MIRT607544 | GLI2 | GLI family zinc finger 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607688 | MAPK10 | mitogen-activated protein kinase 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610072 | CRLF1 | cytokine receptor like factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610573 | CACUL1 | CDK2 associated cullin domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT614041 | THBS2 | thrombospondin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626318 | LRTOMT | leucine rich transmembrane and O-methyltransferase domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT634005 | RIF1 | replication timing regulatory factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639619 | FGF19 | fibroblast growth factor 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647343 | RPH3AL | rabphilin 3A like (without C2 domains) | ![]() |
![]() |
2 | 2 | ||||||
MIRT689704 | ATXN2 | ataxin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691170 | APOL6 | apolipoprotein L6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693165 | NPR1 | natriuretic peptide receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711727 | NUPL2 | nucleoporin like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711806 | ELN | elastin | ![]() |
![]() |
2 | 2 | ||||||
MIRT721546 | FXN | frataxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT722979 | GDE1 | glycerophosphodiester phosphodiesterase 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|