pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-1303 |
Genomic Coordinates | chr5: 154685776 - 154685861 |
Synonyms | MIRN1303, hsa-mir-1303, MIR1303 |
Description | Homo sapiens miR-1303 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-1303 | ||||||||||||||||||||||||||||||||||||||||||
Sequence | 52| UUUAGAGACGGGGUCUUGCUCU |73 | ||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | PCSK9 | ||||||||||||||||||||
Synonyms | FH3, HCHOLA3, LDLCQ1, NARC-1, NARC1, PC9 | ||||||||||||||||||||
Description | proprotein convertase subtilisin/kexin type 9 | ||||||||||||||||||||
Transcript | NM_174936 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on PCSK9 | |||||||||||||||||||||
3'UTR of PCSK9 (miRNA target sites are highlighted) |
>PCSK9|NM_174936|3'UTR 1 CAGCCCCATCCCAGGATGGGTGTCTGGGGAGGGTCAAGGGCTGGGGCTGAGCTTTAAAATGGTTCCGACTTGTCCCTCTC 81 TCAGCCCTCCATGGCCTGGCACGAGGGGATGGGGATGCTTCCGCCTTTCCGGGGCTGCTGGCCTGGCCCTTGAGTGGGGC 161 AGCCTCCTTGCCTGGAACTCACTCACTCTGGGTGCCTCCTCCCCAGGTGGAGGTGCCAGGAAGCTCCCTCCCTCACTGTG 241 GGGCATTTCACCATTCAAACAGGTCGAGCTGTGCTCGGGTGCTGCCAGCTGCTCCCAATGTGCCGATGTCCGTGGGCAGA 321 ATGACTTTTATTGAGCTCTTGTTCCGTGCCAGGCATTCAATCCTCAGGTCTCCACCAAGGAGGCAGGATTCTTCCCATGG 401 ATAGGGGAGGGGGCGGTAGGGGCTGCAGGGACAAACATCGTTGGGGGGTGAGTGTGAAAGGTGCTGATGGCCCTCATCTC 481 CAGCTAACTGTGGAGAAGCCCCTGGGGGCTCCCTGATTAATGGAGGCTTAGCTTTCTGGATGGCATCTAGCCAGAGGCTG 561 GAGACAGGTGCGCCCCTGGTGGTCACAGGCTGTGCCTTGGTTTCCTGAGCCACCTTTACTCTGCTCTATGCCAGGCTGTG 641 CTAGCAACACCCAAAGGTGGCCTGCGGGGAGCCATCACCTAGGACTGACTCGGCAGTGTGCAGTGGTGCATGCACTGTCT 721 CAGCCAACCCGCTCCACTACCCGGCAGGGTACACATTCGCACCCCTACTTCACAGAGGAAGAAACCTGGAACCAGAGGGG 801 GCGTGCCTGCCAAGCTCACACAGCAGGAACTGAGCCAGAAACGCAGATTGGGCTGGCTCTGAAGCCAAGCCTCTTCTTAC 881 TTCACCCGGCTGGGCTCCTCATTTTTACGGGTAACAGTGAGGCTGGGAAGGGGAACACAGACCAGGAAGCTCGGTGAGTG 961 ATGGCAGAACGATGCCTGCAGGCATGGAACTTTTTCCGTTATCACCCAGGCCTGATTCACTGGCCTGGCGGAGATGCTTC 1041 TAAGGCATGGTCGGGGGAGAGGGCCAACAACTGTCCCTCCTTGAGCACCAGCCCCACCCAAGCAAGCAGACATTTATCTT 1121 TTGGGTCTGTCCTCTCTGTTGCCTTTTTACAGCCAACTTTTCTAGACCTGTTTTGCTTTTGTAACTTGAAGATATTTATT 1201 CTGGGTTTTGTAGCATTTTTATTAATATGGTGACTTTTTAAAATAAAAACAAACAAACGTTGTCCTAACAAAAAAAAAAA 1281 AAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 255738.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 255738.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | MCF7 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
CLIP-seq Support 1 for dataset GSM545212 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000302118.5 | 3UTR | CAACAGUGAGACCCCGUCUCUAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545214 | |
---|---|
Method / RBP | PAR-CLIP / AGO3 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000302118.5 | 3UTR | GCAACAGUGAGACCCCGUCUCUAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000302118.5 | 3UTR | CCUGGGCAACAGUGAGACCCCGUCUCUAUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000302118.5 | 3UTR | CCUGGGCAACAGUGAGACCCCGUCUCUAUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM1065668 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
Location of target site | ENST00000302118.5 | 3UTR | CAACAGUGAGACCCCGUCUCUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM1065669 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
Location of target site | ENST00000302118.5 | 3UTR | CAACAGUGAGACCCCGUCUCUAUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset SRR1045082 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | MCF7 / Untreated |
Location of target site | ENST00000302118.5 | 3UTR | CCUGGGCAACAGUGAGACCCCGUCUCUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24398324 / SRX388831 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
186 hsa-miR-1303 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT035871 | SOAT1 | sterol O-acyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT035872 | FHOD3 | formin homology 2 domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT035873 | RPL7A | ribosomal protein L7a | ![]() |
1 | 1 | |||||||
MIRT035874 | NCAPD2 | non-SMC condensin I complex subunit D2 | ![]() |
1 | 1 | |||||||
MIRT035875 | RPS8 | ribosomal protein S8 | ![]() |
1 | 1 | |||||||
MIRT035876 | AHNAK | AHNAK nucleoprotein | ![]() |
1 | 1 | |||||||
MIRT035877 | ACTB | actin beta | ![]() |
1 | 1 | |||||||
MIRT035878 | DEF8 | differentially expressed in FDCP 8 homolog | ![]() |
1 | 1 | |||||||
MIRT035879 | MET | MET proto-oncogene, receptor tyrosine kinase | ![]() |
1 | 1 | |||||||
MIRT035880 | MED13 | mediator complex subunit 13 | ![]() |
1 | 1 | |||||||
MIRT035881 | FAT3 | FAT atypical cadherin 3 | ![]() |
1 | 1 | |||||||
MIRT035882 | HUWE1 | HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase | ![]() |
1 | 1 | |||||||
MIRT035883 | RPS16 | ribosomal protein S16 | ![]() |
1 | 1 | |||||||
MIRT035884 | CDK6 | cyclin dependent kinase 6 | ![]() |
1 | 1 | |||||||
MIRT035885 | GEMIN5 | gem nuclear organelle associated protein 5 | ![]() |
1 | 1 | |||||||
MIRT035886 | PITRM1 | pitrilysin metallopeptidase 1 | ![]() |
1 | 1 | |||||||
MIRT035887 | PRRC2A | proline rich coiled-coil 2A | ![]() |
1 | 1 | |||||||
MIRT035888 | KIAA0226 | RUN and cysteine rich domain containing beclin 1 interacting protein | ![]() |
1 | 1 | |||||||
MIRT035889 | MLLT6 | MLLT6, PHD finger containing | ![]() |
1 | 1 | |||||||
MIRT035890 | EIF3I | eukaryotic translation initiation factor 3 subunit I | ![]() |
1 | 1 | |||||||
MIRT035891 | FASN | fatty acid synthase | ![]() |
1 | 1 | |||||||
MIRT035892 | LEPREL4 | prolyl 3-hydroxylase family member 4 (non-enzymatic) | ![]() |
1 | 1 | |||||||
MIRT035893 | HSCB | HscB mitochondrial iron-sulfur cluster cochaperone | ![]() |
1 | 1 | |||||||
MIRT035894 | PSME4 | proteasome activator subunit 4 | ![]() |
1 | 1 | |||||||
MIRT035895 | FRS2 | fibroblast growth factor receptor substrate 2 | ![]() |
1 | 1 | |||||||
MIRT035896 | ZNF264 | zinc finger protein 264 | ![]() |
1 | 1 | |||||||
MIRT035897 | HYLS1 | HYLS1, centriolar and ciliogenesis associated | ![]() |
1 | 1 | |||||||
MIRT035898 | USP54 | ubiquitin specific peptidase 54 | ![]() |
1 | 1 | |||||||
MIRT035899 | L1TD1 | LINE1 type transposase domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT035900 | OR51E2 | olfactory receptor family 51 subfamily E member 2 | ![]() |
1 | 1 | |||||||
MIRT053762 | CLDN18 | claudin 18 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT060730 | RPS3 | ribosomal protein S3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT083986 | RAB22A | RAB22A, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT098550 | TBPL1 | TATA-box binding protein like 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT134983 | TWF1 | twinfilin actin binding protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT136956 | FNDC3A | fibronectin type III domain containing 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT222065 | PURB | purine rich element binding protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT239574 | UBN2 | ubinuclein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT261820 | BUB3 | BUB3, mitotic checkpoint protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT264698 | C11ORF57 | chromosome 11 open reading frame 57 | ![]() |
![]() |
2 | 4 | ||||||
MIRT308476 | GXYLT2 | glucoside xylosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT377481 | NDUFB5 | NADH:ubiquinone oxidoreductase subunit B5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442304 | NEU3 | neuraminidase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446083 | SLC30A10 | solute carrier family 30 member 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449606 | PRPF4 | pre-mRNA processing factor 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453767 | NUCB1 | nucleobindin 1 | ![]() |
![]() |
2 | 10 | ||||||
MIRT455603 | SRSF3 | serine and arginine rich splicing factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455913 | KIF2C | kinesin family member 2C | ![]() |
![]() |
2 | 2 | ||||||
MIRT460091 | ZYG11B | zyg-11 family member B, cell cycle regulator | ![]() |
![]() |
2 | 4 | ||||||
MIRT460866 | UBE2S | ubiquitin conjugating enzyme E2 S | ![]() |
![]() |
2 | 2 | ||||||
MIRT461339 | NUP133 | nucleoporin 133 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463769 | YOD1 | YOD1 deubiquitinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT466368 | THAP1 | THAP domain containing 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT467168 | SPTY2D1 | SPT2 chromatin protein domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468703 | SDHD | succinate dehydrogenase complex subunit D | ![]() |
![]() |
2 | 2 | ||||||
MIRT469122 | RNF126 | ring finger protein 126 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472426 | NCBP2 | nuclear cap binding protein subunit 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT479420 | CDKN1B | cyclin dependent kinase inhibitor 1B | ![]() |
![]() |
2 | 8 | ||||||
MIRT484260 | FAM177A1 | family with sequence similarity 177 member A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT485468 | IL6ST | interleukin 6 signal transducer | ![]() |
![]() |
2 | 10 | ||||||
MIRT490237 | H2AFZ | H2A histone family member Z | ![]() |
![]() |
2 | 6 | ||||||
MIRT491002 | ATF7IP | activating transcription factor 7 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT492127 | SUMO2 | small ubiquitin-like modifier 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT499169 | RBPJL | recombination signal binding protein for immunoglobulin kappa J region like | ![]() |
![]() |
2 | 2 | ||||||
MIRT499825 | PCSK9 | proprotein convertase subtilisin/kexin type 9 | ![]() |
![]() |
2 | 8 | ||||||
MIRT501794 | NRAS | NRAS proto-oncogene, GTPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT503441 | GINS4 | GINS complex subunit 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT503688 | MAVS | mitochondrial antiviral signaling protein | ![]() |
![]() |
2 | 5 | ||||||
MIRT506926 | IGDCC4 | immunoglobulin superfamily DCC subclass member 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT511430 | HOXA10 | homeobox A10 | ![]() |
![]() |
2 | 6 | ||||||
MIRT512415 | LAYN | layilin | ![]() |
![]() |
2 | 4 | ||||||
MIRT513791 | NIPAL3 | NIPA like domain containing 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT516163 | NTMT1 | N-terminal Xaa-Pro-Lys N-methyltransferase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT516513 | PARK2 | parkin RBR E3 ubiquitin protein ligase | ![]() |
![]() |
2 | 2 | ||||||
MIRT516915 | HINFP | histone H4 transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT517102 | NDUFV3 | NADH:ubiquinone oxidoreductase subunit V3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517350 | NLRP9 | NLR family pyrin domain containing 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518019 | ABHD15 | abhydrolase domain containing 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520945 | SRSF10 | serine and arginine rich splicing factor 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT525250 | RNF213 | ring finger protein 213 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530634 | PPIC | peptidylprolyl isomerase C | ![]() |
![]() |
2 | 4 | ||||||
MIRT530671 | CHRNB1 | cholinergic receptor nicotinic beta 1 subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT531563 | ILDR1 | immunoglobulin like domain containing receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538205 | CYR61 | cysteine rich angiogenic inducer 61 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538419 | COLEC10 | collectin subfamily member 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541964 | ZNF485 | zinc finger protein 485 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543088 | KNSTRN | kinetochore localized astrin/SPAG5 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT543257 | ZNF662 | zinc finger protein 662 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543589 | KIAA1549 | KIAA1549 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543955 | RNF20 | ring finger protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544043 | C9orf64 | chromosome 9 open reading frame 64 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548064 | GIGYF1 | GRB10 interacting GYF protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548240 | FBXW7 | F-box and WD repeat domain containing 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548442 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT548623 | DAZAP1 | DAZ associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548770 | COLEC12 | collectin subfamily member 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT549506 | HDDC2 | HD domain containing 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT551924 | AKAP8 | A-kinase anchoring protein 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT555656 | PGRMC1 | progesterone receptor membrane component 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT556286 | MAP3K5 | mitogen-activated protein kinase kinase kinase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557012 | HOXD13 | homeobox D13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT563907 | CLSPN | claspin | ![]() |
![]() |
2 | 2 | ||||||
MIRT565527 | SON | SON DNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT568000 | COMMD2 | COMM domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569831 | PLA2G16 | phospholipase A2 group XVI | ![]() |
![]() |
2 | 4 | ||||||
MIRT573905 | PARP1 | poly(ADP-ribose) polymerase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT616589 | KLHL9 | kelch like family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617137 | ZNF556 | zinc finger protein 556 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617400 | API5 | apoptosis inhibitor 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617455 | CCS | copper chaperone for superoxide dismutase | ![]() |
![]() |
2 | 2 | ||||||
MIRT617799 | ZNF793 | zinc finger protein 793 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618190 | MACC1 | MACC1, MET transcriptional regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT618303 | GNE | glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT618329 | ZNF813 | zinc finger protein 813 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618820 | PHF20 | PHD finger protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619153 | PPDPF | pancreatic progenitor cell differentiation and proliferation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT619530 | ZNF708 | zinc finger protein 708 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619849 | KIR3DX1 | killer cell immunoglobulin like receptor, three Ig domains X1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620806 | SLC26A2 | solute carrier family 26 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621312 | YIPF4 | Yip1 domain family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621358 | GUCA1B | guanylate cyclase activator 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT621366 | ART4 | ADP-ribosyltransferase 4 (Dombrock blood group) | ![]() |
![]() |
2 | 2 | ||||||
MIRT621547 | ZMYM1 | zinc finger MYM-type containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621883 | TAOK1 | TAO kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622451 | RNF19B | ring finger protein 19B | ![]() |
![]() |
2 | 2 | ||||||
MIRT623404 | KREMEN1 | kringle containing transmembrane protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT623587 | IPO9 | importin 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT623974 | FAM63A | MINDY lysine 48 deubiquitinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624086 | DPP8 | dipeptidyl peptidase 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624108 | DNAH10OS | dynein axonemal heavy chain 10 opposite strand | ![]() |
![]() |
2 | 2 | ||||||
MIRT632486 | RNF8 | ring finger protein 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634057 | PLIN3 | perilipin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634657 | GDE1 | glycerophosphodiester phosphodiesterase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640682 | MCUR1 | mitochondrial calcium uniporter regulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641242 | CENPN | centromere protein N | ![]() |
![]() |
2 | 2 | ||||||
MIRT642260 | ZNF677 | zinc finger protein 677 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642954 | RELA | RELA proto-oncogene, NF-kB subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT644326 | IPP | intracisternal A particle-promoted polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT644632 | ICA1L | islet cell autoantigen 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT645721 | POLR3A | RNA polymerase III subunit A | ![]() |
![]() |
2 | 2 | ||||||
MIRT647850 | LYPLA1 | lysophospholipase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT649281 | NEK8 | NIMA related kinase 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650038 | VHL | von Hippel-Lindau tumor suppressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT650354 | RRP36 | ribosomal RNA processing 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651144 | ZNF384 | zinc finger protein 384 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651778 | UTP6 | UTP6, small subunit processome component | ![]() |
![]() |
2 | 2 | ||||||
MIRT652576 | TLCD2 | TLC domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654621 | PTPRJ | protein tyrosine phosphatase, receptor type J | ![]() |
![]() |
2 | 2 | ||||||
MIRT656023 | MYO5A | myosin VA | ![]() |
![]() |
2 | 2 | ||||||
MIRT656105 | MSRB3 | methionine sulfoxide reductase B3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657749 | GMEB1 | glucocorticoid modulatory element binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657924 | GATSL2 | cytosolic arginine sensor for mTORC1 subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658848 | DUSP19 | dual specificity phosphatase 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659100 | DENND6A | DENN domain containing 6A | ![]() |
![]() |
2 | 2 | ||||||
MIRT659153 | DCX | doublecortin | ![]() |
![]() |
2 | 2 | ||||||
MIRT660870 | ADRBK2 | G protein-coupled receptor kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661941 | FAHD1 | fumarylacetoacetate hydrolase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663577 | C10orf32 | BLOC-1 related complex subunit 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664625 | WDPCP | WD repeat containing planar cell polarity effector | ![]() |
![]() |
2 | 4 | ||||||
MIRT666562 | RHOBTB3 | Rho related BTB domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669992 | GPR156 | G protein-coupled receptor 156 | ![]() |
![]() |
2 | 4 | ||||||
MIRT670445 | RSBN1L | round spermatid basic protein 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT670853 | IFNAR1 | interferon alpha and beta receptor subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT671942 | SPPL3 | signal peptide peptidase like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674269 | LMOD3 | leiomodin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674424 | MIOX | myo-inositol oxygenase | ![]() |
![]() |
2 | 4 | ||||||
MIRT674982 | ATP5G1 | ATP synthase, H+ transporting, mitochondrial Fo complex subunit C1 (subunit 9) | ![]() |
![]() |
2 | 2 | ||||||
MIRT675038 | BACE2 | beta-site APP-cleaving enzyme 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT675309 | C2orf68 | chromosome 2 open reading frame 68 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675641 | TTPAL | alpha tocopherol transfer protein like | ![]() |
![]() |
2 | 2 | ||||||
MIRT688688 | CPS1 | carbamoyl-phosphate synthase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689369 | ZNF101 | zinc finger protein 101 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689605 | AKAP6 | A-kinase anchoring protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691715 | LARS | leucyl-tRNA synthetase | ![]() |
![]() |
2 | 2 | ||||||
MIRT695473 | TRAT1 | T-cell receptor associated transmembrane adaptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695530 | MAP4K2 | mitogen-activated protein kinase kinase kinase kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695878 | CACNG8 | calcium voltage-gated channel auxiliary subunit gamma 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696586 | ORMDL2 | ORMDL sphingolipid biosynthesis regulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703007 | HEATR5A | HEAT repeat containing 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT707942 | PHKA1 | phosphorylase kinase regulatory subunit alpha 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709765 | GPR183 | G protein-coupled receptor 183 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710332 | ZNF669 | zinc finger protein 669 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713249 | ZFP30 | ZFP30 zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT716613 | RBM18 | RNA binding motif protein 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT733414 | BAG2 | BCL2 associated athanogene 2 | ![]() |
![]() |
2 | 0 | ||||||
MIRT756135 | THSD7A | thrombospondin type 1 domain containing 7A | 3 | 1 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|