miRTarBase - #MIRT500041


—
pre-miRNA Information
pre-miRNA hsa-mir-3200   
Genomic Coordinates chr22: 30731557 - 30731641
Description Homo sapiens miR-3200 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3200-3p
Sequence 54| CACCUUGCGCUACUCAGGUCUG |75
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1354947096 9 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PABPC3   
Synonyms PABP3, PABPL3, tPABP
Description poly(A) binding protein cytoplasmic 3
Transcript NM_030979   
Expression
Putative miRNA Targets on PABPC3
3'UTR of PABPC3
(miRNA target sites are highlighted)		 
>PABPC3|NM_030979|3'UTR
   1 AATTGATCAGAGACCACGAAAAGAAATTTGTGCTTCACCGAAGAAAAATATCTAAACATCGAGAAACTATGGGAAAAAAA
  81 ATTGCAAAATCTAAAATAAAAAATGCAAAATCTAAAATAAAAAATGGAAAGGAAACTTTGAACCTTATGTACCGAGCAAA
 161 TGCAAGGTCTAGCAAATATAATGCTAGTCCTAGATTACTTATTGATTTAAAAACAAAAAAAAGATTACTTAATTTTGATT
 241 TAAAAACAAAAAATCGTAAAATACAAAAACCAGTTAATGTTTTGTAGACCCTGGGAAAAGAATTTTCAGCAAAGTACAAA
 321 AATTTAAAGCATTCCTTTAATTTTTTAATTCTTTACTGTGGAATAGCTCAAAATGTCCATTCTGTTTTAAGTAACAGAAT
 401 TGATAACTGAGCAAGGAAACATGGTTTGGATTATAAAATTCTTGCTTTAATAAAAATTTCTTAAACAGTGAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gucUGGACUC-AUCGCGUUCCAc 5'
             ||| |||  | :||||||| 
Target 5' tgtACC-GAGCAAATGCAAGGTc 3'
 148 - 169 154.00 -15.90
2 
miRNA  3' guCUGGACUCAU---CGCGUUCCac 5'
            || :||| ||   | ||||||  
Target 5' caGAATTGA-TAACTGAGCAAGGaa 3'
 395 - 418 135.00 -13.50
3 
miRNA  3' guCU-GGACUC--AUC------G-CGUUCCAc 5'
            || ||||:|   ||      | |||| || 
Target 5' taGACCCTGGGAAAAGAATTTTCAGCAAAGTa 3'
 285 - 316 112.00 -11.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30464736 6 COSMIC
COSN30500707 7 COSMIC
COSN30168390 9 COSMIC
COSN26560900 12 COSMIC
COSN26987774 18 COSMIC
COSN13435605 19 COSMIC
COSN31613459 29 COSMIC
COSN30497058 30 COSMIC
COSN30158184 37 COSMIC
COSN30131842 41 COSMIC
COSN30481590 44 COSMIC
COSN15625650 53 COSMIC
COSN30161730 59 COSMIC
COSN31481284 61 COSMIC
COSN13435607 74 COSMIC
COSN13435608 75 COSMIC
COSN18737458 82 COSMIC
COSN30127387 83 COSMIC
COSN8127551 198 COSMIC
COSN31532330 206 COSMIC
COSN15627653 223 COSMIC
COSN30162984 241 COSMIC
COSN30530755 243 COSMIC
COSN30538113 257 COSMIC
COSN30200609 271 COSMIC
COSN30531864 287 COSMIC
COSN31534833 301 COSMIC
COSN31570944 320 COSMIC
COSN31607628 334 COSMIC
COSN30112331 352 COSMIC
COSN15625651 377 COSMIC
COSN15625652 379 COSMIC
COSN26643220 424 COSMIC
COSN29999097 435 COSMIC
COSN26558036 460 COSMIC
COSN6224739 539 COSMIC
COSN29590104 588 COSMIC
COSN28666283 1065 COSMIC
COSN6224740 1081 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs557247833 3 dbSNP
rs918060858 10 dbSNP
rs879203404 12 dbSNP
rs1426549189 14 dbSNP
rs760247222 16 dbSNP
rs879102421 18 dbSNP
rs1442398895 19 dbSNP
rs370438574 21 dbSNP
rs112394373 22 dbSNP
rs777157914 27 dbSNP
rs879030655 28 dbSNP
rs1244207733 29 dbSNP
rs1256847754 32 dbSNP
rs1474371330 36 dbSNP
rs760081170 39 dbSNP
rs375055169 40 dbSNP
rs201125478 41 dbSNP
rs1419106036 45 dbSNP
rs763079233 48 dbSNP
rs764379352 52 dbSNP
rs751531828 53 dbSNP
rs1165575305 54 dbSNP
rs1319384882 55 dbSNP
rs1379251183 59 dbSNP
rs1400185342 60 dbSNP
rs1406132854 61 dbSNP
rs1397465008 65 dbSNP
rs187286626 67 dbSNP
rs1320921632 68 dbSNP
rs191761057 71 dbSNP
rs1273736635 74 dbSNP
rs1469769459 74 dbSNP
rs182399718 75 dbSNP
rs559348782 83 dbSNP
rs1285963374 93 dbSNP
rs1224028753 97 dbSNP
rs9553534 98 dbSNP
rs1303142326 99 dbSNP
rs553004816 118 dbSNP
rs1439072586 123 dbSNP
rs900430536 126 dbSNP
rs996067378 131 dbSNP
rs1430162436 137 dbSNP
rs1343475184 141 dbSNP
rs1051617913 144 dbSNP
rs890278392 149 dbSNP
rs1171599460 154 dbSNP
rs1268034384 155 dbSNP
rs1326904715 158 dbSNP
rs573046066 163 dbSNP
rs1216623849 165 dbSNP
rs1346703974 168 dbSNP
rs1010018906 174 dbSNP
rs1020446165 177 dbSNP
rs1350472672 178 dbSNP
rs186673299 180 dbSNP
rs1214532491 181 dbSNP
rs1360431656 194 dbSNP
rs1290715594 203 dbSNP
rs1400686731 215 dbSNP
rs546832719 215 dbSNP
rs1311268966 216 dbSNP
rs376474222 219 dbSNP
rs1238181342 221 dbSNP
rs1169427791 223 dbSNP
rs1033989666 225 dbSNP
rs1421482745 226 dbSNP
rs1193830143 229 dbSNP
rs561972465 229 dbSNP
rs959633383 232 dbSNP
rs1255017198 233 dbSNP
rs991013281 249 dbSNP
rs1483348777 255 dbSNP
rs1256976283 257 dbSNP
rs1025127103 273 dbSNP
rs1180371236 274 dbSNP
rs1306337853 285 dbSNP
rs1255674928 290 dbSNP
rs1219380382 293 dbSNP
rs1354870793 297 dbSNP
rs1291473475 300 dbSNP
rs1420066192 301 dbSNP
rs1403115095 311 dbSNP
rs1184709340 315 dbSNP
rs1460270661 323 dbSNP
rs1356265402 328 dbSNP
rs1410213586 329 dbSNP
rs1457234222 332 dbSNP
rs1177761864 347 dbSNP
rs970859406 350 dbSNP
rs983592567 352 dbSNP
rs1424043403 364 dbSNP
rs1249376906 365 dbSNP
rs1177049170 367 dbSNP
rs1467092834 368 dbSNP
rs1199860228 378 dbSNP
rs907951939 383 dbSNP
rs1300734407 387 dbSNP
rs1271368021 388 dbSNP
rs1247005084 390 dbSNP
rs531213141 400 dbSNP
rs1306540109 401 dbSNP
rs1389506671 408 dbSNP
rs1375213544 412 dbSNP
rs1460876170 412 dbSNP
rs942094982 414 dbSNP
rs1166473145 418 dbSNP
rs973826978 422 dbSNP
rs1457957648 432 dbSNP
rs1362911811 437 dbSNP
rs921907540 466 dbSNP
rs58423353 467 dbSNP
rs780637167 467 dbSNP
rs931912237 467 dbSNP
rs1179593447 468 dbSNP
rs890327762 471 dbSNP
rs1251672188 473 dbSNP
rs1211768261 477 dbSNP
rs1290053584 477 dbSNP
rs1237194746 483 dbSNP
rs1032468008 486 dbSNP
rs956406910 491 dbSNP
rs1227753238 492 dbSNP
rs1439805200 512 dbSNP
rs1279195294 514 dbSNP
rs1325420408 520 dbSNP
rs945868261 523 dbSNP
rs1383660422 525 dbSNP
rs1156256687 527 dbSNP
rs544549794 530 dbSNP
rs1024930931 540 dbSNP
rs1159705249 553 dbSNP
rs1454094234 561 dbSNP
rs1483545089 567 dbSNP
rs564816244 569 dbSNP
rs1393854637 587 dbSNP
rs1452649395 588 dbSNP
rs999924035 588 dbSNP
rs1250129092 590 dbSNP
rs1203404868 592 dbSNP
rs1489396058 595 dbSNP
rs1034000178 597 dbSNP
rs533524152 605 dbSNP
rs970601297 611 dbSNP
rs1233356136 620 dbSNP
rs1472449589 626 dbSNP
rs1276354073 627 dbSNP
rs1233910707 628 dbSNP
rs1473099165 629 dbSNP
rs1325730246 639 dbSNP
rs1315620871 645 dbSNP
rs1401307935 648 dbSNP
rs1360830874 657 dbSNP
rs980603176 661 dbSNP
rs894132105 662 dbSNP
rs1427805529 663 dbSNP
rs9581259 664 dbSNP
rs565772947 665 dbSNP
rs1191205314 666 dbSNP
rs1478830953 668 dbSNP
rs984227051 676 dbSNP
rs1264222361 686 dbSNP
rs1210476840 687 dbSNP
rs539181540 694 dbSNP
rs528230740 697 dbSNP
rs908610018 698 dbSNP
rs1200754809 703 dbSNP
rs1338746625 705 dbSNP
rs1268336269 710 dbSNP
rs1219984443 714 dbSNP
rs533992343 714 dbSNP
rs200461700 717 dbSNP
rs1368509004 719 dbSNP
rs1360473320 720 dbSNP
rs1336560897 723 dbSNP
rs940074513 724 dbSNP
rs1396487172 726 dbSNP
rs1415399023 726 dbSNP
rs1408941181 728 dbSNP
rs1169124050 751 dbSNP
rs1467608660 754 dbSNP
rs1275382405 759 dbSNP
rs1187236722 763 dbSNP
rs1474350230 767 dbSNP
rs192517716 778 dbSNP
rs1188063828 801 dbSNP
rs1436998442 802 dbSNP
rs1413796756 809 dbSNP
rs901452747 817 dbSNP
rs567428230 822 dbSNP
rs932901860 835 dbSNP
rs1455314277 836 dbSNP
rs1217406718 838 dbSNP
rs1300750414 847 dbSNP
rs1049980745 849 dbSNP
rs1342937848 859 dbSNP
rs1230854033 863 dbSNP
rs1380976001 868 dbSNP
rs1284410954 879 dbSNP
rs1207613132 880 dbSNP
rs1335578513 886 dbSNP
rs1329667063 900 dbSNP
rs963814340 904 dbSNP
rs904694852 916 dbSNP
rs1164383827 917 dbSNP
rs142503400 917 dbSNP
rs1272702292 923 dbSNP
rs1416287069 937 dbSNP
rs775940666 943 dbSNP
rs1482944803 946 dbSNP
rs1222692396 964 dbSNP
rs1230988253 965 dbSNP
rs1248966669 966 dbSNP
rs1180217094 971 dbSNP
rs1458162854 971 dbSNP
rs537067969 973 dbSNP
rs1191109629 976 dbSNP
rs1322975863 977 dbSNP
rs931964586 978 dbSNP
rs1222873550 982 dbSNP
rs1032126922 988 dbSNP
rs1394003470 996 dbSNP
rs911816193 1009 dbSNP
rs1449507093 1010 dbSNP
rs1041958909 1011 dbSNP
rs1170120341 1011 dbSNP
rs904335517 1018 dbSNP
rs1324234135 1020 dbSNP
rs556939155 1028 dbSNP
rs7990563 1029 dbSNP
rs1378630526 1033 dbSNP
rs1409161650 1036 dbSNP
rs1160308858 1037 dbSNP
rs1394455690 1041 dbSNP
rs1189432691 1046 dbSNP
rs1009259939 1054 dbSNP
rs1055459475 1068 dbSNP
rs1351396594 1073 dbSNP
rs1214372286 1080 dbSNP
rs1025049478 1085 dbSNP
rs1434281821 1101 dbSNP
rs970339641 1105 dbSNP
rs1242825228 1107 dbSNP
rs980675488 1110 dbSNP
rs868249725 1112 dbSNP
rs1303086024 1114 dbSNP
rs1218007232 1117 dbSNP
rs1370292038 1124 dbSNP
rs1013877252 1145 dbSNP
rs1366058048 1146 dbSNP
rs1358931520 1148 dbSNP
rs1300253522 1156 dbSNP
rs1033520789 1158 dbSNP
rs1230636776 1159 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gucUGGACU-CAU--CGCGUUccac 5'
             |||| | |||  | ||||    
Target 5' --aACCUUAUGUACCGAGCAAaug- 3'
 		1 - 22
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 5042.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 5042.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000281589.3 | 3UTR | AAACUUUGAACCUUAUGUACCGAGCAAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000281589.3 | 3UTR | AACCUUAUGUACCGAGCAAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000281589.3 | 3UTR | AACCUUAUGUACCGAGCAAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000281589.3 | 3UTR | AAAGGAAACUUUGAACCUUAUGUACCGAGCAAAUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000281589.3 | 3UTR | AACCUUAUGUACCGAGCAAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000281589.3 | 3UTR | AACCUUAUGUACCGAGCAAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000281589.3 | 3UTR | AACCUUAUGUACCGAGCAAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000281589.3 | 3UTR | AACCUUAUGUACCGAGCAAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000281589.3 | 3UTR | AACCUUAUGUACCGAGCAAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.467 0 0.434 0 45 Click to see details
PRAD 0.261 0.04 0.248 0.05 44 Click to see details
BLCA -0.32 0.11 -0.203 0.23 16 Click to see details
UCEC -0.261 0.14 -0.186 0.22 19 Click to see details
KIRP 0.172 0.17 0.103 0.29 32 Click to see details
HNSC -0.152 0.18 -0.223 0.09 38 Click to see details
LUSC -0.137 0.21 -0.030 0.43 38 Click to see details
THCA -0.096 0.23 -0.069 0.3 59 Click to see details
CESC -0.6 0.3 -0.500 0.33 3 Click to see details
BRCA 0.064 0.3 0.077 0.26 73 Click to see details
STAD -0.1 0.3 -0.091 0.31 31 Click to see details
CHOL 0.221 0.3 -0.167 0.35 8 Click to see details
PAAD 0.376 0.31 0.600 0.2 4 Click to see details
PCPG -0.322 0.4 -0.500 0.33 3 Click to see details
LUAD 0.089 0.41 -0.067 0.43 9 Click to see details
ESCA 0.052 0.46 -0.143 0.38 7 Click to see details
KIRC 0.013 0.46 -0.022 0.43 65 Click to see details
KICH 0.008 0.48 0.014 0.47 25 Click to see details
KICH 0.008 0.48 0.014 0.47 25 Click to see details
35 hsa-miR-3200-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT052815 CDC37 cell division cycle 37 1 1
MIRT052816 ATP6V1E2 ATPase H+ transporting V1 subunit E2 1 1
MIRT052817 MCM3AP minichromosome maintenance complex component 3 associated protein 1 1
MIRT052818 NSUN4 NOP2/Sun RNA methyltransferase family member 4 1 1
MIRT052819 EXOC4 exocyst complex component 4 1 1
MIRT052820 DDB1 damage specific DNA binding protein 1 1 1
MIRT052821 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT052822 RPL23 ribosomal protein L23 1 1
MIRT052823 TPT1 tumor protein, translationally-controlled 1 1 1
MIRT052824 RPSA ribosomal protein SA 1 1
MIRT052825 PPIA peptidylprolyl isomerase A 1 1
MIRT052826 SSRP1 structure specific recognition protein 1 1 1
MIRT052827 STX2 syntaxin 2 1 1
MIRT095464 PURA purine rich element binding protein A 2 4
MIRT325192 PSAT1 phosphoserine aminotransferase 1 2 2
MIRT447293 ZNF562 zinc finger protein 562 2 2
MIRT450360 GRAMD3 GRAM domain containing 2B 2 2
MIRT482917 ZNF845 zinc finger protein 845 2 2
MIRT498302 DCAF8 DDB1 and CUL4 associated factor 8 2 2
MIRT500041 PABPC3 poly(A) binding protein cytoplasmic 3 2 8
MIRT541475 ARHGAP12 Rho GTPase activating protein 12 2 12
MIRT556269 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT565440 SURF4 surfeit 4 2 2
MIRT573386 GPR20 G protein-coupled receptor 20 2 2
MIRT627911 OCIAD2 OCIA domain containing 2 2 2
MIRT633645 SKAP2 src kinase associated phosphoprotein 2 2 2
MIRT643472 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT646284 GALNT2 polypeptide N-acetylgalactosaminyltransferase 2 2 2
MIRT647889 CD55 CD55 molecule (Cromer blood group) 2 2
MIRT664712 EIF4G3 eukaryotic translation initiation factor 4 gamma 3 2 2
MIRT668135 GINS2 GINS complex subunit 2 2 2
MIRT686490 TRIOBP TRIO and F-actin binding protein 2 2
MIRT709525 IGF2 insulin like growth factor 2 2 2
MIRT722252 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 2 2
MIRT755478 CAMK2A calcium/calmodulin dependent protein kinase II alpha 4 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-3200 Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7, T47D)
hsa-mir-3200 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-3200 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-3200 Tamoxifen 2733525 NSC180973 approved resistant cell line (MCF7)
hsa-mir-3200 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-3200 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-3200-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3200-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3200-3p Plx-4720 24180719 NSC757438 sensitive High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-3200-3p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-3200-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-3200-3p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-3200-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-3200-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-miR-3200-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-3200-3p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-3200-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-3200-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3200-3p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-3200-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission