pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4666a |
Genomic Coordinates | chr1: 228462074 - 228462152 |
Description | Homo sapiens miR-4666a stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4666a-5p | |||||||||||||||||||||||||||
Sequence | 10| AUACAUGUCAGAUUGUAUGCC |30 | |||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | TXNIP | ||||||||||||||||||||
Synonyms | ARRDC6, EST01027, HHCPA78, THIF, VDUP1 | ||||||||||||||||||||
Description | thioredoxin interacting protein | ||||||||||||||||||||
Transcript | NM_006472 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on TXNIP | |||||||||||||||||||||
3'UTR of TXNIP (miRNA target sites are highlighted) |
>TXNIP|NM_006472|3'UTR 1 GCATGTGGAAGAAAAGAAGCAGCTTTACCTACTTGTTTCTTTTTGTCTCTCTTCCTGGACACTCACTTTTTCAGAGACTC 81 AACAGTCTCTGCAATGGAGTGTGGGTCCACCTTAGCCTCTGACTTCCTAATGTAGGAGGTGGTCAGCAGGCAATCTCCTG 161 GGCCTTAAAGGATGCGGACTCATCCTCAGCCAGCGCCCATGTTGTGATACAGGGGTGTTTGTTGGATGGGTTTAAAAATA 241 ACTAGAAAAACTCAGGCCCATCCATTTTCTCAGATCTCCTTGAAAATTGAGGCCTTTTCGATAGTTTCGGGTCAGGTAAA 321 AATGGCCTCCTGGCGTAAGCTTTTCAAGGTTTTTTGGAGGCTTTTTGTAAATTGTGATAGGAACTTTGGACCTTGAACTT 401 ACGTATCATGTGGAGAAGAGCCAATTTAACAAACTAGGAAGATGAAAAGGGAAATTGTGGCCAAAACTTTGGGAAAAGGA 481 GGTTCTTAAAATCAGTGTTTCCCCTTTGTGCACTTGTAGAAAAAAAAGAAAAACCTTCTAGAGCTGATTTGATGGACAAT 561 GGAGAGAGCTTTCCCTGTGATTATAAAAAAGGAAGCTAGCTGCTCTACGGTCATCTTTGCTTAGAGTATACTTTAACCTG 641 GCTTTTAAAGCAGTAGTAACTGCCCCACCAAAGGTCTTAAAAGCCATTTTTGGAGCCTATTGCACTGTGTTCTCCTACTG 721 CAAATATTTTCATATGGGAGGATGGTTTTCTCTTCATGTAAGTCCTTGGAATTGATTCTAAGGTGATGTTCTTAGCACTT 801 TAATTCCTGTCAAATTTTTTGTTCTCCCCTTCTGCCATCTTAAATGTAAGCTGAAACTGGTCTACTGTGTCTCTAGGGTT 881 AAGCCAAAAGACAAAAAAAATTTTACTACTTTTGAGATTGCCCCAATGTACAGAATTATATAATTCTAACGCTTAAATCA 961 TGTGAAAGGGTTGCTGCTGTCAGCCTTGCCCACTGTGACTTCAAACCCAAGGAGGAACTCTTGATCAAGATGCCCAACCC 1041 TGTGATCAGAACCTCCAAATACTGCCATGAGAAACTAGAGGGCAGGTCTTCATAAAAGCCCTTTGAACCCCCTTCCTGCC 1121 CTGTGTTAGGAGATAGGGATATTGGCCCCTCACTGCAGCTGCCAGCACTTGGTCAGTCACTCTCAGCCATAGCACTTTGT 1201 TCACTGTCCTGTGTCAGAGCACTGAGCTCCACCCTTTTCTGAGAGTTATTACAGCCAGAAAGTGTGGGCTGAAGATGGTT 1281 GGTTTCATGTTTTTGTATTATGTATCTTTTTGTATGGTAAAGACTATATTTTGTACTTAACCAGATATATTTTTACCCCA 1361 GATGGGGATATTCTTTGTAAAAAATGAAAATAAAGTTTTTTTAATGGAAAAAAAAATGTCTGTGAAAAAAAAAAAAAAAA 1441 AA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | MCF7 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
CLIP-seq Support 1 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000369317.4 | 3UTR | CCAUUUUUGGAGCCUAUUGCACUGUGUUCUCCUACUGCAAAUAUUUUCAUAUGGGAGGAUGGUUUUCUCUUCAUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset SRR1045082 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | MCF7 / Untreated |
Location of target site | ENST00000369317.4 | 3UTR | CCUAUUGCACUGUGUUCUCCUACUGCAAAUAUUUUCAUAUGGGAGGAUGGUUUUCUCUUCAUGUAAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24398324 / SRX388831 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
83 hsa-miR-4666a-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT057266 | FAM35A | family with sequence similarity 35 member A | 2 | 2 | ||||||||
MIRT059969 | PATL1 | PAT1 homolog 1, processing body mRNA decay factor | 2 | 6 | ||||||||
MIRT079031 | TNRC6C | trinucleotide repeat containing 6C | 2 | 2 | ||||||||
MIRT079631 | DNAJB4 | DnaJ heat shock protein family (Hsp40) member B4 | 2 | 2 | ||||||||
MIRT086974 | LANCL1 | LanC like 1 | 2 | 2 | ||||||||
MIRT091804 | GOLGA4 | golgin A4 | 2 | 2 | ||||||||
MIRT229501 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | 2 | 4 | ||||||||
MIRT255972 | WDR17 | WD repeat domain 17 | 2 | 2 | ||||||||
MIRT262975 | ADO | 2-aminoethanethiol dioxygenase | 2 | 2 | ||||||||
MIRT264774 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | 2 | 2 | ||||||||
MIRT334169 | CCND1 | cyclin D1 | 2 | 6 | ||||||||
MIRT345868 | SRSF2 | serine and arginine rich splicing factor 2 | 2 | 2 | ||||||||
MIRT452477 | DDX4 | DEAD-box helicase 4 | 2 | 2 | ||||||||
MIRT455764 | TSPAN6 | tetraspanin 6 | 2 | 4 | ||||||||
MIRT461627 | DCAF15 | DDB1 and CUL4 associated factor 15 | 2 | 4 | ||||||||
MIRT465169 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | 2 | 4 | ||||||||
MIRT468950 | RPS14 | ribosomal protein S14 | 2 | 6 | ||||||||
MIRT483236 | C2orf72 | chromosome 2 open reading frame 72 | 2 | 8 | ||||||||
MIRT498544 | TMEM30B | transmembrane protein 30B | 2 | 2 | ||||||||
MIRT500633 | TXNIP | thioredoxin interacting protein | 2 | 4 | ||||||||
MIRT504113 | GPR158 | G protein-coupled receptor 158 | 2 | 2 | ||||||||
MIRT504428 | ZNF85 | zinc finger protein 85 | 2 | 6 | ||||||||
MIRT505036 | ZNF451 | zinc finger protein 451 | 2 | 2 | ||||||||
MIRT506526 | MRPL17 | mitochondrial ribosomal protein L17 | 2 | 6 | ||||||||
MIRT508773 | GSG1 | germ cell associated 1 | 2 | 2 | ||||||||
MIRT517297 | ELF4 | E74 like ETS transcription factor 4 | 2 | 6 | ||||||||
MIRT519353 | OBFC1 | STN1, CST complex subunit | 2 | 4 | ||||||||
MIRT523891 | ENPP6 | ectonucleotide pyrophosphatase/phosphodiesterase 6 | 2 | 6 | ||||||||
MIRT527509 | ZNF134 | zinc finger protein 134 | 2 | 2 | ||||||||
MIRT531218 | IFNGR2 | interferon gamma receptor 2 | 2 | 2 | ||||||||
MIRT535957 | MOGAT1 | monoacylglycerol O-acyltransferase 1 | 2 | 2 | ||||||||
MIRT537229 | GALNT7 | polypeptide N-acetylgalactosaminyltransferase 7 | 2 | 4 | ||||||||
MIRT537337 | FKBP5 | FK506 binding protein 5 | 2 | 2 | ||||||||
MIRT539125 | ARHGEF17 | Rho guanine nucleotide exchange factor 17 | 2 | 2 | ||||||||
MIRT539910 | ISPD | isoprenoid synthase domain containing | 2 | 2 | ||||||||
MIRT541527 | MGAT4C | MGAT4 family member C | 2 | 2 | ||||||||
MIRT546119 | USP25 | ubiquitin specific peptidase 25 | 2 | 2 | ||||||||
MIRT548846 | CERCAM | cerebral endothelial cell adhesion molecule | 2 | 2 | ||||||||
MIRT549892 | LINC00955 | long intergenic non-protein coding RNA 955 | 2 | 2 | ||||||||
MIRT549898 | ADH4 | alcohol dehydrogenase 4 (class II), pi polypeptide | 2 | 2 | ||||||||
MIRT550763 | ENOX2 | ecto-NOX disulfide-thiol exchanger 2 | 2 | 4 | ||||||||
MIRT553200 | UBE2A | ubiquitin conjugating enzyme E2 A | 2 | 2 | ||||||||
MIRT553970 | SRSF10 | serine and arginine rich splicing factor 10 | 2 | 2 | ||||||||
MIRT554092 | SMU1 | DNA replication regulator and spliceosomal factor | 2 | 2 | ||||||||
MIRT555208 | PROX1 | prospero homeobox 1 | 2 | 4 | ||||||||
MIRT555834 | PAX5 | paired box 5 | 2 | 4 | ||||||||
MIRT556865 | JAZF1 | JAZF zinc finger 1 | 2 | 2 | ||||||||
MIRT558594 | CREBL2 | cAMP responsive element binding protein like 2 | 2 | 2 | ||||||||
MIRT559690 | AGO2 | argonaute 2, RISC catalytic component | 2 | 4 | ||||||||
MIRT563312 | ORC4 | origin recognition complex subunit 4 | 2 | 2 | ||||||||
MIRT563585 | FAM229B | family with sequence similarity 229 member B | 2 | 2 | ||||||||
MIRT563853 | ALYREF | Aly/REF export factor | 2 | 4 | ||||||||
MIRT565146 | TUBB2A | tubulin beta 2A class IIa | 2 | 2 | ||||||||
MIRT565769 | SEPHS1 | selenophosphate synthetase 1 | 2 | 2 | ||||||||
MIRT568317 | BACH1 | BTB domain and CNC homolog 1 | 2 | 2 | ||||||||
MIRT575387 | Unc5b | unc-5 netrin receptor B | 2 | 4 | ||||||||
MIRT607728 | BDH1 | 3-hydroxybutyrate dehydrogenase 1 | 2 | 8 | ||||||||
MIRT612691 | PLXNA4 | plexin A4 | 2 | 4 | ||||||||
MIRT615916 | GDPD1 | glycerophosphodiester phosphodiesterase domain containing 1 | 2 | 2 | ||||||||
MIRT629792 | P2RY1 | purinergic receptor P2Y1 | 2 | 2 | ||||||||
MIRT632119 | FKBP9 | FK506 binding protein 9 | 2 | 2 | ||||||||
MIRT645554 | ZDHHC15 | zinc finger DHHC-type containing 15 | 2 | 4 | ||||||||
MIRT651479 | WWC3 | WWC family member 3 | 2 | 2 | ||||||||
MIRT654138 | RPH3A | rabphilin 3A | 2 | 6 | ||||||||
MIRT655191 | PHAX | phosphorylated adaptor for RNA export | 2 | 2 | ||||||||
MIRT665543 | UNC5B | unc-5 netrin receptor B | 2 | 5 | ||||||||
MIRT668057 | GRIK3 | glutamate ionotropic receptor kainate type subunit 3 | 2 | 2 | ||||||||
MIRT678978 | CERS4 | ceramide synthase 4 | 2 | 4 | ||||||||
MIRT679124 | RBM3 | RNA binding motif (RNP1, RRM) protein 3 | 2 | 2 | ||||||||
MIRT686776 | AZF1 | azoospermia factor 1 | 2 | 2 | ||||||||
MIRT687144 | PTPN12 | protein tyrosine phosphatase, non-receptor type 12 | 2 | 2 | ||||||||
MIRT691453 | C21orf58 | chromosome 21 open reading frame 58 | 2 | 2 | ||||||||
MIRT691469 | FAM98B | family with sequence similarity 98 member B | 2 | 2 | ||||||||
MIRT697031 | UHRF1BP1 | UHRF1 binding protein 1 | 2 | 2 | ||||||||
MIRT698401 | TM9SF3 | transmembrane 9 superfamily member 3 | 2 | 2 | ||||||||
MIRT702056 | RNMT | RNA guanine-7 methyltransferase | 2 | 2 | ||||||||
MIRT705903 | ADAM9 | ADAM metallopeptidase domain 9 | 2 | 2 | ||||||||
MIRT707491 | MMADHC | methylmalonic aciduria and homocystinuria, cblD type | 2 | 2 | ||||||||
MIRT708080 | KLHL23 | kelch like family member 23 | 2 | 2 | ||||||||
MIRT709738 | TRIM27 | tripartite motif containing 27 | 2 | 2 | ||||||||
MIRT710056 | RWDD2A | RWD domain containing 2A | 2 | 2 | ||||||||
MIRT710226 | KCNK1 | potassium two pore domain channel subfamily K member 1 | 2 | 2 | ||||||||
MIRT712043 | STYK1 | serine/threonine/tyrosine kinase 1 | 2 | 2 |