miRTarBase - #MIRT501161


—
pre-miRNA Information
pre-miRNA hsa-mir-6787   
Genomic Coordinates chr17: 82236668 - 82236728
Description Homo sapiens miR-6787 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6787-5p
Sequence 6| UGGCGGGGGUAGAGCUGGCUGC |27
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs778888046 4 dbSNP
rs772018061 5 dbSNP
rs760886644 6 dbSNP
rs776925052 7 dbSNP
rs760060985 8 dbSNP
rs1432528063 9 dbSNP
rs778772390 10 dbSNP
rs924024166 11 dbSNP
rs201523090 13 dbSNP
rs1451075810 17 dbSNP
rs1378844609 18 dbSNP
Putative Targets

Gene Information
Gene Symbol SLC10A7   
Synonyms C4orf13, P7
Description solute carrier family 10 member 7
Transcript NM_001029998   
Other Transcripts NM_032128   
Expression
Putative miRNA Targets on SLC10A7
3'UTR of SLC10A7
(miRNA target sites are highlighted)		 
>SLC10A7|NM_001029998|3'UTR
   1 CAAAGGAGGTGGACTTTCTGTAGCAATGTATATATGTACAGGATTGTACATACTAGCAATTCTGAAGACTTGTACTTGTG
  81 AATGTTGCCTCAATGCATATTTTATTTTTTTACACAAAAATATGAGATCCTGTTTAAGTGCCTTAAAATGTATTTGACAA
 161 GAGCGTTATTTCCAAAATATGCTTTGTTGATTACTGCCAGGGGTGGTACAATATTTGGGGGTTAATTTTGCTTTCCTAAT
 241 GCAGGAATCAGTCATGGTAAGTGACAAAAAGCAAACATGCTTTCCCTGCAGCACCTTTGTGCAATACAACCCTATAGTAG
 321 TTACTGTAATGTTTGAAATGAGGTCACACCATCAGGAAAATGCCCTTCTGATGACAGTGAAAATTTCCAAAGTCTTATTC
 401 ATGCATACTTTGATTTACTGTGTGATTCTTTTTTTCTACGACTGTGACATGCCTCTTCCTTATCAACTCAGCAGGGGTCA
 481 TAGATCGAATAGATGCTGAAAAGCGTAAGATATATGCATTCCTTGACATCATTTTTAAAGACATTCCTTCAAATAGTTTC
 561 CACACAGAAATTCCTCACTCCCATTATGAGAGATTGTGGTTATATGTCTTAAATTTATTATAAGCTGCTTCAAAGAAAGG
 641 GTCTGAATGTTTGAATTATGAGTGAAATCATGTGAAATTTTGAGTTAAACTCTGTGATTTGATTTTCAGGGTCTTTAAAA
 721 TATATCTTAATATCTTCTTCCTCTTTATTCAATAATTTCTGTCTTGCACTTACACACTCATAACAGCCAAATATGAGGCA
 801 CAAAAATGTTACAATCAGTTTGAAAGCAGCATCAATTAATGGTAGATTCTATTCACATTCCACAACCCAGACCAAATTTT
 881 TTTCCTATTACGCAGATGTGCTGAGCACTTTCCAGATTGCCCCTGTTGGCCAAAAGCAGCCTGTTACATCCTGGAATTAA
 961 GCACACTTAAGGTATTTGAGACAATTTATTAATGAAAATTTCCTTGGCAGATTTGACAAATGTTGGCAATATTTTTTTAG
1041 AAGTTAAATCATATTGCTTTCATGAATAAATGAAAATATAAAGGTCATGGATGCAAACAAATGTTACATATACACATTCT
1121 GTCTCTCCAGATGAAAAGAACATGCAAAACCATTTAATAACCAAAATATCAAGTAAAATTAGTTCCCAACGGGGCAGCAG
1201 CTTTCAAATGAGTGTCCAATATTTGCTTCTGCTATAGCTGCAAGAACTGTAACTGGACCCAAGTAGAGAATGAAGCCACG
1281 TATAGAACTACGAGAACACTTTTCTGTGTTTCCCCCATGCCGTCCTGTCACATCCTCTTACACGTCCTCTCTTGATTTGA
1361 TAGACAATATTGGCATCCTGGGTCTCACTGAGGCCGTGCTATGTCCTCAGCAGCTGTTTTTGTTGTTTCGTTATTATGCC
1441 CACAACAAAAAATCATTCCTTAGAAACTCACCAAGTTTATCTACTGTGTAAATTTATATTATTGTTACTACCAGGTCTCA
1521 TCTTTTGTCAATGTCATTGAATAAATTTCATAAGAGTTATTCTCAGTGTGAATTTTAAGGCTAATGCCAGATCCTGCAAA
1601 AATCTATGCTAACCAGGCTGTAGTACACACTGTTATAAAGAATTTTACTTGTGTCTAAAACTACAGTAATTTTGCTTAGG
1681 TAATTGTGCTTACCTATGGAGCACAGGAAGGCTCTTAGGTTTTGTTCCTACAAGTTTCTTTGAATTTTGGAGTAAATGGA
1761 AGTGTCTGTCTGTCTGTCATCTATCTGCCCTATCATAAAAATCTTTCTCCCTAACATTAAAATACTGATCCCCGCCCCCA
1841 ACTTATCTACCTCTATTGTCTAACACCTATAGTAGGTGTGATCATGGGATAAAATTCAACTGAAAATGCTATGATAACAT
1921 TTTATCGTTTGCTTTAAAAATGTGCTTTGTTTTCAAATAATCTTTACATAGTGAACTTTGGTGGCGTTAGTGATATGTTT
2001 ATGCCTATTTCTTTTTTTTACACAAATTCCTTGGCATATTTTTTCATAAAGAACAAAAAATAAAATCAAAATTTATTTTT
2081 AATTCATGCTTATTGGGATTTAATTATTCAGAGCTTAAAATATTTTGTTATGTTTATACACTGTAAAGCTATCTGTTTTA
2161 TGCATTTGTTTTGTCTAAATGTATTTATGAAAGAAATACATTAGATTATATTTATGTTTACTCATTTTTCCACCTGGATT
2241 TTTTTTAATGGTTGTTACAAAATTAGATTTTTTAATGGGTAATAATGTTGGTATTTTCATGTTTTTTCTTAGTATTAAAA
2321 TTTTTGTGGGTTTTTTAAAATTTTTCCCTATTCTGTTAAAAATTAACACACCTCTAGCTAATGTTCAGTGTTTGTGCTAA
2401 ATACCAAATTTTTTCAAAAGGATTGGTTAAGTCATAAAGTGGATTATTTATGATGACTGGAAGATGAAAATAATTATATG
2481 ATTAAACAAAGAATGTTTCAGAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgucggucgaGA-UGGGGGCGGu 5'
                    || |:||||||| 
Target 5' cattaaaataCTGATCCCCGCCc 3'
 1815 - 1837 148.00 -18.80
2 
miRNA  3' cgUCGGUCG-A-GAUGGGGGCGgu 5'
            ||| | | | || :|||:||  
Target 5' aaAGCAAACATGCTTTCCCTGCag 3'
 268 - 291 120.00 -18.40
3 
miRNA  3' cgucGGUCGAGAUGGGGGCGGu 5'
              |||| | |:||||:|:: 
Target 5' ctttCCAGAT-TGCCCCTGTTg 3'
 908 - 928 117.00 -21.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN21782125 41 COSMIC
COSN31573830 70 COSMIC
COSN30486428 76 COSMIC
COSN31596571 122 COSMIC
COSN31587084 141 COSMIC
COSN30757086 145 COSMIC
COSN30110132 156 COSMIC
COSN28639563 175 COSMIC
COSN30105714 271 COSMIC
COSN19661153 302 COSMIC
COSN9217487 457 COSMIC
COSN17182934 458 COSMIC
COSN1997364 804 COSMIC
COSN31778374 891 COSMIC
COSN5556632 900 COSMIC
COSN26722569 920 COSMIC
COSN22816070 943 COSMIC
COSN31529748 986 COSMIC
COSN31523476 1027 COSMIC
COSN31487090 1064 COSMIC
COSN20585040 1133 COSMIC
COSN22914788 1173 COSMIC
COSN17078422 1279 COSMIC
COSN31576162 1284 COSMIC
COSN9885498 1291 COSMIC
COSN26098706 1303 COSMIC
COSN9217486 1332 COSMIC
COSN5865519 1343 COSMIC
COSN22179415 1719 COSMIC
COSN9885497 1845 COSMIC
COSN20306620 2478 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs745707741 5 dbSNP
rs773154588 16 dbSNP
rs777953099 17 dbSNP
rs1277781572 20 dbSNP
rs770103271 20 dbSNP
rs570698255 21 dbSNP
rs115463059 22 dbSNP
rs1489996458 23 dbSNP
rs373542573 24 dbSNP
rs755028074 25 dbSNP
rs1309634042 26 dbSNP
rs375773254 27 dbSNP
rs1214188580 30 dbSNP
rs780745055 31 dbSNP
rs750767276 32 dbSNP
rs765723496 34 dbSNP
rs756865073 39 dbSNP
rs1308567157 41 dbSNP
rs866022689 43 dbSNP
rs1444036350 44 dbSNP
rs753443829 45 dbSNP
rs1433656236 54 dbSNP
rs537235258 57 dbSNP
rs567943521 59 dbSNP
rs536272196 60 dbSNP
rs1443258770 68 dbSNP
rs1008317142 79 dbSNP
rs1353742325 80 dbSNP
rs376849653 80 dbSNP
rs998983483 82 dbSNP
rs1293914501 99 dbSNP
rs560214788 103 dbSNP
rs180802220 105 dbSNP
rs1229943383 126 dbSNP
rs1011732648 128 dbSNP
rs1306671393 145 dbSNP
rs1418678295 147 dbSNP
rs1205484475 149 dbSNP
rs893332117 157 dbSNP
rs1055991084 160 dbSNP
rs1186627141 162 dbSNP
rs1237540370 163 dbSNP
rs533186346 164 dbSNP
rs565446070 165 dbSNP
rs766947189 171 dbSNP
rs11930848 175 dbSNP
rs1430829328 177 dbSNP
rs1170828657 180 dbSNP
rs1373870626 182 dbSNP
rs1255051716 193 dbSNP
rs190892332 194 dbSNP
rs1483018864 196 dbSNP
rs1252138163 200 dbSNP
rs940725056 200 dbSNP
rs113968577 203 dbSNP
rs930410875 206 dbSNP
rs1228877423 211 dbSNP
rs1276442864 214 dbSNP
rs1305884544 215 dbSNP
rs1209703292 217 dbSNP
rs1278761333 222 dbSNP
rs1443621751 238 dbSNP
rs920323611 239 dbSNP
rs1242076804 242 dbSNP
rs1450561918 245 dbSNP
rs1190924078 247 dbSNP
rs931144370 248 dbSNP
rs919739554 250 dbSNP
rs1173341051 254 dbSNP
rs971876093 256 dbSNP
rs1234369887 257 dbSNP
rs1399047734 261 dbSNP
rs1317650722 263 dbSNP
rs1344551793 267 dbSNP
rs1435714679 272 dbSNP
rs963731535 275 dbSNP
rs562311254 277 dbSNP
rs1291768052 289 dbSNP
rs912315807 293 dbSNP
rs1346638116 299 dbSNP
rs1057560 302 dbSNP
rs1282869292 309 dbSNP
rs911851162 316 dbSNP
rs1460012742 320 dbSNP
rs967476476 321 dbSNP
rs987774932 322 dbSNP
rs1251561294 325 dbSNP
rs1020515368 329 dbSNP
rs955428812 340 dbSNP
rs1379596044 347 dbSNP
rs1468748022 354 dbSNP
rs1158130593 365 dbSNP
rs957622053 373 dbSNP
rs1322440892 374 dbSNP
rs1034480627 375 dbSNP
rs1386040725 380 dbSNP
rs1028753104 393 dbSNP
rs1332474186 394 dbSNP
rs1165013092 400 dbSNP
rs1462895085 401 dbSNP
rs1329197808 405 dbSNP
rs528150053 420 dbSNP
rs1435214303 429 dbSNP
rs1271849062 432 dbSNP
rs1334721081 435 dbSNP
rs975387404 439 dbSNP
rs1269900883 440 dbSNP
rs1436360249 458 dbSNP
rs572929720 475 dbSNP
rs1181328533 476 dbSNP
rs1415606912 477 dbSNP
rs1252689980 478 dbSNP
rs182205936 478 dbSNP
rs1001704051 486 dbSNP
rs907282548 487 dbSNP
rs539385960 490 dbSNP
rs957443830 498 dbSNP
rs1415590499 504 dbSNP
rs1004874133 505 dbSNP
rs1163682210 509 dbSNP
rs1251482261 512 dbSNP
rs1389359174 514 dbSNP
rs1033059333 516 dbSNP
rs886464675 518 dbSNP
rs570549061 521 dbSNP
rs1049080590 536 dbSNP
rs1411156082 543 dbSNP
rs1290843309 553 dbSNP
rs1355451222 574 dbSNP
rs999057128 576 dbSNP
rs903349209 577 dbSNP
rs1024584414 579 dbSNP
rs1337830653 582 dbSNP
rs1195543960 583 dbSNP
rs866707106 586 dbSNP
rs1484122269 587 dbSNP
rs1179245576 594 dbSNP
rs1185912955 599 dbSNP
rs898425977 602 dbSNP
rs1039474226 605 dbSNP
rs942577751 607 dbSNP
rs1479785497 617 dbSNP
rs912299534 619 dbSNP
rs1167681976 625 dbSNP
rs576799107 640 dbSNP
rs552350251 641 dbSNP
rs530992037 657 dbSNP
rs536993811 658 dbSNP
rs1237585271 665 dbSNP
rs1310618421 672 dbSNP
rs986977294 672 dbSNP
rs542212226 673 dbSNP
rs749024272 685 dbSNP
rs912860723 689 dbSNP
rs1228133811 692 dbSNP
rs1298723778 694 dbSNP
rs989837393 701 dbSNP
rs957567979 704 dbSNP
rs1055889787 713 dbSNP
rs1483606449 721 dbSNP
rs1202195508 726 dbSNP
rs1271876650 733 dbSNP
rs1426594683 734 dbSNP
rs930275007 739 dbSNP
rs980256577 741 dbSNP
rs1244489311 757 dbSNP
rs1450991913 764 dbSNP
rs898929308 766 dbSNP
rs1036064390 767 dbSNP
rs1329260836 776 dbSNP
rs568023421 777 dbSNP
rs1466133679 780 dbSNP
rs1304011634 803 dbSNP
rs1383456724 811 dbSNP
rs940550682 814 dbSNP
rs1308689125 815 dbSNP
rs1389253221 816 dbSNP
rs1321721233 818 dbSNP
rs1367754149 825 dbSNP
rs1024376637 827 dbSNP
rs547934575 830 dbSNP
rs1375710263 835 dbSNP
rs911700154 836 dbSNP
rs1235516359 838 dbSNP
rs1258977575 855 dbSNP
rs575560674 857 dbSNP
rs886540813 866 dbSNP
rs1325936046 867 dbSNP
rs1208002042 868 dbSNP
rs1028034734 870 dbSNP
rs931909850 872 dbSNP
rs1191473337 876 dbSNP
rs1424036911 881 dbSNP
rs1164183620 884 dbSNP
rs1433354085 884 dbSNP
rs1454106572 891 dbSNP
rs1365261272 892 dbSNP
rs774998040 896 dbSNP
rs1156689989 899 dbSNP
rs921832765 903 dbSNP
rs1391403365 907 dbSNP
rs1417510304 921 dbSNP
rs1439202903 924 dbSNP
rs1293233705 931 dbSNP
rs534529876 937 dbSNP
rs975418290 942 dbSNP
rs1368588366 956 dbSNP
rs898416123 960 dbSNP
rs1305012497 962 dbSNP
rs1379951405 965 dbSNP
rs1194304926 984 dbSNP
rs1229030888 988 dbSNP
rs1328549996 988 dbSNP
rs1268732468 989 dbSNP
rs1219130255 992 dbSNP
rs190025949 995 dbSNP
rs1488639968 1008 dbSNP
rs1192535560 1012 dbSNP
rs1469919046 1020 dbSNP
rs367936450 1025 dbSNP
rs942516983 1027 dbSNP
rs1471988981 1036 dbSNP
rs957350244 1038 dbSNP
rs926066945 1039 dbSNP
rs1036016 1040 dbSNP
rs1460283795 1041 dbSNP
rs1050958806 1043 dbSNP
rs1350802984 1044 dbSNP
rs533333901 1046 dbSNP
rs754063945 1050 dbSNP
rs1350060153 1051 dbSNP
rs1410525900 1064 dbSNP
rs1290231673 1066 dbSNP
rs1352324947 1067 dbSNP
rs2291379 1072 dbSNP
rs1014402820 1078 dbSNP
rs538890436 1079 dbSNP
rs959219068 1083 dbSNP
rs1288925501 1089 dbSNP
rs1262804720 1108 dbSNP
rs1322074902 1114 dbSNP
rs1237361882 1115 dbSNP
rs1034531813 1123 dbSNP
rs1482485710 1131 dbSNP
rs79938523 1142 dbSNP
rs1253325887 1151 dbSNP
rs531193003 1159 dbSNP
rs898814822 1169 dbSNP
rs562373703 1171 dbSNP
rs1303739940 1181 dbSNP
rs1181770553 1182 dbSNP
rs34603583 1185 dbSNP
rs1415098145 1187 dbSNP
rs1425959105 1188 dbSNP
rs935686051 1189 dbSNP
rs1036097800 1190 dbSNP
rs1004599129 1191 dbSNP
rs980375387 1193 dbSNP
rs1368218063 1198 dbSNP
rs890186786 1200 dbSNP
rs1379748946 1201 dbSNP
rs1052035848 1217 dbSNP
rs1229825476 1219 dbSNP
rs571474515 1220 dbSNP
rs867635040 1223 dbSNP
rs757146459 1226 dbSNP
rs1286864199 1227 dbSNP
rs931799820 1237 dbSNP
rs921876419 1247 dbSNP
rs1205419919 1253 dbSNP
rs1053699819 1257 dbSNP
rs1379893306 1263 dbSNP
rs936011641 1263 dbSNP
rs1174564700 1264 dbSNP
rs1208769053 1276 dbSNP
rs542415842 1279 dbSNP
rs1393273692 1280 dbSNP
rs1187134631 1282 dbSNP
rs72948678 1291 dbSNP
rs967885501 1292 dbSNP
rs1264518683 1293 dbSNP
rs1393447308 1297 dbSNP
rs1414005540 1298 dbSNP
rs983646187 1304 dbSNP
rs950824109 1305 dbSNP
rs559385354 1312 dbSNP
rs1488194027 1321 dbSNP
rs1027780889 1322 dbSNP
rs758405192 1324 dbSNP
rs994791121 1331 dbSNP
rs1299406656 1336 dbSNP
rs1212656222 1343 dbSNP
rs17021297 1344 dbSNP
rs993415503 1346 dbSNP
rs958895341 1352 dbSNP
rs1207354842 1354 dbSNP
rs1227564010 1356 dbSNP
rs1247847293 1363 dbSNP
rs1328098781 1365 dbSNP
rs1465647354 1367 dbSNP
rs1190860339 1381 dbSNP
rs1034605250 1382 dbSNP
rs995035920 1384 dbSNP
rs1477788779 1394 dbSNP
rs963566585 1395 dbSNP
rs1399153244 1396 dbSNP
rs1470937914 1399 dbSNP
rs1156887620 1401 dbSNP
rs1375909346 1403 dbSNP
rs139119402 1404 dbSNP
rs556186899 1411 dbSNP
rs1435551354 1412 dbSNP
rs1010109366 1416 dbSNP
rs890210130 1420 dbSNP
rs1435307034 1423 dbSNP
rs1436753100 1428 dbSNP
rs1051512637 1429 dbSNP
rs72948674 1430 dbSNP
rs1268084562 1433 dbSNP
rs1462594534 1437 dbSNP
rs867102073 1440 dbSNP
rs1054234339 1441 dbSNP
rs1210981923 1443 dbSNP
rs574361664 1446 dbSNP
rs1265689985 1453 dbSNP
rs1053732694 1473 dbSNP
rs936585245 1474 dbSNP
rs1199810549 1479 dbSNP
rs1375259645 1481 dbSNP
rs1191737831 1492 dbSNP
rs1181466293 1495 dbSNP
rs1411167588 1496 dbSNP
rs935635552 1512 dbSNP
rs1160156100 1517 dbSNP
rs554457976 1521 dbSNP
rs923831205 1531 dbSNP
rs1323830344 1535 dbSNP
rs1044098032 1540 dbSNP
rs1041745554 1544 dbSNP
rs7435720 1546 dbSNP
rs917513358 1550 dbSNP
rs78407842 1552 dbSNP
rs1230769389 1555 dbSNP
rs1264091885 1568 dbSNP
rs375507711 1573 dbSNP
rs1195849991 1577 dbSNP
rs1210769923 1578 dbSNP
rs1292301900 1579 dbSNP
rs1340935589 1582 dbSNP
rs950948528 1584 dbSNP
rs1249542053 1585 dbSNP
rs553427084 1606 dbSNP
rs920668664 1609 dbSNP
rs1183878689 1610 dbSNP
rs1366598059 1613 dbSNP
rs1472359909 1613 dbSNP
rs1163554278 1627 dbSNP
rs1367060946 1635 dbSNP
rs766822636 1640 dbSNP
rs1356025357 1655 dbSNP
rs1306945403 1676 dbSNP
rs927477957 1683 dbSNP
rs539586776 1691 dbSNP
rs973516538 1696 dbSNP
rs977202593 1702 dbSNP
rs570936178 1715 dbSNP
rs1340325923 1716 dbSNP
rs1286310471 1719 dbSNP
rs973434674 1720 dbSNP
rs1275508941 1724 dbSNP
rs761317491 1733 dbSNP
rs963598023 1737 dbSNP
rs1015095850 1743 dbSNP
rs1017523162 1758 dbSNP
rs773574434 1762 dbSNP
rs550657505 1768 dbSNP
rs530952407 1774 dbSNP
rs1447325852 1779 dbSNP
rs1167544425 1785 dbSNP
rs1390349311 1793 dbSNP
rs1463074374 1803 dbSNP
rs954398864 1813 dbSNP
rs1030517989 1818 dbSNP
rs955468924 1833 dbSNP
rs1398809574 1834 dbSNP
rs1339155922 1835 dbSNP
rs1168627038 1836 dbSNP
rs1465521575 1838 dbSNP
rs995927416 1839 dbSNP
rs1298651901 1841 dbSNP
rs1231175484 1842 dbSNP
rs568738376 1846 dbSNP
rs1032196173 1847 dbSNP
rs150739781 1855 dbSNP
rs1244796970 1859 dbSNP
rs1236522801 1865 dbSNP
rs370993667 1866 dbSNP
rs902442005 1871 dbSNP
rs762300102 1872 dbSNP
rs1429916105 1881 dbSNP
rs905619357 1886 dbSNP
rs775218407 1888 dbSNP
rs1197482706 1899 dbSNP
rs1044046988 1911 dbSNP
rs1467050216 1916 dbSNP
rs1335350214 1925 dbSNP
rs1275017125 1926 dbSNP
rs1434829284 1927 dbSNP
rs1321567326 1930 dbSNP
rs949788767 1935 dbSNP
rs1355447783 1938 dbSNP
rs946079742 1940 dbSNP
rs1331731759 1942 dbSNP
rs895800119 1943 dbSNP
rs1264960461 1962 dbSNP
rs1443114413 1964 dbSNP
rs1207943974 1971 dbSNP
rs1261090768 1972 dbSNP
rs1486665952 1973 dbSNP
rs375243463 1985 dbSNP
rs768180493 1986 dbSNP
rs1433298850 1989 dbSNP
rs1200879146 2006 dbSNP
rs1446190056 2017 dbSNP
rs929564295 2020 dbSNP
rs1328588826 2034 dbSNP
rs937443283 2038 dbSNP
rs1160454879 2045 dbSNP
rs920732689 2061 dbSNP
rs1456626164 2062 dbSNP
rs973547684 2067 dbSNP
rs927338967 2072 dbSNP
rs1368523657 2073 dbSNP
rs1406849554 2087 dbSNP
rs943415137 2095 dbSNP
rs1348630351 2102 dbSNP
rs1227679490 2112 dbSNP
rs973547698 2122 dbSNP
rs545873911 2127 dbSNP
rs1470930294 2130 dbSNP
rs1219066408 2131 dbSNP
rs910676054 2134 dbSNP
rs376343764 2139 dbSNP
rs908172943 2142 dbSNP
rs983701935 2151 dbSNP
rs1029974775 2162 dbSNP
rs988722101 2163 dbSNP
rs113313118 2178 dbSNP
rs1183503313 2183 dbSNP
rs1177433617 2185 dbSNP
rs1422466853 2187 dbSNP
rs1164437585 2193 dbSNP
rs769386087 2200 dbSNP
rs1477774875 2209 dbSNP
rs1350745846 2216 dbSNP
rs1426783457 2216 dbSNP
rs955954782 2232 dbSNP
rs1032812465 2238 dbSNP
rs1468573430 2247 dbSNP
rs1254797466 2249 dbSNP
rs1000033531 2254 dbSNP
rs954556295 2255 dbSNP
rs1030013241 2260 dbSNP
rs748798432 2261 dbSNP
rs1211810421 2264 dbSNP
rs908083094 2268 dbSNP
rs1022757176 2290 dbSNP
rs1359788430 2295 dbSNP
rs1247673583 2308 dbSNP
rs184497454 2312 dbSNP
rs73855118 2324 dbSNP
rs1482454480 2329 dbSNP
rs1204557858 2332 dbSNP
rs73855117 2336 dbSNP
rs1047862116 2337 dbSNP
rs1482529114 2337 dbSNP
rs377508312 2355 dbSNP
rs1386218698 2360 dbSNP
rs574127383 2362 dbSNP
rs1446725943 2366 dbSNP
rs1166974735 2373 dbSNP
rs1307412709 2404 dbSNP
rs1389743381 2417 dbSNP
rs1032062874 2423 dbSNP
rs144909478 2427 dbSNP
rs530097422 2429 dbSNP
rs1330914861 2439 dbSNP
rs1356264370 2442 dbSNP
rs902347108 2443 dbSNP
rs1021315987 2446 dbSNP
rs1328012052 2465 dbSNP
rs1434868568 2475 dbSNP
rs899425643 2476 dbSNP
rs181431560 2479 dbSNP
rs1013515173 2488 dbSNP
rs1340938555 2492 dbSNP
rs1214658800 2494 dbSNP
rs1402847808 2507 dbSNP
rs1037829094 2511 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgucggucgagauGGGGGcggu 5'
                       |||||    
Target 5' -------------CCCCCaacu 3'
 		1 - 9
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 84068.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgucggucgagauGGGGGcggu 5'
                       |||||    
Target 5' -------------CCCCCaacu 3'
 		1 - 9
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000264986.3 | 3UTR | CCCCCAACUUAUCUACCUCUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000264986.3 | 3UTR | CCCCCAACUUAUCUACCUCUAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000264986.3 | 3UTR | CCCCCAACUUAUCUACCUCUAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
90 hsa-miR-6787-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT449091 XPO6 exportin 6 2 2
MIRT449991 PSMG1 proteasome assembly chaperone 1 2 2
MIRT454608 MYADM myeloid associated differentiation marker 2 2
MIRT456116 VAV3 vav guanine nucleotide exchange factor 3 2 6
MIRT457064 TOR4A torsin family 4 member A 2 2
MIRT461023 SDF4 stromal cell derived factor 4 2 2
MIRT467197 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT471711 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT472566 NACC1 nucleus accumbens associated 1 2 2
MIRT476079 GRB2 growth factor receptor bound protein 2 2 2
MIRT480150 CALR calreticulin 2 2
MIRT483027 KHSRP KH-type splicing regulatory protein 2 4
MIRT483498 STMN3 stathmin 3 2 4
MIRT483728 THSD4 thrombospondin type 1 domain containing 4 2 2
MIRT484550 BARHL1 BarH like homeobox 1 2 6
MIRT484684 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT486059 CTDNEP1 CTD nuclear envelope phosphatase 1 2 2
MIRT486116 INO80E INO80 complex subunit E 2 2
MIRT486313 SIPA1 signal-induced proliferation-associated 1 2 2
MIRT486525 CLCN7 chloride voltage-gated channel 7 2 2
MIRT486857 DPF1 double PHD fingers 1 2 2
MIRT487352 PHF15 jade family PHD finger 2 1 1
MIRT487582 FAM83H family with sequence similarity 83 member H 2 4
MIRT487792 GPR20 G protein-coupled receptor 20 2 4
MIRT488104 POU3F1 POU class 3 homeobox 1 2 2
MIRT488786 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT489361 SYNGR1 synaptogyrin 1 2 4
MIRT489387 RAB11B RAB11B, member RAS oncogene family 2 2
MIRT489680 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT489731 GNAI2 G protein subunit alpha i2 2 4
MIRT489750 TACC3 transforming acidic coiled-coil containing protein 3 2 2
MIRT490029 PCSK4 proprotein convertase subtilisin/kexin type 4 2 2
MIRT490379 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT490580 SLC47A1 solute carrier family 47 member 1 2 2
MIRT490753 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT491187 JUND JunD proto-oncogene, AP-1 transcription factor subunit 2 4
MIRT491301 VGF VGF nerve growth factor inducible 2 2
MIRT491462 HOXB8 homeobox B8 2 2
MIRT491702 PDZD4 PDZ domain containing 4 2 2
MIRT491724 RTN4R reticulon 4 receptor 2 2
MIRT491737 SEMA3F semaphorin 3F 2 2
MIRT491984 UNK unkempt family zinc finger 2 2
MIRT492844 NRGN neurogranin 2 2
MIRT492936 NEUROD2 neuronal differentiation 2 2 4
MIRT493713 H2AFX H2A histone family member X 2 2
MIRT494623 ASB6 ankyrin repeat and SOCS box containing 6 2 4
MIRT494703 ARHGAP31 Rho GTPase activating protein 31 2 2
MIRT495602 NKX2-5 NK2 homeobox 5 2 2
MIRT495750 PDE4C phosphodiesterase 4C 2 4
MIRT500367 ZNF385A zinc finger protein 385A 2 2
MIRT501161 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501702 PCGF3 polycomb group ring finger 3 2 6
MIRT504922 PDRG1 p53 and DNA damage regulated 1 2 2
MIRT517945 TRIM59 tripartite motif containing 59 2 2
MIRT524212 DDI2 DNA damage inducible 1 homolog 2 2 6
MIRT531186 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT531972 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT558055 EVI5L ecotropic viral integration site 5 like 2 2
MIRT560482 LACE1 AFG1 like ATPase 2 2
MIRT563217 FXN frataxin 2 2
MIRT569095 FSCN1 fascin actin-bundling protein 1 2 2
MIRT569522 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 2
MIRT569531 CTTN cortactin 2 2
MIRT569848 RGS5 regulator of G protein signaling 5 2 2
MIRT570738 ANKRD52 ankyrin repeat domain 52 2 2
MIRT574140 MARVELD1 MARVEL domain containing 1 2 2
MIRT615994 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT628493 ZNF556 zinc finger protein 556 2 2
MIRT633451 KLLN killin, p53-regulated DNA replication inhibitor 2 2
MIRT649054 SLC1A2 solute carrier family 1 member 2 2 2
MIRT649340 HEXA hexosaminidase subunit alpha 2 2
MIRT670226 PTCHD1 patched domain containing 1 2 2
MIRT670666 KIAA1551 KIAA1551 2 2
MIRT671452 CDH7 cadherin 7 2 2
MIRT671729 ZNF451 zinc finger protein 451 2 2
MIRT690285 ZNF154 zinc finger protein 154 2 2
MIRT700575 PRSS22 protease, serine 22 2 2
MIRT701411 NKRF NFKB repressing factor 2 2
MIRT711877 VASP vasodilator stimulated phosphoprotein 2 2
MIRT712082 UNC13A unc-13 homolog A 2 2
MIRT712523 CYTH2 cytohesin 2 2 2
MIRT712751 GMDS GDP-mannose 4,6-dehydratase 2 2
MIRT714681 PRX periaxin 2 2
MIRT714718 VPS8 VPS8, CORVET complex subunit 2 2
MIRT717508 HRNR hornerin 2 2
MIRT717650 THBS2 thrombospondin 2 2 2
MIRT719592 PIAS4 protein inhibitor of activated STAT 4 2 2
MIRT720521 PTGR2 prostaglandin reductase 2 2 2
MIRT721295 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT724922 VPS18 VPS18, CORVET/HOPS core subunit 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6787 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-6787-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-6787-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-6787-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-6787-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-6787-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-6787-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-6787-5p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-6787-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-6787-5p Docetaxel+Cisplatin+5-Fluorouracil resistant tissue (hypopharyngeal squamous cell carcinoma)

Error report submission