miRTarBase - #MIRT501197


—
pre-miRNA Information
pre-miRNA hsa-mir-4677   
Genomic Coordinates chr1: 243346176 - 243346255
Description Homo sapiens miR-4677 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4677-3p
Sequence 50| UCUGUGAGACCAAAGAACUACU |71
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1481229343 11 dbSNP
rs771267188 18 dbSNP
rs1254655423 20 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SUMO1   
Synonyms DAP1, GMP1, OFC10, PIC1, SENP2, SMT3, SMT3C, SMT3H3, UBL1
Description small ubiquitin-like modifier 1
Transcript NM_001005782   
Other Transcripts NM_001005781 , NM_003352   
Expression
Putative miRNA Targets on SUMO1
3'UTR of SUMO1
(miRNA target sites are highlighted)		 
>SUMO1|NM_001005782|3'UTR
   1 ATATTCTTTTTATTTTTTTTCTTTTCCCTCAATCCTTTTTTATTTTTAAAAATAGTTCTTTTGTAATGTGGTGTTCAAAA
  81 CGGAATTGAAAACTGGCACCCCATCTCTTTGAAACATCTGGTAATTTGAATTCTAGTGCTCATTATTCATTATTGTTTGT
 161 TTTCATTGTGCTGATTTTTGGTGATCAAGCCTCAGTCCCCTTCATATTACCCTCTCCTTTTTAAAAATTACGTGTGCACA
 241 GAGAGGTCACCTTTTTCAGGACATTGCATTTTCAGGCTTGTGGTGATAAATAAGATCGACCAATGCAAGTGTTCATAATG
 321 ACTTTCCAATTGGCCCTGATGTTCTAGCATGTGATTACTTCACTCCTGGACTGTGACTTTCAGTGGGAGATGGAAGTTTT
 401 TCAGAGAACTGAACTGTGGAAAAATGACCTTTCCTTAACTTGAAGCTACTTTTAAAATTTGAGGGTCTGGACCAAAAGAA
 481 GAGGAATATCAGGTTGAAGTCAAGATGACAGATAAGGTGAGAGTAATGACTAACTCCAAAGATGGCTTCACTGAAGAAAA
 561 GGCATTTTAAGATTTTTTAAAAATCTTGTCAGAAGATCCCAGAAAAGTTCTAATTTTCATTAGCAATTAATAAAGCTATA
 641 CATGCAGAAATGAATACAACAGAACACTGCTCTTTTTGATTTTATTTGTACTTTTTGGCCTGGGATATGGGTTTTAAATG
 721 GACATTGTCTGTACCAGCTTCATTAAAATAAACAATATTTGTAAAAATCATACTAATGCTTATTTTATTTTAATTGTATA
 801 GAAAGAAAAAAATGCCTAAAATAAGGTTTTCTTGCATAAATACTGGAAATTGCACATGGTACAAATTTTTTCTTCATTAC
 881 TGTACAGTGATGATGTTAATGACTTTGAAGCACTGAAAGTTACTGAAGTGCCTTCTGAATCAAGGATTTAATTAAGGCCA
 961 CAATACCTTTTTAATACTCAGTGTTCTGTTTTTTTAAAAACTTGATATTCCTGTATGGTGCATATATGATACAGTTACCT
1041 AATCATGTTGAATAAATGGGCATGCCAAAAATT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucAUCAAGAAACCAGAGUGUCu 5'
            || || |||| |:|||: | 
Target 5' atTA-TTGTTTGTTTTCATTGt 3'
 149 - 169 107.00 -6.40
2 
miRNA  3' ucaucAAGAAACCA-GA-GUGUCu 5'
               |||||   | || :|||| 
Target 5' attttTTCTTCATTACTGTACAGt 3'
 865 - 888 105.00 -5.74
3 
miRNA  3' ucaucaagaaACCAGAGUGUCu 5'
                    ||| :|||| | 
Target 5' actccaaagaTGGCTTCACTGa 3'
 533 - 554 104.00 -10.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
333613 475 ClinVar
333612 545 ClinVar
333611 724 ClinVar
895353 753 ClinVar
895352 776 ClinVar
895351 814 ClinVar
333610 884 ClinVar
333609 944 ClinVar
898330 1038 ClinVar
COSN31492697 19 COSMIC
COSN13963965 21 COSMIC
COSN30157018 21 COSMIC
COSN31586812 32 COSMIC
COSN30156998 34 COSMIC
COSN31496610 46 COSMIC
COSN30492430 47 COSMIC
COSN24299284 57 COSMIC
COSN26997461 58 COSMIC
COSN30184979 68 COSMIC
COSN30148999 76 COSMIC
COSN26997457 82 COSMIC
COSN30474899 100 COSMIC
COSN31610298 291 COSMIC
COSN31529156 406 COSMIC
COSN30040479 427 COSMIC
COSN18793733 588 COSMIC
COSN17131955 631 COSMIC
COSN15660412 721 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs775681074 3 dbSNP
rs1163997856 4 dbSNP
rs770432722 6 dbSNP
rs752984189 8 dbSNP
rs1270845780 13 dbSNP
rs1366583892 16 dbSNP
rs760066247 19 dbSNP
rs777261065 20 dbSNP
rs915971988 21 dbSNP
rs1388244381 22 dbSNP
rs771198991 27 dbSNP
rs747026305 28 dbSNP
rs1056292132 41 dbSNP
rs1322724073 43 dbSNP
rs1297261106 47 dbSNP
rs778103751 48 dbSNP
rs1211520779 49 dbSNP
rs1451937257 55 dbSNP
rs1311238836 63 dbSNP
rs941526430 74 dbSNP
rs1246042320 76 dbSNP
rs1192097228 79 dbSNP
rs910094705 82 dbSNP
rs572535139 84 dbSNP
rs1273703658 85 dbSNP
rs964487195 91 dbSNP
rs1206431723 93 dbSNP
rs1269551812 95 dbSNP
rs1186668776 99 dbSNP
rs1180722234 103 dbSNP
rs951661514 119 dbSNP
rs534230755 121 dbSNP
rs1188069332 127 dbSNP
rs1410948115 137 dbSNP
rs1455386351 139 dbSNP
rs922857978 141 dbSNP
rs566873208 142 dbSNP
rs866479633 148 dbSNP
rs975751372 163 dbSNP
rs548561063 166 dbSNP
rs966102169 168 dbSNP
rs1348109611 171 dbSNP
rs1397105339 175 dbSNP
rs958418130 189 dbSNP
rs1288186565 197 dbSNP
rs1017406384 205 dbSNP
rs1000622330 210 dbSNP
rs1230557002 215 dbSNP
rs1289855941 217 dbSNP
rs1282232508 223 dbSNP
rs1329372958 224 dbSNP
rs529216647 231 dbSNP
rs1021147493 232 dbSNP
rs1017319375 241 dbSNP
rs568234416 242 dbSNP
rs1250914207 246 dbSNP
rs1471502347 257 dbSNP
rs1009797907 272 dbSNP
rs1007350221 273 dbSNP
rs957188959 277 dbSNP
rs145284427 282 dbSNP
rs998757452 285 dbSNP
rs1359971318 286 dbSNP
rs1288293017 294 dbSNP
rs1369193295 297 dbSNP
rs903070328 298 dbSNP
rs1308984081 306 dbSNP
rs1373668386 310 dbSNP
rs1218275345 317 dbSNP
rs1046077492 319 dbSNP
rs11545248 326 dbSNP
rs183187867 329 dbSNP
rs11545249 335 dbSNP
rs905204482 336 dbSNP
rs941474399 337 dbSNP
rs1804594 348 dbSNP
rs1252263609 363 dbSNP
rs1488314827 370 dbSNP
rs910040720 371 dbSNP
rs1038383862 387 dbSNP
rs564254971 394 dbSNP
rs941461237 397 dbSNP
rs1433862720 404 dbSNP
rs1167993806 420 dbSNP
rs149269552 424 dbSNP
rs1047576045 426 dbSNP
rs780743647 427 dbSNP
rs1349670078 437 dbSNP
rs1050860 454 dbSNP
rs1434695684 454 dbSNP
rs929225046 464 dbSNP
rs1369238761 468 dbSNP
rs754482827 475 dbSNP
rs1296204114 484 dbSNP
rs922840948 489 dbSNP
rs977416624 490 dbSNP
rs975772658 494 dbSNP
rs964693321 497 dbSNP
rs944378706 499 dbSNP
rs1259098073 501 dbSNP
rs1185384098 531 dbSNP
rs1485821347 532 dbSNP
rs1259137847 539 dbSNP
rs1488911295 540 dbSNP
rs747664973 545 dbSNP
rs979148070 551 dbSNP
rs1485212363 553 dbSNP
rs1251616179 557 dbSNP
rs1229523934 562 dbSNP
rs985859634 573 dbSNP
rs1169799410 574 dbSNP
rs1032773196 578 dbSNP
rs1167311993 579 dbSNP
rs1351311401 579 dbSNP
rs967808992 579 dbSNP
rs527345489 583 dbSNP
rs1436569375 587 dbSNP
rs1270716925 607 dbSNP
rs1378295047 610 dbSNP
rs1226436111 614 dbSNP
rs977227739 630 dbSNP
rs1335800780 633 dbSNP
rs1021116549 641 dbSNP
rs967617204 657 dbSNP
rs1466327765 659 dbSNP
rs1193944541 665 dbSNP
rs1237455346 676 dbSNP
rs1433733355 678 dbSNP
rs1311277906 680 dbSNP
rs1472085151 682 dbSNP
rs1184024868 687 dbSNP
rs1414977423 697 dbSNP
rs1472428302 712 dbSNP
rs1157974721 718 dbSNP
rs867404338 720 dbSNP
rs886055457 724 dbSNP
rs1458384956 726 dbSNP
rs1414336228 733 dbSNP
rs1358554118 737 dbSNP
rs1035640561 753 dbSNP
rs559734031 757 dbSNP
rs1300225740 767 dbSNP
rs1002466992 770 dbSNP
rs72923015 776 dbSNP
rs1372988721 786 dbSNP
rs1038351086 787 dbSNP
rs1169384975 793 dbSNP
rs1227504826 794 dbSNP
rs1475245127 807 dbSNP
rs377075241 808 dbSNP
rs1419644685 809 dbSNP
rs1185358137 813 dbSNP
rs1370102740 813 dbSNP
rs894459902 813 dbSNP
rs753364030 814 dbSNP
rs1005572567 815 dbSNP
rs887219619 827 dbSNP
rs1251010928 837 dbSNP
rs1258754826 843 dbSNP
rs1472479659 850 dbSNP
rs766211759 856 dbSNP
rs1479641364 863 dbSNP
rs1250689945 864 dbSNP
rs1158701434 865 dbSNP
rs1423850188 866 dbSNP
rs929171995 875 dbSNP
rs1336117266 876 dbSNP
rs1375949772 879 dbSNP
rs555380378 884 dbSNP
rs1305932711 886 dbSNP
rs1040663268 887 dbSNP
rs1352625966 890 dbSNP
rs1240027146 895 dbSNP
rs888507325 896 dbSNP
rs373040487 906 dbSNP
rs943315607 916 dbSNP
rs1047139249 938 dbSNP
rs537401465 944 dbSNP
rs979116877 956 dbSNP
rs12991014 960 dbSNP
rs967778084 963 dbSNP
rs913688448 972 dbSNP
rs1336531532 973 dbSNP
rs760340269 977 dbSNP
rs1203510159 979 dbSNP
rs901370347 986 dbSNP
rs561161012 995 dbSNP
rs1439262150 996 dbSNP
rs1182086716 1013 dbSNP
rs1041296887 1016 dbSNP
rs1476774106 1020 dbSNP
rs987910782 1022 dbSNP
rs1395670886 1027 dbSNP
rs1429014543 1034 dbSNP
rs1166559333 1037 dbSNP
rs754651477 1038 dbSNP
rs753262687 1044 dbSNP
rs1391703944 1046 dbSNP
rs961124453 1048 dbSNP
rs1323161140 1064 dbSNP
rs199601666 1066 dbSNP
rs1035207757 1068 dbSNP
rs773233092 1078 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000296257.5 | 3UTR | ACAUUUCCAUAUACCUCAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
61 hsa-miR-4677-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT277530 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT296646 RPS21 ribosomal protein S21 2 4
MIRT306961 THRB thyroid hormone receptor beta 2 2
MIRT439091 MYC MYC proto-oncogene, bHLH transcription factor 0 1
MIRT443953 LRIT3 leucine rich repeat, Ig-like and transmembrane domains 3 2 2
MIRT445487 KLF12 Kruppel like factor 12 2 2
MIRT446637 SDC3 syndecan 3 2 2
MIRT448594 PCP4L1 Purkinje cell protein 4 like 1 2 2
MIRT449822 FNBP1 formin binding protein 1 2 2
MIRT450422 BCL2L14 BCL2 like 14 2 2
MIRT454907 SEPT8 septin 8 2 17
MIRT466442 TFAM transcription factor A, mitochondrial 2 6
MIRT474198 LEPRE1 prolyl 3-hydroxylase 1 1 1
MIRT474486 KLHDC8B kelch domain containing 8B 2 2
MIRT474900 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT477670 EFHD2 EF-hand domain family member D2 2 2
MIRT483912 GNB1L G protein subunit beta 1 like 2 2
MIRT484163 FAM71B family with sequence similarity 71 member B 2 2
MIRT487565 LOXL2 lysyl oxidase like 2 2 2
MIRT489678 CYP1A1 cytochrome P450 family 1 subfamily A member 1 2 2
MIRT491482 APC2 APC2, WNT signaling pathway regulator 2 6
MIRT492745 PER1 period circadian clock 1 2 10
MIRT499212 CHRDL1 chordin like 1 2 4
MIRT501197 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT522622 MAP7D1 MAP7 domain containing 1 2 4
MIRT523971 DVL3 dishevelled segment polarity protein 3 2 2
MIRT541017 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT554741 RHOC ras homolog family member C 2 2
MIRT558910 CBX5 chromobox 5 2 2
MIRT561466 TCEB3 elongin A 2 2
MIRT564039 BIRC5 baculoviral IAP repeat containing 5 2 2
MIRT564508 DUSP3 dual specificity phosphatase 3 2 2
MIRT566854 LRRC58 leucine rich repeat containing 58 2 2
MIRT574110 SPINT2 serine peptidase inhibitor, Kunitz type 2 2 2
MIRT611056 DAB2 DAB2, clathrin adaptor protein 2 2
MIRT615578 NCS1 neuronal calcium sensor 1 2 2
MIRT615742 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT626785 IL18RAP interleukin 18 receptor accessory protein 2 2
MIRT627338 TTLL7 tubulin tyrosine ligase like 7 2 2
MIRT629039 KLLN killin, p53-regulated DNA replication inhibitor 2 2
MIRT637643 RASGRP1 RAS guanyl releasing protein 1 2 2
MIRT641769 ZNF207 zinc finger protein 207 2 2
MIRT645719 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT652155 TRIM71 tripartite motif containing 71 2 2
MIRT659216 CXXC5 CXXC finger protein 5 2 2
MIRT661995 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT662711 C10orf111 chromosome 10 open reading frame 111 2 4
MIRT663216 ZNF277 zinc finger protein 277 2 2
MIRT668715 DIP2C disco interacting protein 2 homolog C 2 2
MIRT675132 FSD2 fibronectin type III and SPRY domain containing 2 2 2
MIRT686180 ZNHIT6 zinc finger HIT-type containing 6 2 2
MIRT695993 SNX19 sorting nexin 19 2 2
MIRT702346 KLHL7 kelch like family member 7 2 2
MIRT702702 IPO9 importin 9 2 2
MIRT708232 PPP1R26 protein phosphatase 1 regulatory subunit 26 2 2
MIRT713311 SNRNP25 small nuclear ribonucleoprotein U11/U12 subunit 25 2 2
MIRT713528 PAFAH2 platelet activating factor acetylhydrolase 2 2 2
MIRT714651 FSTL1 follistatin like 1 2 2
MIRT715549 FPGS folylpolyglutamate synthase 2 2
MIRT724289 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 2
MIRT724433 TFCP2L1 transcription factor CP2 like 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4677 Doxorubicin 31703 NSC123127 approved resistant High Triple-Negative Breast Cancer cell line (MDA-MB-231, MDA-MB-468)
hsa-mir-4677 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-4677 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-4677-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-4677-3p Etoposide 36462 NSC141540 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-4677-3p Doxorubicin 31703 NSC123127 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-4677-3p Vinorelbine 44424639 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-4677-3p Vincristine 5978 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-4677-3p Paclitaxel 36314 NSC125973 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-4677-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4677-3p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil resistant tissue (myasthenia gravis)
hsa-miR-4677-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4677-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-4677-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission