miRTarBase - #MIRT501367


—
pre-miRNA Information
pre-miRNA hsa-mir-4707   
Genomic Coordinates chr14: 22956950 - 22957029
Description Homo sapiens miR-4707 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4707-3p
Sequence 52| AGCCCGCCCCAGCCGAGGUUCU |73
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1180125593 2 dbSNP
rs1390998288 5 dbSNP
rs2273626 6 dbSNP
rs765507627 7 dbSNP
rs1299611135 9 dbSNP
rs1158707105 11 dbSNP
rs535691977 15 dbSNP
rs952013388 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol REXO1   
Synonyms ELOABP1, EloA-BP1, REX1, TCEB3BP1
Description RNA exonuclease 1 homolog
Transcript NM_020695   
Expression
Putative miRNA Targets on REXO1
3'UTR of REXO1
(miRNA target sites are highlighted)		 
>REXO1|NM_020695|3'UTR
   1 CGCCTGCCCGCCTCCCACCCGCCTCTCCTGCCGTCCCGCTGGTCCTTAGCCCCATGCCTCTTCCAAAACAGTGCAATAAA
  81 TCTCCGGTAACCCGTCCACCTGGCCGAGGCAGCCCAGAGCAGCGGGATGAGCTGGCGGCCAGAGAACGCCCAGCCCAGCC
 161 CACCCCCGCTCACGTCCTGCCGCACCCCTCCGCCGGTCCCCACCCTCTGCCCCCCAGCCCTCTGGCGTCTCTAGAAACTG
 241 CTGCTGATGGAGACCAGGACAGAGCCCGCCCCCACCCGGCCCGCAGCCCCTCCTGCCCCTCCTGCCAGGCCCTCCCTCCC
 321 GGGTGGTGGCCGGCACCTCTGCTCCTCACGTGGGTCGCGGGGCGGGCTTGTCCCAGGTTTGTTTGAGACAGTCTTTTTTT
 401 ATTTTGTATTGTTATTTTTATTATTTTTAATTTAAACCTGATGACTTGCACAGCATCTTTCCCACCGGGAAGAGCGGGCC
 481 TGCTGCCTTCCCTCCTGCGGGGTGGGGGTGGGACAGACCCCAGTGGGGGCCAGGGCCACACTCAGCGCAGTGTGGGCTGG
 561 ACCCGCCTCTGTGCTCCAGGGGCTGGCCGGTCTTCGGGGGCGCCGGCTTCCACCACTCGCCGCCCCACCCCTGCACTCCG
 641 TGACCTCTGAGAACCCAGCTGGCCCCTCGTTAGCCCCAGGGTCTGCCGTCTAGAGGGAGCCCACCGGCCTCCGGACACTG
 721 TCTTCCCGCTAGAGCCCCGTCCTCCTCTGCGGGGCTCTCCGGACCCCCTTCCCCCTCACCTCCAGGCAGGGACAGAATAA
 801 ATGTTTGTATGGATTTTAGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucuUGGAGCCG--ACCCCGCCCGa 5'
             || | ||:   ||||||||| 
Target 5' ctcACGTGGGTCGCGGGGCGGGCt 3'
 345 - 368 157.00 -27.00
2 
miRNA  3' ucuuGGA--GCCGACC-CCGCCCGa 5'
              |||  ||| ||| ||| ||| 
Target 5' cctcCCTCCCGGGTGGTGGCCGGCa 3'
 311 - 335 132.00 -22.40
3 
miRNA  3' ucuUGGAG-C-CGA---CCCCGCCCGa 5'
             :|||| | |||   ||||| ||| 
Target 5' cccGCCTCTGTGCTCCAGGGGCTGGCc 3'
 562 - 588 131.00 -22.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26860138 162 COSMIC
COSN24314775 190 COSMIC
COSN26860187 210 COSMIC
COSN26858218 318 COSMIC
COSN26857502 342 COSMIC
COSN23564213 357 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs199597990 1 dbSNP
rs138676883 2 dbSNP
rs928020021 3 dbSNP
rs567134814 9 dbSNP
rs779083064 10 dbSNP
rs757078721 13 dbSNP
rs1239631465 14 dbSNP
rs1310325322 17 dbSNP
rs777700881 17 dbSNP
rs756040782 19 dbSNP
rs548857767 20 dbSNP
rs767329272 21 dbSNP
rs759256753 23 dbSNP
rs1287093216 26 dbSNP
rs1483826898 26 dbSNP
rs1313282607 28 dbSNP
rs1044243564 32 dbSNP
rs376233777 33 dbSNP
rs1353368306 35 dbSNP
rs370241664 36 dbSNP
rs530762247 37 dbSNP
rs777184637 38 dbSNP
rs1335470341 39 dbSNP
rs1174673236 40 dbSNP
rs1448200800 41 dbSNP
rs1360391025 43 dbSNP
rs1377699483 46 dbSNP
rs1156767845 48 dbSNP
rs35839199 50 dbSNP
rs768977406 51 dbSNP
rs1166107530 54 dbSNP
rs1380635031 54 dbSNP
rs1160277676 55 dbSNP
rs1350891984 56 dbSNP
rs376062181 57 dbSNP
rs1241593172 60 dbSNP
rs1452906734 67 dbSNP
rs1181346684 75 dbSNP
rs1483581443 76 dbSNP
rs1239302009 78 dbSNP
rs775853851 79 dbSNP
rs1353659994 82 dbSNP
rs1287157680 85 dbSNP
rs1242836179 86 dbSNP
rs772142680 93 dbSNP
rs150006723 94 dbSNP
rs1228544764 95 dbSNP
rs1236044985 97 dbSNP
rs924421865 104 dbSNP
rs111599606 105 dbSNP
rs778802321 106 dbSNP
rs1361143021 111 dbSNP
rs964999443 112 dbSNP
rs1299793247 113 dbSNP
rs771100735 114 dbSNP
rs966349698 116 dbSNP
rs1164276647 117 dbSNP
rs1466808208 118 dbSNP
rs1424640495 119 dbSNP
rs1416004314 123 dbSNP
rs749233043 124 dbSNP
rs1465934193 126 dbSNP
rs777901185 129 dbSNP
rs532961645 134 dbSNP
rs1219246781 136 dbSNP
rs1489944422 137 dbSNP
rs1245949425 142 dbSNP
rs752494930 144 dbSNP
rs1007237204 145 dbSNP
rs952994837 147 dbSNP
rs1292792561 148 dbSNP
rs1368359393 152 dbSNP
rs781075058 154 dbSNP
rs559157752 155 dbSNP
rs1219783924 157 dbSNP
rs1279941917 159 dbSNP
rs754526370 161 dbSNP
rs1039723878 162 dbSNP
rs1342002790 163 dbSNP
rs541125625 163 dbSNP
rs994975597 165 dbSNP
rs1293927083 166 dbSNP
rs186656374 167 dbSNP
rs1351889450 168 dbSNP
rs1368712678 173 dbSNP
rs562307085 173 dbSNP
rs1036929242 174 dbSNP
rs141666246 176 dbSNP
rs1424438419 177 dbSNP
rs757961818 180 dbSNP
rs540671714 181 dbSNP
rs1267068181 182 dbSNP
rs576157335 185 dbSNP
rs1045267916 186 dbSNP
rs1489249959 187 dbSNP
rs1360011310 189 dbSNP
rs1308054202 191 dbSNP
rs948070530 192 dbSNP
rs1428517453 193 dbSNP
rs761199594 194 dbSNP
rs1317924883 195 dbSNP
rs1323087225 196 dbSNP
rs775767836 203 dbSNP
rs1221572379 204 dbSNP
rs1284625728 206 dbSNP
rs915229920 206 dbSNP
rs1368235021 210 dbSNP
rs1301694336 212 dbSNP
rs767939549 214 dbSNP
rs1369999301 215 dbSNP
rs1424149421 216 dbSNP
rs1329482780 219 dbSNP
rs1465318043 224 dbSNP
rs759665779 226 dbSNP
rs1172953313 227 dbSNP
rs1464961045 229 dbSNP
rs1377614169 238 dbSNP
rs558116732 240 dbSNP
rs1435206226 245 dbSNP
rs569769927 247 dbSNP
rs1157102094 254 dbSNP
rs1379740912 256 dbSNP
rs896799177 258 dbSNP
rs1249733328 261 dbSNP
rs1457960216 265 dbSNP
rs770889413 267 dbSNP
rs1201284490 271 dbSNP
rs1005845620 273 dbSNP
rs1256590821 274 dbSNP
rs1235335722 275 dbSNP
rs867663560 277 dbSNP
rs749431707 278 dbSNP
rs1446283460 279 dbSNP
rs1044617195 280 dbSNP
rs769816638 282 dbSNP
rs545843452 283 dbSNP
rs986031770 287 dbSNP
rs1173611013 288 dbSNP
rs953046068 292 dbSNP
rs1378813622 297 dbSNP
rs1158463783 299 dbSNP
rs1408879573 302 dbSNP
rs1439899454 303 dbSNP
rs1176965789 305 dbSNP
rs1027318857 307 dbSNP
rs112410147 307 dbSNP
rs752456754 307 dbSNP
rs1381843733 310 dbSNP
rs759142564 311 dbSNP
rs895891161 313 dbSNP
rs962109368 313 dbSNP
rs1256265540 314 dbSNP
rs1177487907 315 dbSNP
rs1361230198 318 dbSNP
rs1202066490 319 dbSNP
rs572426046 320 dbSNP
rs934758687 321 dbSNP
rs1377113312 322 dbSNP
rs925922127 331 dbSNP
rs553928577 332 dbSNP
rs1311650618 333 dbSNP
rs1219719819 334 dbSNP
rs1242900893 337 dbSNP
rs943617002 344 dbSNP
rs910840907 347 dbSNP
rs557176037 349 dbSNP
rs567122458 350 dbSNP
rs1297960989 352 dbSNP
rs1420767712 353 dbSNP
rs1458332287 355 dbSNP
rs201158917 355 dbSNP
rs1026500507 356 dbSNP
rs972446208 357 dbSNP
rs961122942 358 dbSNP
rs935314420 359 dbSNP
rs1464528671 361 dbSNP
rs1170325064 362 dbSNP
rs1476791410 363 dbSNP
rs555171712 364 dbSNP
rs1041114278 367 dbSNP
rs536932641 372 dbSNP
rs1329974082 373 dbSNP
rs1436659175 378 dbSNP
rs746607249 380 dbSNP
rs911707987 381 dbSNP
rs986084143 386 dbSNP
rs931876243 389 dbSNP
rs1289350570 392 dbSNP
rs1208247239 394 dbSNP
rs1288070900 401 dbSNP
rs1355961004 401 dbSNP
rs569819554 404 dbSNP
rs1284832752 405 dbSNP
rs920475987 406 dbSNP
rs1339084822 422 dbSNP
rs1278054410 430 dbSNP
rs1477103194 430 dbSNP
rs905767197 437 dbSNP
rs551678232 442 dbSNP
rs1479032420 443 dbSNP
rs1022908835 457 dbSNP
rs961711452 460 dbSNP
rs1405611960 461 dbSNP
rs1014485323 466 dbSNP
rs1171807299 467 dbSNP
rs532747686 469 dbSNP
rs1278811059 473 dbSNP
rs1342136066 475 dbSNP
rs776046948 476 dbSNP
rs970894062 482 dbSNP
rs1379148066 484 dbSNP
rs1052892708 492 dbSNP
rs1210690983 494 dbSNP
rs934707645 498 dbSNP
rs1472190315 499 dbSNP
rs904656177 501 dbSNP
rs772557460 504 dbSNP
rs1449086428 505 dbSNP
rs1185798354 508 dbSNP
rs1484497042 510 dbSNP
rs1472899940 512 dbSNP
rs1255100723 513 dbSNP
rs1418634439 514 dbSNP
rs1200647078 516 dbSNP
rs1347665911 519 dbSNP
rs943413882 521 dbSNP
rs1259324798 523 dbSNP
rs1238980731 525 dbSNP
rs1333212677 528 dbSNP
rs1340865856 533 dbSNP
rs1245760873 535 dbSNP
rs769309671 535 dbSNP
rs1351598976 537 dbSNP
rs1239591902 544 dbSNP
rs1286847809 545 dbSNP
rs565681006 546 dbSNP
rs910778140 547 dbSNP
rs1255849080 549 dbSNP
rs371676859 552 dbSNP
rs887984166 553 dbSNP
rs987719271 557 dbSNP
rs1047896791 561 dbSNP
rs1231479001 562 dbSNP
rs919388402 564 dbSNP
rs1438706874 565 dbSNP
rs1335181555 566 dbSNP
rs1158650804 574 dbSNP
rs1397990871 575 dbSNP
rs1404101976 576 dbSNP
rs1485806236 578 dbSNP
rs1286833911 582 dbSNP
rs972227284 587 dbSNP
rs961113047 588 dbSNP
rs115470451 589 dbSNP
rs984179127 591 dbSNP
rs969772784 592 dbSNP
rs1023071840 595 dbSNP
rs1014092566 596 dbSNP
rs1337634835 600 dbSNP
rs959951222 601 dbSNP
rs1255993722 602 dbSNP
rs1473960895 604 dbSNP
rs1031462452 605 dbSNP
rs1187892430 611 dbSNP
rs1443733061 618 dbSNP
rs529043399 619 dbSNP
rs76386559 621 dbSNP
rs904602019 622 dbSNP
rs376731821 625 dbSNP
rs1378195948 627 dbSNP
rs746067771 634 dbSNP
rs1168192619 636 dbSNP
rs779124789 639 dbSNP
rs1052209106 640 dbSNP
rs1385219734 644 dbSNP
rs1300692584 645 dbSNP
rs1355801987 649 dbSNP
rs970444045 652 dbSNP
rs1023308808 653 dbSNP
rs1276642922 654 dbSNP
rs990952741 659 dbSNP
rs1198846803 661 dbSNP
rs958177822 662 dbSNP
rs933522497 663 dbSNP
rs531956733 665 dbSNP
rs770935859 668 dbSNP
rs919550189 669 dbSNP
rs564594395 681 dbSNP
rs1191447714 684 dbSNP
rs1434153051 687 dbSNP
rs746701179 688 dbSNP
rs1008195751 690 dbSNP
rs909605797 691 dbSNP
rs1356438846 695 dbSNP
rs546477793 700 dbSNP
rs1456585423 703 dbSNP
rs572341825 705 dbSNP
rs915539804 706 dbSNP
rs1407269983 708 dbSNP
rs1296926388 709 dbSNP
rs573361883 712 dbSNP
rs541900016 713 dbSNP
rs959938735 715 dbSNP
rs1031576985 719 dbSNP
rs1243656119 721 dbSNP
rs1163269562 727 dbSNP
rs777876864 728 dbSNP
rs1490711984 732 dbSNP
rs1214320076 735 dbSNP
rs1370936877 738 dbSNP
rs968555797 739 dbSNP
rs1021888453 742 dbSNP
rs754837091 744 dbSNP
rs1422232148 746 dbSNP
rs1054112 747 dbSNP
rs1038047005 748 dbSNP
rs1187519847 750 dbSNP
rs940616460 751 dbSNP
rs751578935 757 dbSNP
rs780679047 758 dbSNP
rs1007610784 760 dbSNP
rs34426998 761 dbSNP
rs574627429 761 dbSNP
rs1290961498 764 dbSNP
rs556256818 767 dbSNP
rs907567441 771 dbSNP
rs1250272147 772 dbSNP
rs1315359271 778 dbSNP
rs1212380536 781 dbSNP
rs1451469899 787 dbSNP
rs536824087 788 dbSNP
rs1046074109 796 dbSNP
rs949020172 807 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 57455.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucuUGGAGCCG--ACCCCGCCCga 5'
             || | ||:   ||||||||  
Target 5' --cACGUGGGUCGCGGGGCGGG-- 3'
 		1 - 20
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucuUGGAGCCG--ACCCCGCCCGa 5'
             || | ||:   ||||||||| 
Target 5' cucACGUGGGUCGCGGGGCGGGC- 3'
 		4 - 26
Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000170168.4 | 3UTR | CACGUGGGUCGCGGGGCGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000170168.4 | 3UTR | CUCCUCACGUGGGUCGCGGGGCGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
91 hsa-miR-4707-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT442514 SYT7 synaptotagmin 7 2 4
MIRT457799 NQO2 N-ribosyldihydronicotinamide:quinone reductase 2 2 2
MIRT466318 THRA thyroid hormone receptor, alpha 2 2
MIRT486129 TRAF3 TNF receptor associated factor 3 2 2
MIRT492341 SEPT8 septin 8 2 2
MIRT495690 KCNC3 potassium voltage-gated channel subfamily C member 3 2 2
MIRT496928 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT499518 MAFK MAF bZIP transcription factor K 2 2
MIRT501367 REXO1 RNA exonuclease 1 homolog 2 4
MIRT501636 PIAS4 protein inhibitor of activated STAT 4 2 4
MIRT521071 SLC25A16 solute carrier family 25 member 16 2 2
MIRT525700 PCYT2 phosphate cytidylyltransferase 2, ethanolamine 2 2
MIRT532722 DDTL D-dopachrome tautomerase like 2 2
MIRT533137 WWC1 WW and C2 domain containing 1 2 4
MIRT537288 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT570555 PHF21B PHD finger protein 21B 2 2
MIRT573469 MTRNR2L9 MT-RNR2-like 9 2 2
MIRT576750 Tmem127 transmembrane protein 127 2 2
MIRT609342 DAAM2 dishevelled associated activator of morphogenesis 2 2 2
MIRT610638 PIGM phosphatidylinositol glycan anchor biosynthesis class M 2 2
MIRT612591 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT614237 WDR53 WD repeat domain 53 2 4
MIRT622784 PGK1 phosphoglycerate kinase 1 2 2
MIRT628880 MED16 mediator complex subunit 16 2 2
MIRT629550 SPN sialophorin 2 2
MIRT634714 DDX19B DEAD-box helicase 19B 2 2
MIRT634932 GTF2H2C GTF2H2 family member C 2 4
MIRT635341 RBL1 RB transcriptional corepressor like 1 2 2
MIRT637838 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT644311 NFKBID NFKB inhibitor delta 2 2
MIRT649206 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT657262 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT658919 DPY19L4 dpy-19 like 4 2 2
MIRT663608 SEC23B Sec23 homolog B, coat complex II component 2 2
MIRT667425 MFAP2 microfibril associated protein 2 2 2
MIRT667667 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT668144 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT668540 ERGIC1 endoplasmic reticulum-golgi intermediate compartment 1 2 2
MIRT670039 NFRKB nuclear factor related to kappaB binding protein 2 2
MIRT670875 RAB10 RAB10, member RAS oncogene family 2 2
MIRT672694 ZNF677 zinc finger protein 677 2 2
MIRT673107 MFSD2A major facilitator superfamily domain containing 2A 2 2
MIRT673508 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 4
MIRT674244 NUP62 nucleoporin 62 2 4
MIRT676541 IRGQ immunity related GTPase Q 2 2
MIRT676787 CXorf38 chromosome X open reading frame 38 2 4
MIRT677600 PRKX protein kinase, X-linked 2 2
MIRT678607 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT678940 MYADM myeloid associated differentiation marker 2 2
MIRT679104 CD99 CD99 molecule (Xg blood group) 2 2
MIRT679196 WNT2B Wnt family member 2B 2 2
MIRT679325 ZMYM4 zinc finger MYM-type containing 4 2 2
MIRT679634 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT679819 TMEM106B transmembrane protein 106B 2 2
MIRT679898 FBXO48 F-box protein 48 2 2
MIRT680579 ZNF784 zinc finger protein 784 2 2
MIRT680600 SZT2 SZT2, KICSTOR complex subunit 2 2
MIRT682991 RNF40 ring finger protein 40 2 4
MIRT683483 ZNF7 zinc finger protein 7 2 2
MIRT683681 MICA MHC class I polypeptide-related sequence A 2 2
MIRT684122 CEP104 centrosomal protein 104 2 2
MIRT684774 MYO1F myosin IF 2 2
MIRT685698 BHMT2 betaine--homocysteine S-methyltransferase 2 2 2
MIRT686471 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT687940 HMGB1 high mobility group box 1 2 2
MIRT688627 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT689110 ZBTB25 zinc finger and BTB domain containing 25 2 2
MIRT690063 MBD1 methyl-CpG binding domain protein 1 2 2
MIRT691067 NUGGC nuclear GTPase, germinal center associated 2 2
MIRT691317 KIAA1841 KIAA1841 2 2
MIRT692778 SYNPO2L synaptopodin 2 like 2 2
MIRT694087 KIAA0930 KIAA0930 2 2
MIRT696148 WDR59 WD repeat domain 59 2 2
MIRT696176 GNB5 G protein subunit beta 5 2 2
MIRT696434 SUGP1 SURP and G-patch domain containing 1 2 2
MIRT697974 TSPAN6 tetraspanin 6 2 2
MIRT698917 SPEM1 spermatid maturation 1 2 2
MIRT699312 SLC35F5 solute carrier family 35 member F5 2 4
MIRT700500 PTPN4 protein tyrosine phosphatase, non-receptor type 4 2 2
MIRT700557 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT701817 MRPL37 mitochondrial ribosomal protein L37 2 2
MIRT702045 METTL21A methyltransferase like 21A 2 2
MIRT702215 LPCAT1 lysophosphatidylcholine acyltransferase 1 2 2
MIRT702337 KLHL7 kelch like family member 7 2 2
MIRT704139 DNAL1 dynein axonemal light chain 1 2 2
MIRT704189 LDHD lactate dehydrogenase D 2 2
MIRT705344 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT706097 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT709068 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT717579 VTA1 vesicle trafficking 1 2 2
MIRT722440 ZBTB7B zinc finger and BTB domain containing 7B 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4707 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4707 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4707 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4707 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4707-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4707-3p Tripterygium wilfordii Hook F sensitive tissue
hsa-miR-4707-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-4707-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-4707-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-4707-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission