>MTRNR2L8|NM_001190702|3'UTR
   1 TATAACAAGACGAGAAGACCCTATGGAGCTTTAATTCATTAACGCAAACAACACTTAACAAGTCCACAGGCCCTAAACTA
  81 TCAAACCTGCGTGAAAAATTTCGGTTGGGGCGACCTCGGAGCACAATCCGACCTCCGAGCAACACATGCCGAGACTTCAC
 161 CAGTCAAAGCGAATTACCACGTTTAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACAGCGCAAT
 241 CCTATTCTAGAGTCCATATCAACAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uuGGGUUAUAGUUUGUAUAGu 5' :|:|: :|| |||||| Target 5' atTCTAGAGTC---CATATCa 3'	244 - 261	123.00	-9.30
2	miRNA 3' uuGGGUUAUAGUU-UGUAUAGu 5' ||: | ||| ||||: | Target 5' gaCCTCCGAGCAACACATGCCg 3'	130 - 151	103.00	-10.30
3	miRNA 3' uugGGUUAUAGUUUGUAUAGu 5' |||| : :|||| :|: Target 5' tgaCCAACG--GAACAAGTTa 3'	201 - 219	90.00	-5.60

Mutant ID	Mutant Position	Mutant Source
COSN26505187	37	COSMIC
COSN26465886	43	COSMIC
COSN15665465	90	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs879123431	1	dbSNP
rs1461300334	3	dbSNP
rs1265784574	4	dbSNP
rs181020376	5	dbSNP
rs1464187741	6	dbSNP
rs1392728723	11	dbSNP
rs1161915263	12	dbSNP
rs1420138382	14	dbSNP
rs1407384456	17	dbSNP
rs1479273775	22	dbSNP
rs1175518731	24	dbSNP
rs1455621092	25	dbSNP
rs1190049089	28	dbSNP
rs78806612	37	dbSNP
rs1187738986	38	dbSNP
rs1213285287	39	dbSNP
rs12164827	43	dbSNP
rs1263388646	44	dbSNP
rs1386676192	45	dbSNP
rs999433731	46	dbSNP
rs1317401761	47	dbSNP
rs879203233	51	dbSNP
rs878877898	52	dbSNP
rs879129090	55	dbSNP
rs1346678650	56	dbSNP
rs879203633	62	dbSNP
rs878935607	63	dbSNP
rs1274241754	70	dbSNP
rs878959293	71	dbSNP
rs1373979744	73	dbSNP
rs878949694	81	dbSNP
rs574082736	86	dbSNP
rs948994130	87	dbSNP
rs1328027973	89	dbSNP
rs79890206	91	dbSNP
rs12161765	93	dbSNP
rs1274195407	98	dbSNP
rs773894562	103	dbSNP
rs1342641188	105	dbSNP
rs916148261	109	dbSNP
rs1184376065	111	dbSNP
rs144647066	112	dbSNP
rs1472368405	114	dbSNP
rs189323874	117	dbSNP
rs762140928	118	dbSNP
rs1470296797	119	dbSNP
rs1403327363	121	dbSNP
rs774627711	123	dbSNP
rs77685346	124	dbSNP
rs76582454	127	dbSNP
rs567981161	129	dbSNP
rs78715228	130	dbSNP
rs775008347	135	dbSNP
rs560342363	136	dbSNP
rs985943373	137	dbSNP
rs1294686525	140	dbSNP
rs80044127	142	dbSNP
rs78985758	143	dbSNP
rs1191943133	147	dbSNP
rs76238052	150	dbSNP
rs75747393	151	dbSNP
rs534476634	162	dbSNP
rs1226925205	167	dbSNP
rs1289643787	170	dbSNP
rs1438875909	170	dbSNP
rs372106711	171	dbSNP
rs8181594	174	dbSNP
rs879023070	178	dbSNP
rs879039647	180	dbSNP
rs879110802	181	dbSNP
rs77455544	182	dbSNP
rs113018605	183	dbSNP
rs80196904	184	dbSNP
rs1221783989	186	dbSNP
rs1022194567	190	dbSNP
rs1370344932	191	dbSNP
rs990169863	192	dbSNP
rs1270999483	196	dbSNP
rs1420018859	198	dbSNP
rs1431549899	199	dbSNP
rs1430364289	204	dbSNP
rs957356541	208	dbSNP
rs1335992262	209	dbSNP
rs1335659628	225	dbSNP
rs1032182459	230	dbSNP
rs1446897736	234	dbSNP
rs998986367	235	dbSNP
rs1340582642	236	dbSNP
rs1405303443	237	dbSNP
rs907262081	244	dbSNP
rs1273034463	246	dbSNP
rs1342074594	250	dbSNP
rs866612483	250	dbSNP
rs551759354	253	dbSNP
rs1466736002	254	dbSNP
rs1419691772	256	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- PLoS pathogens, 2012

KSHV is the etiological agent of Kaposi's sarcoma (KS), primary effusion lymphoma (PEL), and a subset of multicentricCastleman's disease (MCD). The fact that KSHV-encoded miRNAs are readily detectable in all KSHV-associated tumors suggests a potential role in viral pathogenesis and tumorigenesis. MiRNA-mediated regulation of gene expression is a complex network with each miRNA having many potential targets, and to date only few KSHV miRNA targets have been experimentally determined. A detailed understanding of KSHV miRNA functions requires high-through putribonomics to globally analyze putative miRNA targets in a cell type-specific manner. We performed Ago HITS-CLIP to identify viral and cellular miRNAs and their cognate targets in two latently KSHV-infected PEL cell lines. Ago HITS-CLIP recovered 1170 and 950 cellular KSHV miRNA targets from BCBL-1 and BC-3, respectively. Importantly, enriched clusters contained KSHV miRNA seed matches in the 3'UTRs of numerous well characterized targets, among them THBS1, BACH1, and C/EBPbeta. KSHV miRNA targets were strongly enriched for genes involved in multiple pathways central for KSHV biology, such as apoptosis, cell cycle regulation, lymphocyte proliferation, and immune evasion, thus further supporting a role in KSHV pathogenesis and potentially tumorigenesis. A limited number of viral transcripts were also enriched by HITS-CLIP including vIL-6 expressed only in a subset of PEL cells during latency. Interestingly, Ago HITS-CLIP revealed extremely high levels of Ago-associated KSHV miRNAs especially in BC-3 cells where more than 70% of all miRNAs are of viral origin. This suggests that in addition to seed match-specific targeting of cellular genes, KSHV miRNAs may also function by hijacking RISCs, thereby contributing to a global de-repression of cellular gene expression due to the loss of regulation by human miRNAs. In summary, we provide an extensive list of cellular and viral miRNA targets representing an important resource to decipher KSHV miRNA function.

- Cell, 2013

The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- Genome biology, 2013

BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.

- Breast cancer research and treatment, 2014

miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.