pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3189 |
Genomic Coordinates | chr19: 18386562 - 18386634 |
Description | Homo sapiens miR-3189 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3189-5p | |||||||||||||||||||||
Sequence | 9| UGCCCCAUCUGUGCCCUGGGUAGGA |33 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Illumina | DRVs in miRNA |
|
|||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | MKNK2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | GPRK7, MNK2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | MAP kinase interacting serine/threonine kinase 2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_199054 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other Transcripts | NM_017572 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on MKNK2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of MKNK2 (miRNA target sites are highlighted) |
>MKNK2|NM_199054|3'UTR 1 CCCTCCCATCTCCCCTCTGTACATAGGTCACCCGTCCCCCAATCAAATCTAAAGGTTTTTTAAGCTATCGCCAGCCGGTG 81 TCCAGCGGGCTGCCCCTCCTCTGCCTGGATTCCCAGGCACTAAGCTCAGCTGAGGGGGGTGTTTTATAGAAGGTTTTTGC 161 TTTTGGGTTTTTTTTTTCCTGTTTCCACCCCTCCCCGTTATTTTTTCCTTTGGATGGTTAAAAGCATTGCAGGCACCCGG 241 GAAGGTGAGCAGAGGGTAGGTGGGTGGGCTTGTCCCCTCCCCGGTCCCCCGCCCTGCTCACCTCTACTATGAAGGTGCCC 321 CCAGGTCACCTGTGCTGCCCGCCATCTGCCCACGTGGCTTGCAGTGACTCAGGAGAGCAGGCCCACAGCGTTTGCCATCT 401 TGCAGAGCTGGGGAGGGGCACAGGACCCTGCCCTCGTGTTCCCTCCCAGCCCGCAGTATTTCAGGGACAGGCTCTTCCCC 481 TCTATCCCTCACCCTGAGAGCACCCCTGGTGGCTTGGTTGGGGAAGGGAGGGGCTGCCTGTCTCTGGAGGTGTCAGGCAG 561 GCAGGTGGCAGGCAGCTCACCCACCCACCCCATGGGATCCCCCAGCCCTTCACCCGCGCCTGCCTTGTCCCCATGATAGT 641 TGACAATCGGGGCTTCCTGCAAGGCCCGTCTGTCTGTCCAGGACTCCTGGTGGCCAGATTCGGCCTCCGACCTTGACCTT 721 AAACTGCAGCTGACCCCAGGGGCTCGCCGCTGCCCCTCCCCTCCACACCAAGGCCTGAGACAGCAGGAGCCCCGCCTGGC 801 CCGAAGCCGTTTCCACCGCAGCAGGCAGAGGGGCTGGACAGGCACTGTCAGCCAATGTGGGGGGTCCTGAAGACACCCCC 881 TTGGGGCACCCGAGTGCCCCTTCTCAGGGCTCAGTCTGACCGTAGCCACGTCCTGCCTCGCGCCGCCCCTCGGGCCTGAC 961 CTGGAAGCTCCGTCAGCTCCGTCCTTGTCCTTAGAGCTGAGCCCAGACCCCGGGGTCTGGCCGAATCCTCACCCCCAGGG 1041 CAGTGTTTTTGGTCTGCCACCTTCAGGAAAACGGCTGCGGCCTCGGCCTCCCTTCGGGCACCCAGGAATGCGGGGGTCTG 1121 CTCAGTCCCCCCACCCTCCATGCTCCAACCCCCGGGGGCTGCGGAGCCTGCTGCCCCCTCCCCGCGGGTGGGGACGTTCT 1201 ATGCAATACAGGGTTCCACTTTAGAAGTGCGCGCGGCTAGGGTCACCGCCCGCCCTTCCCGGCGCAGCCCCCGAGCTCCA 1281 CAGCTGGGGCAGCCCCTCTGGCTTCTAAATCCGCGGTCGGGATTCTTCCTCCTGTTTAGTTTTTTAGTTTTTCCTTAAAA 1361 AAAAACAACACATCGATGGACTTTGCTTCCCTGTTCTTGAAGAATACTTGAATGTCGGGGGGCCTGGGGGTGGGGGCCTC 1441 GGAGACCGTCTGCCTGGCCCTGCTGCCCCTCCTGAATCTCGTATGATGGTCACAGTCCGGTGGCCGTGGGGGTGCTCTGC 1521 CTTCCCTGGTCCCCACTGCCCATATCTGTGGACTGCCCCTTCCAAAGACCCCTGGGGGGGGTGGGGCATTCCGCCCACCC 1601 CTTTCCCCCATCACTTCTCGCCTGTCAGTGATTCCATGTTTCGTAACGGGGGATTCTCTGCCTTTTTGTATCAAAGAACA 1681 AGCAAATGGACCCCCGCCCGCTGCAGGCGCCCATAGCCATCGGGTCTCTAAAGCTGAGTGGCTAGCAGCGTTTGTTTGTT 1761 TGTTTTTTTTTTTTTTTCTGAAGGTGGGACAGTCACTTCCTCCTCCCTCCCCACCCCTGTCGCATCCACGTGCGACCTGG 1841 AGGACTGGTCAGAACCGTTACTGTGAATGAGTGAAGATCCTGGAGGACCCTGGGCCCCAGGCCAGCTCCCATCGCTGGGG 1921 GACGGTGAACGGCCATGTGTTAATGTTACGATGTTTTTAAAAGACAAAAAAAAAAAAAAAACCTCAAAAGTTTTTTTAAA 2001 GTGGGGGAAAAACATCCAAGCACTTTAATTCCAATGTACCAGGTGAACTGACGGAGCTCAGAAGTTTTCCTTTACACCAA 2081 CTGTCAATGCCGGAATTTTGTATTCTGTTTTGTAAAGATTTAATAAAAGTCAAAAAACTTGCAAAAAAAAAAAAAAAAAA 2161 AA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | MCF7 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Prostate Tissue | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760591. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_B
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset GSM4903828 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / PID21_9124 |
Location of target site | NM_199054 | 3UTR | AUUCCGCCCACCCCUUUCCCCCAUCACUUCUCGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161237 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset SRR1045082 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | MCF7 / Untreated |
Location of target site | ENST00000591601.1 | 3UTR | CUGGGGCAGCCCCUCUGGCUUCUAAAUCCG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24398324 / SRX388831 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
54 hsa-miR-3189-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT055405 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | 2 | 6 | ||||||||
MIRT263576 | GHITM | growth hormone inducible transmembrane protein | 2 | 2 | ||||||||
MIRT338983 | CPSF6 | cleavage and polyadenylation specific factor 6 | 2 | 2 | ||||||||
MIRT404222 | RPL7L1 | ribosomal protein L7 like 1 | 2 | 2 | ||||||||
MIRT451745 | CES3 | carboxylesterase 3 | 2 | 2 | ||||||||
MIRT454466 | RBM14 | RNA binding motif protein 14 | 2 | 8 | ||||||||
MIRT477627 | EFNA1 | ephrin A1 | 2 | 2 | ||||||||
MIRT495128 | METTL24 | methyltransferase like 24 | 2 | 2 | ||||||||
MIRT496506 | G6PC | glucose-6-phosphatase catalytic subunit | 2 | 2 | ||||||||
MIRT497260 | GRK6 | G protein-coupled receptor kinase 6 | 2 | 2 | ||||||||
MIRT501881 | MKNK2 | MAP kinase interacting serine/threonine kinase 2 | 2 | 2 | ||||||||
MIRT504586 | ADH1B | alcohol dehydrogenase 1B (class I), beta polypeptide | 2 | 4 | ||||||||
MIRT505570 | SMC1A | structural maintenance of chromosomes 1A | 2 | 6 | ||||||||
MIRT506759 | KMT2D | lysine methyltransferase 2D | 2 | 2 | ||||||||
MIRT512454 | POLR3G | RNA polymerase III subunit G | 2 | 2 | ||||||||
MIRT512716 | YWHAZ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | 2 | 2 | ||||||||
MIRT514382 | CLUAP1 | clusterin associated protein 1 | 2 | 2 | ||||||||
MIRT519861 | ZFP62 | ZFP62 zinc finger protein | 2 | 6 | ||||||||
MIRT525670 | NHLRC4 | NHL repeat containing 4 | 2 | 2 | ||||||||
MIRT526359 | TIMMDC1 | translocase of inner mitochondrial membrane domain containing 1 | 2 | 2 | ||||||||
MIRT526656 | PRSS42 | protease, serine 42 | 2 | 4 | ||||||||
MIRT527017 | PABPN1L | poly(A) binding protein nuclear 1 like, cytoplasmic | 2 | 2 | ||||||||
MIRT532190 | MPDU1 | mannose-P-dolichol utilization defect 1 | 2 | 2 | ||||||||
MIRT533223 | VPS4A | vacuolar protein sorting 4 homolog A | 2 | 2 | ||||||||
MIRT543161 | GTF2A1 | general transcription factor IIA subunit 1 | 2 | 2 | ||||||||
MIRT552228 | SART3 | squamous cell carcinoma antigen recognized by T-cells 3 | 2 | 2 | ||||||||
MIRT552719 | YTHDC1 | YTH domain containing 1 | 2 | 2 | ||||||||
MIRT556873 | IVNS1ABP | influenza virus NS1A binding protein | 2 | 2 | ||||||||
MIRT558255 | DYNLL2 | dynein light chain LC8-type 2 | 2 | 2 | ||||||||
MIRT563105 | IFRD2 | interferon related developmental regulator 2 | 2 | 2 | ||||||||
MIRT565436 | SURF4 | surfeit 4 | 2 | 2 | ||||||||
MIRT568459 | ARPP19 | cAMP regulated phosphoprotein 19 | 2 | 2 | ||||||||
MIRT572804 | PPP3CB | protein phosphatase 3 catalytic subunit beta | 2 | 2 | ||||||||
MIRT576203 | Baz2a | bromodomain adjacent to zinc finger domain, 2A | 2 | 2 | ||||||||
MIRT623519 | KCNK10 | potassium two pore domain channel subfamily K member 10 | 2 | 2 | ||||||||
MIRT637006 | HHAT | hedgehog acyltransferase | 2 | 2 | ||||||||
MIRT643668 | WDR5 | WD repeat domain 5 | 2 | 2 | ||||||||
MIRT647472 | TNFAIP8L1 | TNF alpha induced protein 8 like 1 | 2 | 2 | ||||||||
MIRT650823 | LZTR1 | leucine zipper like transcription regulator 1 | 2 | 2 | ||||||||
MIRT657377 | HMGA1 | high mobility group AT-hook 1 | 2 | 2 | ||||||||
MIRT685077 | HPSE | heparanase | 2 | 2 | ||||||||
MIRT687565 | MDGA1 | MAM domain containing glycosylphosphatidylinositol anchor 1 | 2 | 2 | ||||||||
MIRT696101 | SETD1A | SET domain containing 1A | 2 | 2 | ||||||||
MIRT704887 | CCND1 | cyclin D1 | 2 | 2 | ||||||||
MIRT709133 | GLG1 | golgi glycoprotein 1 | 2 | 2 | ||||||||
MIRT709189 | SAPCD2 | suppressor APC domain containing 2 | 2 | 2 | ||||||||
MIRT713407 | PEX16 | peroxisomal biogenesis factor 16 | 2 | 2 | ||||||||
MIRT713467 | SLC22A12 | solute carrier family 22 member 12 | 2 | 2 | ||||||||
MIRT714544 | COL14A1 | collagen type XIV alpha 1 chain | 2 | 2 | ||||||||
MIRT716953 | TFAP2B | transcription factor AP-2 beta | 2 | 2 | ||||||||
MIRT717325 | PGK1 | phosphoglycerate kinase 1 | 2 | 2 | ||||||||
MIRT718252 | ZDHHC8 | zinc finger DHHC-type containing 8 | 2 | 2 | ||||||||
MIRT718522 | WDR33 | WD repeat domain 33 | 2 | 2 | ||||||||
MIRT723002 | FADS1 | fatty acid desaturase 1 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|