pre-miRNA Information | |
---|---|
pre-miRNA | hsa-let-7e |
Genomic Coordinates | chr19: 51692786 - 51692864 |
Synonyms | MIRNLET7E, hsa-let-7e, let-7e, MIRLET7E |
Description | Homo sapiens let-7e stem-loop |
Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||
---|---|---|---|---|---|---|---|
Mature miRNA | hsa-let-7e-5p | ||||||
Sequence | 8| UGAGGUAGGAGGUUGUAUAGUU |29 | ||||||
Evidence | Experimental | ||||||
Experiments | Cloned | ||||||
SNPs in miRNA |
|
||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | MBD2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | DMTase, NY-CO-41 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | methyl-CpG binding domain protein 2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_003927 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other Transcripts | NM_015832 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on MBD2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of MBD2 (miRNA target sites are highlighted) |
>MBD2|NM_003927|3'UTR 1 GAATATGATCAGGTAACTTTCGACCGACTTTCCCCAAGAGAAAATTCCTAGAAATTGAACAAAAATGTTTCCACTGGCTT 81 TTGCCTGTAAGAAAAAAAATGTACCCGAGCACATAGAGCTTTTTAATAGCACTAACCAATGCCTTTTTAGATGTATTTTT 161 GATGTATATATCTATTATTCAAAAAATCATGTTTATTTTGAGTCCTAGGACTTAAAATTAGTCTTTTGTAATATCAAGCA 241 GGACCCTAAGATGAAGCTGAGCTTTTGATGCCAGGTGCAATCTACTGGAAATGTAGCACTTACGTAAAACATTTGTTTCC 321 CCCACAGTTTTAATAAGAACAGATCAGGAATTCTAAATAAATTTCCCAGTTAAAGATTATTGTGACTTCACTGTATATAA 401 ACATATTTTTATACTTTATTGAAAGGGGACACCTGTACATTCTTCCATCATCACTGTAAAGACAAATAAATGATTATATT 481 CACAGACTGATTGGAATTCTTTCTGTTGAAAAGCACACACAATAAAGAACCCCTCGTTAGCCTTCCTCTGATTTACATTC 561 AACTCTGATCCCTGGGCCTTAGGTTTGACATGGAGGTGGAGGAAGATAGCGCATATATTTGCAGTATGAACTATTGCCTC 641 TGGACGTTGTGAGAATTGTGCTTTCACCAGAATTTCTAAGAATTTCTGCTAAATATCACCTAGCATGTGTAATTTTTTTT 721 CCTTGCCTGTGACTTGGACTTTTGATAGTTCTATAAGAATAAGGCTTTTTCTTCCCTTGGGCATGAGTCAGATACACAAG 801 GACCCTTCAGGTGTTACTAGAAGGCGTCCATGTTTATTGTTTTTTAAAGAATGTTTGGCACTCTCTAACGTCCACTAGCT 881 TACTGAGTTATCAGGTGCAGGTCAGACTCTTGGCTACAGTGAGAGGCAGCTTCTAGACAGAGTTGCTTAATGAAAGGGTT 961 TGTAATACTTTACAAACCATTACCTGTACCTGGCCTGGCCTCCAAAATATTAACATTCTTTTTCTGTTGAAACTCGCGAG 1041 TGTAACTTTCATACCACTTGAATTTATTGATATTTAATTATGAAAACTAGCATTACATTATTAAACGATTTCTAAAATCA 1121 AAACATACTTAATCTGATACCAAGGAAGGGAGGGAGTGGTTATAAGCAAATGAAAACAAATTTTGAGAGACAGAGCAAAA 1201 GTAAAATCATTCTATAGAAAAGGTGTGTTTATTTCTTAACTCTTGAGTTCTTTTAAAATTAGAACCTAAATGATGCAGTC 1281 AGGGGTATGACCAATTCCACATGAGTGTCACCTGTACATTTTATTACCACTACCTCCAGTTTCCAAGGCAGGGAAGAAGA 1361 GGGGAATAGTCAAAGCAATATGACTAGCTAGGTTTGGGCTGCTGTTTGGGCTGCTGTTTTTCCTGGACTTTTATGCCAAA 1441 CTACATAAATACTTCTTGGAATTCCTGATTTACGCTCAACTTTGATCCCTGGACCCTAGGGCCATTAGTTTCCTTGAAGC 1521 AGTCCTGCTGGTGGATGAGCAGGGAAACTTGTAGACCCTGGGAAGCCAATTGGTAGAGGGTGCCTGCCCGCCCCATCAGA 1601 CTGTCCCAACTGGGGTGGGGGTGAGGATCATAGTGATTTCTTTTTAAAAGCTAGTATGACTAGTGAGAATGGATGTCCAA 1681 GGGCTTTTCTCTTCCTCCCCCGAGTCCACGATTCTTCATTTGTGATCAGGGTTGGGGTAACTTCACCTTGGTGATCATAT 1761 ATTCTTTTTACAAACCAATCCAGCCAAGATATATGTGCTTTTCTAAACAGCTTGTAAAAGCAAAAACACAATGTATACAC 1841 ATATAAAACTGATTTTTTTTTTTTTGCTTATATACTTTGCTCAGGTGGAGAACAAGGTATGAAAGCCATTATATGGTGTC 1921 CCTTGGGGACCATCCCATAAGTCCAGGGTGTTCCCAATATACCCACAAGACAACATGTTCAAAACTTCATCACCTGGTCC 2001 CCACAAACCTACCACCCTCTTCCATTCCCTCACTCTGGTAAAAGCAAGCCATCTTCTCCAGTTACGCAAGGCAGAAGCCC 2081 AGGAGTGAGCACAATGCTGCCCTTTCCCTTGCTTCTGACTTCTCATCAATCCTATTAGAACTACTGACTGCACCCCACCT 2161 CTCCTCCATCCCCACGATCACTGCCTTCATATGAACTGCCTTTCCTGTCCTCTGGACTTTCAGTGGCTTCCTTTTTTGCT 2241 CACCTGTCCACTTTCTTCCCCTTCCCTCTCTCCATCCCTCCACATAGTCATCAGAAAGATCATCAAAACAGGCAAATGTG 2321 ACTGTATTATTTCCCTCACTTATCTTTGTATGCAGTTTAGAGTGATTTTTAAGAGCACACACTTTGAAATTAGGAGAACC 2401 TGTGTCTGAATCCTGATTTTTGCCATTTGTGTGACTTGTCAGGTTATTTAATCTCTTTGAGCCTGTCCCTCCTCAGTGAA 2481 ATAGGAATAATAATACCTACCTCATAGAGTTGTTGTGAGGATTCAGTGAGATAGACTGTTTCTAAAGTGTGTAGCACAGT 2561 GCCTGGCACATAGTGGGTGCTCACATTGGAGCACACTATTGTCGCTATCCCTGCAGGTGTGAGTTTTACATCCTTTCCAA 2641 GAGGCATTTGCTAATAACCCTAACTACCGCCTATCCCTGTGACACTATTTTCTGCCTCAGCACCCTATTTCTTTTGTAGA 2721 CATTTTCTAAGTCTGTATTTTATTTATTTGTTGGCTTTTTGTCTATTTCTCTACTAGAATGTAAGCTCCATGAGAGCAAG 2801 GATGTGTTTGTCTGATTTCCCGTTACAGCCCCAGCACTTAGCTGAGTGACTGGCACCTAGTAAGCACTCAGTAACTGTTT 2881 GCTGAATAAATGGAAGAATGGTCAAAAGGCTCTTCTTGATCTGATCCCTGCTTGTCTGTCTGGCCTCATGCTGCCACTAT 2961 TCCTCACTGCACCTTCAGCTCAAGAAAAACCTCTTTACTTGCTTCTTTGAAGTGCCCCTTGGGCCTCTGTGTCTTTGTAC 3041 CTGTTGTTCCCTTTGCCTGAAACACCCTTTGCCTGCCCGTCTACATGGTGAATTCCTAATCATTGATGAAGTCTCAGCTC 3121 AATGGCTACCTCCTCTGTGAAGCTGTCCCTGATTTCTTCAGGCAGATGTTCTTTCCCGCCTTCCCTGTTCCCACCGCACT 3201 TTGTAAATACCTCCATGGAAGCACTTTATTGTATTGTATTGTAATTTTTTTTTGCATGTCTGTTTCTACTATTAGACTGT 3281 AAGCACCGTAAAAGCAGAGATTGTGCTTTTTCATCCTCATGTTCCCCGAGCCTAGCCCAGTGCCTGGCACGTAATAGCTT 3361 GTCATTAAATATTTGTTGAATGAATCTGTGAATGAACAAGAGTCATGCAGTTGGAAAAGTGTTAGAAGCTGTATGTATTA 3441 TAAAGGAAAGAAATGCCCTTGGTGGCTTCCAGGGTGTTTTTTTTTTTTTTTTTGGTCTAAAGAGGAGATCTAGAGAGTGT 3521 TATACAATCTCTTTGAATATAAGATTACTCGTTTGGATTTTTAAAATAATATAGATCTTCATAAATAATTGCAAAGATAT 3601 AAACAAGCTTTGTGATTTCTCAAATGCTATGAAGTCCAAAATAAATATTTGCACTATTAGTATTTCCATAGTAAATGCTA 3681 TGAGAAAATGTACAGCAATAAATTTTGAAGCTTTAAAACTGTTAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 8932.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 8932.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | MCF7 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
CLIP-seq Support 1 for dataset GSM545215 | |
---|---|
Method / RBP | PAR-CLIP / AGO4 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000256429.3 | 3UTR | AUAAUAAUACCUACCUCAUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000256429.3 | 3UTR | AUAAUAAUACCUACCUCAUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM545217 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-7 transfection |
Location of target site | ENST00000256429.3 | 3UTR | AUAAUAAUACCUACCUCAUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000256429.3 | 3UTR | AAUAAUAAUACCUACCUCAUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000256429.3 | 3UTR | AUAAUAAUACCUACCUCAUAGA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM1065669 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
Location of target site | ENST00000256429.3 | 3UTR | AUAAUAAUACCUACCUCAUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset SRR1045082 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | MCF7 / Untreated |
Location of target site | ENST00000256429.3 | 3UTR | AUAAUAAUACCUACCUCAUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24398324 / SRX388831 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
581 hsa-let-7e-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT002081 | HMGA2 | high mobility group AT-hook 2 | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 5 | |||
MIRT003932 | EIF3J | eukaryotic translation initiation factor 3 subunit J | ![]() |
![]() |
2 | 1 | ||||||
MIRT004469 | SMC1A | structural maintenance of chromosomes 1A | ![]() |
![]() |
![]() |
![]() |
4 | 7 | ||||
MIRT005718 | WNT1 | Wnt family member 1 | ![]() |
![]() |
![]() |
![]() |
4 | 1 | ||||
MIRT006122 | CCND1 | cyclin D1 | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 4 | |||
MIRT006404 | MPL | MPL proto-oncogene, thrombopoietin receptor | ![]() |
1 | 1 | |||||||
MIRT032098 | RABGAP1L | RAB GTPase activating protein 1 like | ![]() |
1 | 1 | |||||||
MIRT032099 | DAD1 | defender against cell death 1 | ![]() |
1 | 1 | |||||||
MIRT032100 | MYCN | MYCN proto-oncogene, bHLH transcription factor | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT051413 | WDR67 | TBC1 domain family member 31 | ![]() |
1 | 1 | |||||||
MIRT051414 | FAM219B | family with sequence similarity 219 member B | ![]() |
1 | 1 | |||||||
MIRT051415 | C11orf91 | chromosome 11 open reading frame 91 | ![]() |
1 | 1 | |||||||
MIRT051416 | CENPP | centromere protein P | ![]() |
1 | 1 | |||||||
MIRT051417 | TMEM107 | transmembrane protein 107 | ![]() |
1 | 1 | |||||||
MIRT051418 | SREBF1 | sterol regulatory element binding transcription factor 1 | ![]() |
1 | 1 | |||||||
MIRT051419 | DAAM1 | dishevelled associated activator of morphogenesis 1 | ![]() |
1 | 1 | |||||||
MIRT051420 | DGCR8 | DGCR8, microprocessor complex subunit | ![]() |
1 | 1 | |||||||
MIRT051421 | RAP1A | RAP1A, member of RAS oncogene family | ![]() |
1 | 1 | |||||||
MIRT051422 | RPA1 | replication protein A1 | ![]() |
1 | 1 | |||||||
MIRT051423 | SKIV2L | Ski2 like RNA helicase | ![]() |
1 | 1 | |||||||
MIRT051424 | AGO1 | argonaute 1, RISC catalytic component | ![]() |
![]() |
![]() |
![]() |
4 | 2 | ||||
MIRT051425 | RPS27 | ribosomal protein S27 | ![]() |
1 | 1 | |||||||
MIRT051426 | ARNT2 | aryl hydrocarbon receptor nuclear translocator 2 | ![]() |
1 | 1 | |||||||
MIRT051427 | GPM6B | glycoprotein M6B | ![]() |
1 | 1 | |||||||
MIRT051428 | TTLL12 | tubulin tyrosine ligase like 12 | ![]() |
1 | 1 | |||||||
MIRT051429 | HIST2H2BF | histone cluster 2 H2B family member f | ![]() |
1 | 1 | |||||||
MIRT051430 | CELF2 | CUGBP Elav-like family member 2 | ![]() |
1 | 1 | |||||||
MIRT051431 | AGO2 | argonaute 2, RISC catalytic component | ![]() |
1 | 1 | |||||||
MIRT051432 | VPS13D | vacuolar protein sorting 13 homolog D | ![]() |
1 | 1 | |||||||
MIRT051433 | RPL10 | ribosomal protein L10 | ![]() |
1 | 1 | |||||||
MIRT051434 | SPCS2 | signal peptidase complex subunit 2 | ![]() |
1 | 1 | |||||||
MIRT051435 | DCAF8 | DDB1 and CUL4 associated factor 8 | ![]() |
1 | 1 | |||||||
MIRT051436 | CTC1 | CST telomere replication complex component 1 | ![]() |
1 | 1 | |||||||
MIRT051437 | NAA60 | N(alpha)-acetyltransferase 60, NatF catalytic subunit | ![]() |
1 | 1 | |||||||
MIRT051438 | PHF3 | PHD finger protein 3 | ![]() |
1 | 1 | |||||||
MIRT051439 | TUBA1B | tubulin alpha 1b | ![]() |
1 | 1 | |||||||
MIRT051440 | SHANK1 | SH3 and multiple ankyrin repeat domains 1 | ![]() |
1 | 1 | |||||||
MIRT051441 | SKA2 | spindle and kinetochore associated complex subunit 2 | ![]() |
1 | 1 | |||||||
MIRT051442 | SPTBN1 | spectrin beta, non-erythrocytic 1 | ![]() |
1 | 1 | |||||||
MIRT051443 | ND2 | MTND2 | ![]() |
1 | 1 | |||||||
MIRT051444 | MED13L | mediator complex subunit 13 like | ![]() |
1 | 1 | |||||||
MIRT051445 | RCOR3 | REST corepressor 3 | ![]() |
1 | 1 | |||||||
MIRT051446 | MACF1 | microtubule-actin crosslinking factor 1 | ![]() |
1 | 1 | |||||||
MIRT051447 | RDX | radixin | ![]() |
![]() |
2 | 5 | ||||||
MIRT051448 | PCBP2 | poly(rC) binding protein 2 | ![]() |
1 | 1 | |||||||
MIRT051449 | UBAP2L | ubiquitin associated protein 2 like | ![]() |
1 | 1 | |||||||
MIRT051450 | CDCA3 | cell division cycle associated 3 | ![]() |
1 | 1 | |||||||
MIRT051451 | CABLES1 | Cdk5 and Abl enzyme substrate 1 | ![]() |
1 | 1 | |||||||
MIRT051452 | BTRC | beta-transducin repeat containing E3 ubiquitin protein ligase | ![]() |
1 | 1 | |||||||
MIRT051453 | C12orf49 | chromosome 12 open reading frame 49 | ![]() |
1 | 1 | |||||||
MIRT051454 | TIMP3 | TIMP metallopeptidase inhibitor 3 | ![]() |
1 | 1 | |||||||
MIRT051455 | WBSCR16 | RCC1 like | ![]() |
1 | 1 | |||||||
MIRT051456 | SLC2A11 | solute carrier family 2 member 11 | ![]() |
1 | 1 | |||||||
MIRT051457 | NF1 | neurofibromin 1 | ![]() |
1 | 1 | |||||||
MIRT051458 | LRRC8A | leucine rich repeat containing 8 VRAC subunit A | ![]() |
1 | 1 | |||||||
MIRT051459 | RUNX1T1 | RUNX1 translocation partner 1 | ![]() |
1 | 1 | |||||||
MIRT051460 | DTNB | dystrobrevin beta | ![]() |
1 | 1 | |||||||
MIRT051461 | SCMH1 | Scm polycomb group protein homolog 1 | ![]() |
1 | 1 | |||||||
MIRT051462 | YWHAG | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma | ![]() |
1 | 1 | |||||||
MIRT051463 | RHBDD2 | rhomboid domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT051464 | ND5 | NADH dehydrogenase, subunit 5 (complex I) | ![]() |
1 | 1 | |||||||
MIRT051465 | NDST1 | N-deacetylase and N-sulfotransferase 1 | ![]() |
1 | 1 | |||||||
MIRT051466 | IGF2BP3 | insulin like growth factor 2 mRNA binding protein 3 | ![]() |
![]() |
2 | 5 | ||||||
MIRT051467 | EIF4A1 | eukaryotic translation initiation factor 4A1 | ![]() |
1 | 1 | |||||||
MIRT051468 | BAHCC1 | BAH domain and coiled-coil containing 1 | ![]() |
1 | 1 | |||||||
MIRT051469 | CARM1 | coactivator associated arginine methyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT051470 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | ![]() |
1 | 1 | |||||||
MIRT051471 | ND3 | NADH dehydrogenase, subunit 3 (complex I) | ![]() |
1 | 1 | |||||||
MIRT051472 | PIGS | phosphatidylinositol glycan anchor biosynthesis class S | ![]() |
1 | 1 | |||||||
MIRT051473 | ALG13 | ALG13, UDP-N-acetylglucosaminyltransferase subunit | ![]() |
1 | 1 | |||||||
MIRT051474 | RPN2 | ribophorin II | ![]() |
1 | 1 | |||||||
MIRT051475 | RPL12 | ribosomal protein L12 | ![]() |
1 | 1 | |||||||
MIRT051476 | NME4 | NME/NM23 nucleoside diphosphate kinase 4 | ![]() |
1 | 1 | |||||||
MIRT051477 | IVD | isovaleryl-CoA dehydrogenase | ![]() |
1 | 1 | |||||||
MIRT051478 | JAZF1 | JAZF zinc finger 1 | ![]() |
1 | 1 | |||||||
MIRT051479 | ND4 | NADH dehydrogenase, subunit 4 (complex I) | ![]() |
1 | 1 | |||||||
MIRT051480 | VARS | valyl-tRNA synthetase | ![]() |
1 | 1 | |||||||
MIRT051481 | RNF26 | ring finger protein 26 | ![]() |
1 | 1 | |||||||
MIRT051482 | LHFPL2 | LHFPL tetraspan subfamily member 2 | ![]() |
1 | 1 | |||||||
MIRT051483 | ARCN1 | archain 1 | ![]() |
1 | 1 | |||||||
MIRT051484 | COX1 | cytochrome c oxidase subunit I | ![]() |
1 | 1 | |||||||
MIRT051485 | SLC12A4 | solute carrier family 12 member 4 | ![]() |
1 | 1 | |||||||
MIRT051486 | AEBP2 | AE binding protein 2 | ![]() |
1 | 1 | |||||||
MIRT051487 | PET112 | glutamyl-tRNA amidotransferase subunit B | ![]() |
1 | 1 | |||||||
MIRT051488 | UROC1 | urocanate hydratase 1 | ![]() |
1 | 1 | |||||||
MIRT051489 | IGF1R | insulin like growth factor 1 receptor | ![]() |
![]() |
![]() |
![]() |
![]() |
5 | 10 | |||
MIRT051490 | BSDC1 | BSD domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT051491 | PTK2 | protein tyrosine kinase 2 | ![]() |
1 | 1 | |||||||
MIRT051492 | CDC5L | cell division cycle 5 like | ![]() |
1 | 1 | |||||||
MIRT051493 | EN2 | engrailed homeobox 2 | ![]() |
1 | 1 | |||||||
MIRT051494 | SSB | Sjogren syndrome antigen B | ![]() |
1 | 1 | |||||||
MIRT051495 | SLCO3A1 | solute carrier organic anion transporter family member 3A1 | ![]() |
1 | 1 | |||||||
MIRT051496 | RRAGC | Ras related GTP binding C | ![]() |
1 | 1 | |||||||
MIRT051497 | ZNF236 | zinc finger protein 236 | ![]() |
1 | 1 | |||||||
MIRT051498 | SEMA4B | semaphorin 4B | ![]() |
1 | 1 | |||||||
MIRT051499 | SERBP1 | SERPINE1 mRNA binding protein 1 | ![]() |
1 | 1 | |||||||
MIRT051500 | XIAP | X-linked inhibitor of apoptosis | ![]() |
1 | 1 | |||||||
MIRT051501 | GTF2I | general transcription factor IIi | ![]() |
1 | 1 | |||||||
MIRT051502 | JMJD1C | jumonji domain containing 1C | ![]() |
1 | 1 |