| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-16-2 |
| Genomic Coordinates | chr3: 160404745 - 160404825 |
| Description | Homo sapiens miR-16-2 stem-loop |
| Comment | This entry represents a second putative hairpin precursor sequence for miR-16, located on chromosome 3 (see also MIR:MI0000070). The sequence was previously named mir-16-3 here and in references . |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-16-2-3p | ||||||||||||||||||
| Sequence | 53| CCAAUAUUACUGUGCUGCUUUA |74 | ||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||
| Experiments | Cloned | DRVs in miRNA |
|
||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||
| Putative Targets | |||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | GRPEL2 | ||||||||||||||||||||
| Synonyms | Mt-GrpE#2 | ||||||||||||||||||||
| Description | GrpE like 2, mitochondrial | ||||||||||||||||||||
| Transcript | NM_152407 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on GRPEL2 | |||||||||||||||||||||
| 3'UTR of GRPEL2 (miRNA target sites are highlighted) |
>GRPEL2|NM_152407|3'UTR 1 AGAGGCCATCAGGAACTGGATGTTCTCCCAGAGCGCAGTCACCTATGTTTCTTTTATTTATTAAACTAGGTTTGTATTGT 81 ACATGAGGTACTTCATGTGATATGTTTTGGATTTAGTCATATTGGCTTTATTTCTAAGATATTCTATTGATTTAATGTGA 161 CCTGTTTGGTCTCATCAGAAGTCTTACCATTGGGCATTTGAACAGTGTGACAGGTGTTCCAATGGCCTTTATCAAAACAT 241 GTTTAGGAAAATTGGTACTGTGATAAATTTGAATCCAAAATCCTTTTAACTATGGGTTTTCAACTACATGTTTCTTCCTA 321 GCGGTCTCTATAACAGGAATTGTGTAGTATCTTGTATTTTGTGGAAAAAGGAGATGGTAGGGATTGGTTCAACATTTGGG 401 TACTTAGAGGATAAAGCTTCGTGGTCGTATAAATTTAGATCATTTGGATTGATTTTTATACACATAGATTTTCAGGACTT 481 TACCTTTTGTTTTGTTTTTTTCCTTTTAGCCATCTTTTGTTCTTGTAATCCCAACTAGATAGGCTTTATGCTCACATCAT 561 TGTCCCATACCCACCCCTTTCTCATCCCCATTTGCAGGGGCTAAAGGTCTAGATGAGACTTGGAAGGCAAGGAGCATCGA 641 AATTTGAGATACCCAGGACCCTTTCAAGCAAGAATGGCCAAAAAGCCTTGTGCTGTCTTTGCTCTTCAAATTATTTTCAG 721 CCTCCTTGTCATATAATCATTTCAGGCAAACTGAGGCAACACTAACAGCTAATGACCCAGATGGCTCTATTTGGGTAATT 801 TACCTACAACTTATTCCACCAGCCTTTACTCCTCTGCCCTTTTGTCAATTTTACCTTATAATCCTTTATTAAATGATGGG 881 AGGTGGTGATCAGGACAAAAGTGTTAGGTTCCCATGATTTCTCATTTCATTTATTAATAGTTAATGCTGAATTTTTTTTT 961 AAGTTTCCTCTGGCTCTATTTATGTTACTTTTTGCGATAAGAACACTTAACATAAGTATTCTCTCCTCTTGGCAATTTTT 1041 TTTTTTTTTCCTGTGTTGCCCAGGCTGACCTCCAACTCCTGGGCCCAAGCAATCCTGCCTCAGCCTGCCAAGTAGCTAGG 1121 ACTACAGGCGTTCACCACTGCGCCCGCAAAGTTTTTTTGTTGTTTTTTTTTTTAAGTTGGTACTCACAAATCACTACCTC 1201 TGTTATATTGACAAGCTCTATTTCCTATTCTTTGTATCTGTTAAGTCACATCTGTGTAAACATTGAGCTCACCTTTTATA 1281 TATTAACCTCTAGAATTAATGGGCCTATGTGGTTTTTTTTCAGTCTTATAGCTGGTGTTCTGTAAAAGATTTGTCCAATA 1361 AACGACTTAATGAATGATACATCAGTCAGATTTTAGGAAGGCAGTCAATTATGGATATTTTAATGTTGGAAGAGGCCTTA 1441 ATGATCAAATCTCACCCTTTCTGCTTCTGAAGTATGAAAATCTAGTCTTTTTAGGACTGGACACAAGGAAAATAATCTCT 1521 AAACTATTGACTAAATTCCAGTGAGAGTATGAATGAAGAACAACTAGATATTAATGTCAATCATTTAAGATTAATGGGCA 1601 TGCAATTAAGTCTCCATTTAAGATTAATGGGCATGCAATGAAGTCTCCAGCAGACAATCAGATGTTGTTGGATGTCTAGA 1681 TTATATAGGTTTAGGTTGAAGTTATAAAATAAAATAAAATTCATTTTCCACTGGAACTCTATGACATTCAGTGGAGTGGT 1761 GGAAAGTTAACCTCTTATACATTATAGATAATTCTAAGACAGCACACAAACTTATCAATAAAGCCATCTCCTTGTGGGCC 1841 TTACCATCTTCATCAGATTTAGACCCTTAAAAAACAAGTAAATATGCACTTTTAAAATGCAATCAAAAGACTGGTGGTTA 1921 AGCTTGTAAAACCAGAACATCTTTTGGCATTCCACTAAGTATATATTGTAAATTTAATGAACAATCAAGGTTCACAATAG 2001 GAAGTTGTCTTTTTTTGCCTTCCATTCTGTGAGATTTGACAGATGGTGACAATAAGAAAATGAGCTGATTGTAATTACTC 2081 TCTGTGTGTTTTTTTATTGCTAGCTATCATTACCAGTTAGAATTAACATTAATTACAATTAACAATAATTTTAGGTATGG 2161 AATGTTATGATTACCTAAAGAGATGTCTCTACCTAATGAGCTCAAGTGATCCTCCCACCTCAGCCTACCAAGTAGCCAGG 2241 ACCACAGGCAAGTGCACCACCATGACTGGCTAGTTTTGTTTTTTGGTTTTTGGTTTTTGGTTTTTGGTTTTTTTTTTTTG 2321 GTTGGTTGGTTGTTTTTTACAGGCGGGGTCTCACTATATTGTCCAGGCTAGAAGAATTTTCTAATGGTCTATTACACCTC 2401 CCGTTTTGGCAAGTAAATTCAGAATAATTTTAGGTTCTTTTGTTATTCAGTAGTTTTGCAGACTTAAAAGTGTAAATTTA 2481 GAATTAGAAGATGAAGCTATAGTAGTAAGAATCTCAAGCTGAAGGGCTTTGGGGAGCCAAAGCAGCATATTAGAGCATAG 2561 GCTTGAACTTAAATCTCAGCTCAGTCACCTGCAGGACTTTAGGCACCAGTGATTTCACCCTTCTGAGCCTGTTTCTTTAT 2641 TCGTAAAATGATTATAATAATTCTTTCACAGCGTTGTGAGGATTAAGTGAAATGTGTTAAATGCCTACTACAGTAGGTGC 2721 TCAGATATTTATTTTTATTTTTTTATTATGCACATTGTTTTTCCTGCCTTTTTATGGCTGTCTAAAGTCTAGGGAAAAGG 2801 GAAGACTGGTTAATGATGAGTAGAAAAAACTTGTAAGCTAATCATTCACTGACTTATTTTCCTTCCATTTTCTGGTTTTT 2881 AAAATTAGCCACACCACAGGAAACCCACATTTTTAGATGGAAAGAGCAAGAAAATTGTGTCAGTGCTCTTAGTTATTTTC 2961 ATCTTAATGGTATAGTGAAAAGACATTGACTTGAGATGATACTAAGGAAGCTTTGGCTCACTCTCACTTGAAGAGGGGAT 3041 CTTGGTGTTGTAGTACTTGGACTGTACAAATGTTTTACTGACTTTTCTTACTGCTGTAAAGGAATCAGGCAGTTGGGTAT 3121 TGATATGTTATTTGGTGCTCTCATTCATGGCAAAGGATTTGATAAATAAAAGTTCTTTAAACACTAAAGCAAAATCAAAT 3201 GAGCAAAACTAAGGATGAAATGTAATATTCATCAGAACAAGGATCACTGAGAAAAAATATTCAGAAACAACTTTAATAAA 3281 ACCTGAATTGAAATAACTGCA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Disease | 134266.0 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
||||||
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 134266.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177604. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_6
PAR-CLIP data was present in ERX177620. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_10
PAR-CLIP data was present in ERX177628. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_6
PAR-CLIP data was present in ERX177632. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_10
PAR-CLIP data was present in ERX177616. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_6
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| CLIP-seq Support 1 for dataset GSM545216 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-124 transfection |
| Location of target site | ENST00000329271.3 | 3UTR | UACUCACAAAUCACUACCUCUGUUAUAUUGAC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000329271.3 | 3UTR | UACUCACAAAUCACUACCUCUGUUAUAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM1065670 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
| Location of target site | ENST00000329271.3 | 3UTR | UACUCACAAAUCACUACCUCUGUUAUAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000329271.3 | 3UTR | UACUCACAAAUCACUACCUCUGUUAUAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
75 hsa-miR-16-2-3p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT004488 | RARB | retinoic acid receptor beta |  |
|
|
3 | 1 | |||||
| MIRT038707 | NUCKS1 | nuclear casein kinase and cyclin dependent kinase substrate 1 | |
1 | 1 | |||||||
| MIRT057208 | PPIF | peptidylprolyl isomerase F | |
|
2 | 4 | ||||||
| MIRT058726 | RSBN1 | round spermatid basic protein 1 | |
|
2 | 8 | ||||||
| MIRT074502 | NFATC2IP | nuclear factor of activated T-cells 2 interacting protein | |
|
2 | 4 | ||||||
| MIRT081544 | ZNF431 | zinc finger protein 431 | |
|
2 | 4 | ||||||
| MIRT096893 | ERBB2IP | erbb2 interacting protein | |
|
2 | 2 | ||||||
| MIRT105124 | MYC | MYC proto-oncogene, bHLH transcription factor | |
|
2 | 2 | ||||||
| MIRT107898 | PTAR1 | protein prenyltransferase alpha subunit repeat containing 1 | |
|
2 | 4 | ||||||
| MIRT109432 | KLHL15 | kelch like family member 15 | |
|
2 | 6 | ||||||
| MIRT166742 | PAPD7 | poly(A) RNA polymerase D7, non-canonical | |
|
2 | 6 | ||||||
| MIRT171257 | YWHAG | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma | |
|
2 | 2 | ||||||
| MIRT192760 | B2M | beta-2-microglobulin | |
|
2 | 2 | ||||||
| MIRT194905 | RBBP6 | RB binding protein 6, ubiquitin ligase | |
|
2 | 8 | ||||||
| MIRT215599 | SUB1 | SUB1 homolog, transcriptional regulator | |
|
2 | 2 | ||||||
| MIRT223632 | ATP6V1C1 | ATPase H+ transporting V1 subunit C1 | |
|
2 | 4 | ||||||
| MIRT241605 | AMOTL1 | angiomotin like 1 | |
|
2 | 4 | ||||||
| MIRT291174 | SH3GLB1 | SH3 domain containing GRB2 like, endophilin B1 | |
|
2 | 2 | ||||||
| MIRT444286 | ABCG2 | ATP binding cassette subfamily G member 2 (Junior blood group) | |
|
2 | 2 | ||||||
| MIRT463285 | ZFX | zinc finger protein, X-linked | |
|
2 | 4 | ||||||
| MIRT471759 | NUS1 | NUS1 dehydrodolichyl diphosphate synthase subunit | |
|
2 | 8 | ||||||
| MIRT479611 | CDC25A | cell division cycle 25A | |
|
2 | 2 | ||||||
| MIRT481497 | ARL6IP1 | ADP ribosylation factor like GTPase 6 interacting protein 1 | |
|
2 | 8 | ||||||
| MIRT483117 | SH3BP5 | SH3 domain binding protein 5 | |
|
2 | 2 | ||||||
| MIRT502279 | GRPEL2 | GrpE like 2, mitochondrial | |
|
2 | 8 | ||||||
| MIRT507838 | CCNT1 | cyclin T1 | |
|
2 | 2 | ||||||
| MIRT508179 | MTRNR2L6 | MT-RNR2-like 6 | |
|
2 | 4 | ||||||
| MIRT510576 | UBE2D3 | ubiquitin conjugating enzyme E2 D3 | |
|
2 | 6 | ||||||
| MIRT517853 | RPS4X | ribosomal protein S4, X-linked | |
|
2 | 4 | ||||||
| MIRT521690 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | |
|
2 | 8 | ||||||
| MIRT525070 | FRK | fyn related Src family tyrosine kinase | |
|
2 | 2 | ||||||
| MIRT527082 | UBE2E3 | ubiquitin conjugating enzyme E2 E3 | |
|
2 | 2 | ||||||
| MIRT529552 | EI24 | EI24, autophagy associated transmembrane protein | |
|
2 | 2 | ||||||
| MIRT530426 | SULT1B1 | sulfotransferase family 1B member 1 | |
|
2 | 2 | ||||||
| MIRT533909 | TBC1D15 | TBC1 domain family member 15 | |
|
2 | 2 | ||||||
| MIRT536627 | IPO7 | importin 7 | |
|
2 | 2 | ||||||
| MIRT537647 | ERGIC2 | ERGIC and golgi 2 | |
|
2 | 4 | ||||||
| MIRT538512 | CLCN3 | chloride voltage-gated channel 3 | |
|
2 | 2 | ||||||
| MIRT539219 | ANP32E | acidic nuclear phosphoprotein 32 family member E | |
|
2 | 6 | ||||||
| MIRT539348 | AGO2 | argonaute 2, RISC catalytic component | |
|
2 | 4 | ||||||
| MIRT539954 | CCT4 | chaperonin containing TCP1 subunit 4 | |
|
2 | 2 | ||||||
| MIRT541208 | HOXA10 | homeobox A10 | |
|
2 | 2 | ||||||
| MIRT543216 | TMEM117 | transmembrane protein 117 | |
|
2 | 2 | ||||||
| MIRT543399 | DROSHA | drosha ribonuclease III | |
|
2 | 2 | ||||||
| MIRT546648 | RPS6KA5 | ribosomal protein S6 kinase A5 | |
|
2 | 2 | ||||||
| MIRT546852 | RAB1A | RAB1A, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT549917 | MRPS30 | mitochondrial ribosomal protein S30 | |
|
2 | 2 | ||||||
| MIRT552998 | USP46 | ubiquitin specific peptidase 46 | |
|
2 | 2 | ||||||
| MIRT555254 | PREPL | prolyl endopeptidase-like | |
|
2 | 2 | ||||||
| MIRT555956 | NRIP1 | nuclear receptor interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT557095 | HOXA9 | homeobox A9 | |
|
2 | 2 | ||||||
| MIRT561396 | TUBB2A | tubulin beta 2A class IIa | |
|
2 | 2 | ||||||
| MIRT561654 | RNF219 | ring finger protein 219 | |
|
2 | 2 | ||||||
| MIRT563101 | PABPC4L | poly(A) binding protein cytoplasmic 4 like | |
|
2 | 2 | ||||||
| MIRT565979 | RNF44 | ring finger protein 44 | |
|
2 | 2 | ||||||
| MIRT572396 | CCDC14 | coiled-coil domain containing 14 | |
|
2 | 2 | ||||||
| MIRT574400 | TM9SF3 | transmembrane 9 superfamily member 3 | |
|
2 | 2 | ||||||
| MIRT607623 | VSNL1 | visinin like 1 | |
|
2 | 2 | ||||||
| MIRT610645 | CTGF | connective tissue growth factor | |
|
2 | 2 | ||||||
| MIRT623379 | LPP | LIM domain containing preferred translocation partner in lipoma | |
|
2 | 2 | ||||||
| MIRT624687 | AR | androgen receptor | |
|
2 | 2 | ||||||
| MIRT632089 | ALDH1A2 | aldehyde dehydrogenase 1 family member A2 | |
|
2 | 2 | ||||||
| MIRT644216 | CBS | cystathionine-beta-synthase | |
|
2 | 2 | ||||||
| MIRT647841 | BID | BH3 interacting domain death agonist | |
|
2 | 2 | ||||||
| MIRT651649 | WASF2 | WAS protein family member 2 | |
|
2 | 2 | ||||||
| MIRT689064 | AGMAT | agmatinase | |
|
2 | 2 | ||||||
| MIRT698150 | TNPO1 | transportin 1 | |
|
2 | 2 | ||||||
| MIRT700516 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | |
|
2 | 2 | ||||||
| MIRT704081 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | |
|
2 | 2 | ||||||
| MIRT705970 | ACBD5 | acyl-CoA binding domain containing 5 | |
|
2 | 2 | ||||||
| MIRT715694 | COMMD3-BMI1 | COMMD3-BMI1 readthrough | |
|
2 | 2 | ||||||
| MIRT717184 | BMI1 | BMI1 proto-oncogene, polycomb ring finger | |
|
2 | 2 | ||||||
| MIRT724607 | AP3B1 | adaptor related protein complex 3 beta 1 subunit | |
|
2 | 2 | ||||||
| MIRT724854 | IGFBP5 | insulin like growth factor binding protein 5 | |
|
2 | 2 | ||||||
| MIRT725401 | LRIG2 | leucine rich repeats and immunoglobulin like domains 2 | |
|
2 | 2 | ||||||
| miRNA-Drug Associations | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|