pre-miRNA Information
pre-miRNA hsa-mir-1246   
Genomic Coordinates chr2: 176600980 - 176601052
Synonyms MIRN1246, hsa-mir-1246, MIR1246
Description Homo sapiens miR-1246 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1246
Sequence 11| AAUGGAUUUUUGGAGCAGG |29
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1489969781 2 dbSNP
rs757265617 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CTC1   
Synonyms AAF-132, AAF132, C17orf68, CRMCC, tmp494178
Description CST telomere replication complex component 1
Transcript NM_025099   
Expression
Putative miRNA Targets on CTC1
3'UTR of CTC1
(miRNA target sites are highlighted)
>CTC1|NM_025099|3'UTR
   1 CTGAACTGCAAGGATGGCCTGAGAGTCCTTCCTTGCTGAAAACCTGAAGGCCTAGGTCCTGGCTCCTCTCCCTACTTGTT
  81 CTGTGATTGAACCAAGGACTCCAGATTCACAAACTGCTACTCCACTATAATTTCCCTTCTTTGGTGTTCTGGTGCCAGCC
 161 TGCCTTGGCAAAATTGTGGCAACAGGAAATCATGGCCCTATTAATATGTCCTCTGATTGGGACAAGGCACCTGCATTCAC
 241 AGGCGGCCCTGAGCACCTGGGTTCTGACTTTGTCGCAGGAGCTGAGGGAACAAAAGACTTGCTCGCTGTGGGGTGATGGT
 321 GACAGGCCTATTGACCTGCAATGAAGCCCTCTGGTGTCATTTCTCACTGGTACTCATCTCTGGGGTCCCAGGCCTCCTGA
 401 CTCCTAGTTGTCCACCTCCTAGGAACTCCTAGTCGTTCATCATCATTTCAGCCCTTTGCCGCCAGGGCCAAAGGTGGAAA
 481 GTGATTTGGAAGAGAAGAGCTTTTCGTCCAGCAGAAGAAATGGTACCAAAATCAGTCTGTAAAGGAAGTAAATTGGGGAG
 561 TTGGCGGCAAGGCAGAGAGCATAGCTATGATGGTCTCAGTCAGTAAGGCTGGGCCCTGCAGGAAGTCAAATATGAATGCC
 641 TAGAGGTGTTCACAAGCACAAAGAAGGTGTAGGGGGAGGCAAGTGCCAGGCACAAGCAGGGGCAGGTGAGGACTCTGGGT
 721 GACTGTGCTATAGGGCCCCAGGCTACGGTTAGCCCTGTAGGTTTCCCAAGGGCCTGGCCTAAGGCAGATCCTTGATCGAT
 801 ATACCTTGAGACCAGAAGGTGCTCCGAAATCACAACCGTACAATTAGGGGATCTAGGAACAATTCTTTGGAGATACCAAT
 881 GCCTTTGGCTGGTGTTGCTGCATTTCTTTACTGGGGACTGATAGATGGAGAGGTGGAAAGATGAGCTGAGGCACATCTTT
 961 CAGAGCTACTGGGAGGCCATTTCTTCCTGGCTGTTAGGATTTGTTCGTGTTTGGGAGACCTTTAGAGCGTGGTTAAACCC
1041 ATATGTTGGGATTTATGCTGCTTTTATGGTAGCAATACCCTATATTAAGATTTGAAGTAGACCCGGAAAGTTAGTGGCCG
1121 GTTAGCTCAGTTGGTTAGAGCGTGGTGCTAATAACGCCAAGGTCGCGGGTTCGAACCCCGTACGGGCCAGTGGGTGGCTT
1201 TTTTTTGTGTGTGTTTTGTTTTCTGACCCTCTGCTGTTATCCGGAAGTTTCTACCCGGAGCCAGTTGCCTTCTGGTAACA
1281 GAATTATATTGCACCTACTGCTTCCTATTCCCTGAATCACTAGCGCTCCCGAAGGCTTGGAGGGAGGAGTCTCTGGGCAC
1361 CCGGGTGAAAGGAAGGTTCACGTGCAACCGCCGCGTCTTTTTTTCCCTGAAGCGCTTTCATGGAGGCAGATGTTTGTCAG
1441 TCAAGGGAAGTAAGAAAGGCATTGGATGAAAACGAAGCCCTAAGCCTCGTAGTCGTGGCCGAGTGGTTAAGGCGATGGAC
1521 TAGAAATCCATTGGGGTCTCCCCGCGCAGGTTCGAATCCTGCCGACTACGTCATATTTTTTTCTTCAGCATACTGACCAT
1601 ATTTCTCTCCAGGATGGGATGATCCAGTCGGCACCCTCCAAACCTCTCATCTAGGAACTCTAGAATCGAGAATTTGATTT
1681 AGAGTCTATGATTTTGGTTTGAAATCTATGATTAACGTCTTTGGACATTGAAGGAAATCCGAGGAATGGACAAGTGATGC
1761 AAGAGCCAGTTGAGTTACCAAATTAGTTCTAGAAAGATCTGAAAAAGCTCGGTCCGGGTTCCTAGCTCTATATTCTTGTA
1841 GATGAATTTCAGGAACCTTTATGGCAGCTTCGGCGCCGTGGCTTAGTTGGTTAAAGCGCCTGTCTAGTAAACAGGAGATC
1921 CTGGGTTCGAATCCCAGCGGTGCCTTTATTCAATTGAAACAGCGTGATTTTGCGGCTAAATCCACATCCTTTCATGTATT
2001 GTTTTTATATCAGAACGCGTAAGAGTTTCTGTTCTGCACTCATAGCACCCACATTTCCTGCAGAGTCAAGCTGCCACTCC
2081 CATGAGATCGCCACTCTAAAAGGTGGTTCTCTAACTTAGGGGCAGAAATGTTGCATAGGCCTAAGGGTCCTTTGCTTAAC
2161 TGATGCCACACCCCACTGGTGCAGGTGGACTGGGTCAGGCGGCCGCCCCACCCTCGATGGAAGGGGCTGCCCACCTTCCA
2241 GGCCTCTTTCTCCACCCTAGGACGTCCCCTAGAACCTGAGCCACTTTGTTTTGTTTGGCTCTTCATTATAGTTCTTTGGG
2321 TTTGGTGGCTCATAATGTTATATATATAGTATATAATATAAAAATATATATTTAAATATACAGTATTTAAAATTTGGCAC
2401 AGCTTCCAGATGCGGTCCTCTAACTGGTCTTTCACTTGCAGTTACCTCCATCCCTCTCCACCAGCGGGATGTCAGGGTAA
2481 GGAGTAAGCAGGGATCCGGCTGGCCTGGCCTGGCCTGGCACCAGGTTTCGTGCAGCAGGGTGCAGAAGGGCTGAGGCCAT
2561 GTGAACAGAGTCCAAGAAAGCATCATTCGGGAGTCGCTAGGGATCCTGGTGTGGAAGGGCAGGGCACTTTTCTGGAGCAC
2641 TGAAGCTAGGCTGGTTAAGGAAGAAATAAATGCCAGAGATAAGGCAAGAAATAGGATCTGTGAGCTCTTGGCAGGACCTA
2721 AACCTCCTTGGAAGATAGGCAGAAAGCTCTCGACACCATTCCATGGCCCACGAACCAATGTAAGATGAGCAAATGGCTTG
2801 AAGGAATTGCTACCTCCAGGTCAAGCCAGGGATGCAGCACTGCCGAGACCACGTTTGTGCCAAGCACTGGGCTGGACCCT
2881 GTGCAGAACCAAATGAACAAGGCACGTTCCCCTTTCAGCACTAACGGCACTGTAAGAACAGGGAGAAGTGGAATCTAATC
2961 TGGCCTGAGGGTAGAGGGTGATCAGCTAAGTCTGAAACACCATGTAGAAACTTGCCATGTATGGCCGGGCGCGGTGGCTC
3041 ACGCCTGTAATCCCAGCGCTTTGGGAGGCCAAGGTGGGCGGATCACGAGGTCAGGAGTTCCAGACCAGCAGCCTGGCCAA
3121 CATAGTGAAACCTGGTAACATAGTGAAACCTCGTCTCTACTAAAAATGCAAAAAATTAGCCAGGCGTGGTGGCAGGCGCC
3201 TGCAGTCCTAGCTACTTGGGAGGCTGAGGCAAGAGAATCGCTTCAACCTTGGAGGGGGGAGGAGGTGTTGTCAGCCGAGA
3281 TCGCGCCACTGCATCCCAGCCTGGGCAACAAGAGTGAAACTCCGTCTCAAAAAAATGAAATAAAATAAACGAATGATCAA
3361 AAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ggACGAGGUUUUUAGGUAa 5'
            ||  |:|:|||||||| 
Target 5' gaTGGACTAGAAATCCATt 3'
1514 - 1532 161.00 -13.90
2
miRNA  3' ggACGAGGUUUUUAGGUAa 5'
            || |:: :|||||:|| 
Target 5' ttTGGTTT-GAAATCTATg 3'
1693 - 1710 136.00 -5.70
3
miRNA  3' ggACGAGGUUUUUAGGUaa 5'
            |||  |  |||||||  
Target 5' ttTGCGGC-TAAATCCAca 3'
1969 - 1986 128.00 -8.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
326062 43 ClinVar
326061 64 ClinVar
326060 65 ClinVar
326059 207 ClinVar
326058 218 ClinVar
326057 234 ClinVar
892323 274 ClinVar
326056 275 ClinVar
326055 286 ClinVar
892322 305 ClinVar
326054 327 ClinVar
891122 384 ClinVar
891121 429 ClinVar
891120 445 ClinVar
891119 460 ClinVar
891118 474 ClinVar
891117 509 ClinVar
326053 536 ClinVar
326052 558 ClinVar
326051 631 ClinVar
890554 642 ClinVar
890553 663 ClinVar
890552 759 ClinVar
326050 797 ClinVar
890551 808 ClinVar
326049 825 ClinVar
326048 1041 ClinVar
888856 1042 ClinVar
326047 1046 ClinVar
888855 1052 ClinVar
888854 1053 ClinVar
888853 1061 ClinVar
326046 1102 ClinVar
888852 1103 ClinVar
326045 1105 ClinVar
326044 1107 ClinVar
892257 1125 ClinVar
892256 1129 ClinVar
326043 1130 ClinVar
326042 1134 ClinVar
326041 1148 ClinVar
326040 1155 ClinVar
326039 1156 ClinVar
326038 1166 ClinVar
326037 1176 ClinVar
326036 1177 ClinVar
891030 1188 ClinVar
326035 1191 ClinVar
891029 1191 ClinVar
891028 1200 ClinVar
326034 1201 ClinVar
326033 1204 ClinVar
326032 1205 ClinVar
326031 1286 ClinVar
890473 1308 ClinVar
890472 1369 ClinVar
890471 1410 ClinVar
890470 1420 ClinVar
326030 1438 ClinVar
888765 1450 ClinVar
326029 1473 ClinVar
326027 1474 ClinVar
326028 1474 ClinVar
326026 1475 ClinVar
326025 1477 ClinVar
888763 1477 ClinVar
888764 1477 ClinVar
326024 1478 ClinVar
892199 1479 ClinVar
326023 1486 ClinVar
326022 1495 ClinVar
892198 1517 ClinVar
892197 1531 ClinVar
326021 1534 ClinVar
326020 1540 ClinVar
326019 1542 ClinVar
890966 1553 ClinVar
326018 1565 ClinVar
326017 1569 ClinVar
326016 1573 ClinVar
890965 1578 ClinVar
326015 1598 ClinVar
890964 1600 ClinVar
326014 1603 ClinVar
890963 1603 ClinVar
890962 1630 ClinVar
326013 1663 ClinVar
890403 1668 ClinVar
890402 1711 ClinVar
326012 1792 ClinVar
326011 1807 ClinVar
890401 1807 ClinVar
326009 1844 ClinVar
326010 1844 ClinVar
326008 1852 ClinVar
326007 1853 ClinVar
326006 1856 ClinVar
326005 1857 ClinVar
326004 1861 ClinVar
888701 1867 ClinVar
888700 1868 ClinVar
888699 1900 ClinVar
892139 1913 ClinVar
326003 1930 ClinVar
892138 1933 ClinVar
326002 1936 ClinVar
326001 1939 ClinVar
326000 1940 ClinVar
325999 1960 ClinVar
892137 1964 ClinVar
892136 1994 ClinVar
325998 1998 ClinVar
890906 2006 ClinVar
325997 2007 ClinVar
325996 2013 ClinVar
890905 2070 ClinVar
325995 2087 ClinVar
890904 2090 ClinVar
325994 2106 ClinVar
325993 2115 ClinVar
890341 2146 ClinVar
890340 2242 ClinVar
325992 2296 ClinVar
890339 2337 ClinVar
325991 2338 ClinVar
325990 2353 ClinVar
325989 2372 ClinVar
890338 2425 ClinVar
890337 2498 ClinVar
888641 2530 ClinVar
888640 2536 ClinVar
325988 2685 ClinVar
888639 2725 ClinVar
325987 2784 ClinVar
888638 2842 ClinVar
888637 2848 ClinVar
888636 2926 ClinVar
892093 3079 ClinVar
325986 3186 ClinVar
210793 3198 ClinVar
325985 3231 ClinVar
892092 3255 ClinVar
COSN30185317 3 COSMIC
COSN30183189 11 COSMIC
COSN30153484 46 COSMIC
COSN30473992 96 COSMIC
COSN31600154 139 COSMIC
COSN28841399 168 COSMIC
COSN6662050 275 COSMIC
COSN26806381 506 COSMIC
COSN6662049 631 COSMIC
COSN1730421 675 COSMIC
COSN6662048 825 COSMIC
COSN7457457 870 COSMIC
COSN19414774 1166 COSMIC
COSN21388139 1205 COSMIC
COSN1730420 1287 COSMIC
COSN6662047 1450 COSMIC
COSN7457456 1474 COSMIC
COSN24576132 1484 COSMIC
COSN6662046 1960 COSMIC
COSN8395139 1981 COSMIC
COSN1202978 1987 COSMIC
COSN24294752 2019 COSMIC
COSN6662044 2338 COSMIC
COSN8247054 2703 COSMIC
COSN14592192 3087 COSMIC
COSN9674941 3119 COSMIC
COSN17537659 3197 COSMIC
rs3027247 631 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs761493927 3 dbSNP
rs781050870 6 dbSNP
rs1480741548 8 dbSNP
rs938330252 12 dbSNP
rs754749578 14 dbSNP
rs1261713832 18 dbSNP
rs200134999 19 dbSNP
rs780090929 22 dbSNP
rs1283095456 23 dbSNP
rs1235614129 25 dbSNP
rs982652908 26 dbSNP
rs758386429 27 dbSNP
rs749988882 31 dbSNP
rs931194879 32 dbSNP
rs764641685 34 dbSNP
rs1408090806 41 dbSNP
rs3027245 43 dbSNP
rs753366370 49 dbSNP
rs949148584 51 dbSNP
rs1427019545 53 dbSNP
rs975627976 54 dbSNP
rs886053609 64 dbSNP
rs886053608 65 dbSNP
rs116523089 71 dbSNP
rs545385816 72 dbSNP
rs758988824 74 dbSNP
rs908765580 90 dbSNP
rs984798142 94 dbSNP
rs1345289615 107 dbSNP
rs1224436521 112 dbSNP
rs1281390172 120 dbSNP
rs1266188059 124 dbSNP
rs1215680183 137 dbSNP
rs952873045 170 dbSNP
rs1207964901 185 dbSNP
rs998865383 197 dbSNP
rs1195467708 202 dbSNP
rs774013108 207 dbSNP
rs975463272 210 dbSNP
rs1199826981 211 dbSNP
rs1427207175 212 dbSNP
rs965475589 214 dbSNP
rs1019557336 217 dbSNP
rs886053607 218 dbSNP
rs1421531547 223 dbSNP
rs1301532464 230 dbSNP
rs768210527 232 dbSNP
rs570408909 234 dbSNP
rs775290832 241 dbSNP
rs556183031 244 dbSNP
rs749014337 245 dbSNP
rs1339550155 247 dbSNP
rs1056804143 249 dbSNP
rs1032218826 271 dbSNP
rs533383004 274 dbSNP
rs3027246 275 dbSNP
rs905017468 277 dbSNP
rs886864315 281 dbSNP
rs886053606 286 dbSNP
rs1221817285 287 dbSNP
rs1248283474 296 dbSNP
rs1385734659 301 dbSNP
rs1176563768 302 dbSNP
rs1408540548 303 dbSNP
rs1045340429 304 dbSNP
rs1161700028 305 dbSNP
rs183335476 308 dbSNP
rs7502325 309 dbSNP
rs1013322644 310 dbSNP
rs896266098 310 dbSNP
rs1353185741 311 dbSNP
rs930998795 319 dbSNP
rs569217905 327 dbSNP
rs540622412 330 dbSNP
rs1312338688 338 dbSNP
rs769646982 341 dbSNP
rs1368145817 354 dbSNP
rs1291509875 356 dbSNP
rs1184388810 358 dbSNP
rs3180911 363 dbSNP
rs1446531627 368 dbSNP
rs1203509846 370 dbSNP
rs1238738237 373 dbSNP
rs942509695 374 dbSNP
rs1459076822 380 dbSNP
rs912438390 384 dbSNP
rs1187998198 385 dbSNP
rs1473161714 403 dbSNP
rs1165231373 409 dbSNP
rs192853005 415 dbSNP
rs781123007 416 dbSNP
rs1171502690 421 dbSNP
rs1286225682 429 dbSNP
rs534273760 432 dbSNP
rs954743519 434 dbSNP
rs1355322841 435 dbSNP
rs924692776 435 dbSNP
rs912620321 438 dbSNP
rs1247632086 443 dbSNP
rs977398110 445 dbSNP
rs1353118474 447 dbSNP
rs968763033 449 dbSNP
rs755039235 451 dbSNP
rs1319735265 452 dbSNP
rs371544637 460 dbSNP
rs1032790330 461 dbSNP
rs979369352 462 dbSNP
rs551515663 463 dbSNP
rs1435163487 465 dbSNP
rs1240600582 466 dbSNP
rs1475235717 468 dbSNP
rs139392724 474 dbSNP
rs959116904 492 dbSNP
rs1320803418 495 dbSNP
rs1403976026 499 dbSNP
rs969733995 503 dbSNP
rs780223144 505 dbSNP
rs1390394757 506 dbSNP
rs1035785804 508 dbSNP
rs758527781 509 dbSNP
rs750723681 512 dbSNP
rs1388534310 514 dbSNP
rs1023466760 531 dbSNP
rs886834837 534 dbSNP
rs533538191 536 dbSNP
rs566169763 553 dbSNP
rs112446369 558 dbSNP
rs368781257 559 dbSNP
rs187397257 561 dbSNP
rs887436743 565 dbSNP
rs942667983 566 dbSNP
rs931577434 569 dbSNP
rs1450826471 570 dbSNP
rs757709073 580 dbSNP
rs900115701 580 dbSNP
rs1269419548 581 dbSNP
rs1408947720 581 dbSNP
rs528881420 595 dbSNP
rs944189165 605 dbSNP
rs764726519 608 dbSNP
rs912745965 610 dbSNP
rs1199087673 611 dbSNP
rs1378550459 614 dbSNP
rs988173587 615 dbSNP
rs1339696727 616 dbSNP
rs1382210797 623 dbSNP
rs3027247 631 dbSNP
rs1298433610 637 dbSNP
rs1362025314 638 dbSNP
rs1402899102 640 dbSNP
rs1282456436 642 dbSNP
rs935171369 645 dbSNP
rs924663381 651 dbSNP
rs773709049 653 dbSNP
rs1235416824 654 dbSNP
rs1277689718 658 dbSNP
rs1350063726 661 dbSNP
rs183099496 663 dbSNP
rs914610714 668 dbSNP
rs1434850690 671 dbSNP
rs991903758 673 dbSNP
rs1268574623 676 dbSNP
rs529966106 680 dbSNP
rs1435263324 687 dbSNP
rs969423433 696 dbSNP
rs1363656574 697 dbSNP
rs1304190342 702 dbSNP
rs1023517769 706 dbSNP
rs958945752 713 dbSNP
rs1368984156 715 dbSNP
rs1168147136 722 dbSNP
rs1422408387 728 dbSNP
rs867049848 730 dbSNP
rs546719943 738 dbSNP
rs1421662951 741 dbSNP
rs1014793594 746 dbSNP
rs1326775427 747 dbSNP
rs1004616202 748 dbSNP
rs1240756360 752 dbSNP
rs1477691412 757 dbSNP
rs1311606457 760 dbSNP
rs765967683 767 dbSNP
rs1429882956 773 dbSNP
rs562823828 777 dbSNP
rs951926103 779 dbSNP
rs1489672086 782 dbSNP
rs1002966759 787 dbSNP
rs1194391443 787 dbSNP
rs142486253 797 dbSNP
rs1181021092 798 dbSNP
rs1250642167 802 dbSNP
rs867351909 803 dbSNP
rs1239538081 805 dbSNP
rs1442228646 805 dbSNP
rs1204707319 811 dbSNP
rs1439047281 814 dbSNP
rs1025329195 815 dbSNP
rs1368617432 818 dbSNP
rs995305792 823 dbSNP
rs191057012 824 dbSNP
rs3027248 825 dbSNP
rs777998896 837 dbSNP
rs1447507590 838 dbSNP
rs900197929 843 dbSNP
rs1218112079 845 dbSNP
rs565232814 848 dbSNP
rs1017905415 849 dbSNP
rs1039906260 851 dbSNP
rs1313736660 855 dbSNP
rs769523278 858 dbSNP
rs891025696 865 dbSNP
rs1251148901 874 dbSNP
rs1284444277 876 dbSNP
rs1051022979 877 dbSNP
rs1241777710 881 dbSNP
rs1459596687 884 dbSNP
rs1348958443 888 dbSNP
rs577626164 894 dbSNP
rs1052593476 895 dbSNP
rs1443288625 901 dbSNP
rs578206320 904 dbSNP
rs935141973 911 dbSNP
rs902373537 915 dbSNP
rs935422394 916 dbSNP
rs182306226 929 dbSNP
rs758415557 930 dbSNP
rs947458282 947 dbSNP
rs552752956 948 dbSNP
rs948026035 949 dbSNP
rs1332330901 954 dbSNP
rs1303552273 967 dbSNP
rs544467350 970 dbSNP
rs914642381 973 dbSNP
rs1277794890 981 dbSNP
rs1341539082 983 dbSNP
rs960635783 984 dbSNP
rs867247445 987 dbSNP
rs907704887 988 dbSNP
rs1413949745 990 dbSNP
rs991480045 993 dbSNP
rs937354882 996 dbSNP
rs1429942192 1003 dbSNP
rs371018652 1006 dbSNP
rs1178439524 1009 dbSNP
rs928877310 1011 dbSNP
rs555296895 1017 dbSNP
rs1203016851 1020 dbSNP
rs1261931452 1021 dbSNP
rs1471494974 1025 dbSNP
rs540773140 1026 dbSNP
rs1195510673 1027 dbSNP
rs981683396 1028 dbSNP
rs534044520 1032 dbSNP
rs573278994 1033 dbSNP
rs1410866994 1038 dbSNP
rs1432566219 1039 dbSNP
rs951545971 1040 dbSNP
rs148405704 1041 dbSNP
rs974655494 1042 dbSNP
rs542320822 1043 dbSNP
rs191080822 1045 dbSNP
rs550911189 1046 dbSNP
rs186230926 1048 dbSNP
rs568070375 1049 dbSNP
rs1488438733 1050 dbSNP
rs890826122 1051 dbSNP
rs201297846 1052 dbSNP
rs1158073985 1053 dbSNP
rs1000063340 1055 dbSNP
rs1306809674 1056 dbSNP
rs999485070 1058 dbSNP
rs146194728 1059 dbSNP
rs1043524842 1060 dbSNP
rs1224664068 1061 dbSNP
rs1240025210 1061 dbSNP
rs573261085 1062 dbSNP
rs570505368 1064 dbSNP
rs946558350 1066 dbSNP
rs561297505 1069 dbSNP
rs1241947532 1071 dbSNP
rs181379019 1071 dbSNP
rs189822939 1072 dbSNP
rs1248407569 1073 dbSNP
rs1338628087 1075 dbSNP
rs951946155 1077 dbSNP
rs1177926912 1078 dbSNP
rs529433541 1081 dbSNP
rs1238930378 1082 dbSNP
rs1056311504 1086 dbSNP
rs937323657 1091 dbSNP
rs920471204 1092 dbSNP
rs928679335 1093 dbSNP
rs1455634527 1098 dbSNP
rs561057139 1100 dbSNP
rs930194946 1101 dbSNP
rs3027249 1102 dbSNP
rs75272219 1103 dbSNP
rs181917497 1104 dbSNP
rs141632364 1105 dbSNP
rs1444722126 1106 dbSNP
rs573286497 1107 dbSNP
rs955024454 1108 dbSNP
rs139880610 1109 dbSNP
rs34547632 1110 dbSNP
rs545945504 1110 dbSNP
rs1230895650 1111 dbSNP
rs145994242 1112 dbSNP
rs886457200 1114 dbSNP
rs575511953 1115 dbSNP
rs746028426 1116 dbSNP
rs974582473 1117 dbSNP
rs911603006 1118 dbSNP
rs1278083858 1119 dbSNP
rs1010725751 1120 dbSNP
rs1443064785 1121 dbSNP
rs987200385 1122 dbSNP
rs894994082 1123 dbSNP
rs1383787744 1124 dbSNP
rs779298230 1125 dbSNP
rs189581070 1126 dbSNP
rs1361234807 1128 dbSNP
rs370571497 1129 dbSNP
rs375962823 1130 dbSNP
rs907305868 1133 dbSNP
rs754222087 1134 dbSNP
rs1347836110 1135 dbSNP
rs1335814090 1136 dbSNP
rs1022877026 1137 dbSNP
rs1358177237 1137 dbSNP
rs1162690553 1138 dbSNP
rs766778840 1138 dbSNP
rs1424966594 1140 dbSNP
rs929998502 1141 dbSNP
rs1386687569 1143 dbSNP
rs918818143 1144 dbSNP
rs1448311008 1145 dbSNP
rs1261670412 1146 dbSNP
rs552721293 1147 dbSNP
rs534594967 1148 dbSNP
rs570318149 1149 dbSNP
rs1450174750 1152 dbSNP
rs1222193571 1154 dbSNP
rs1003660073 1155 dbSNP
rs886053605 1155 dbSNP
rs538807522 1156 dbSNP
rs1047764411 1157 dbSNP
rs1175024155 1157 dbSNP
rs1226314084 1157 dbSNP
rs552270298 1158 dbSNP
rs530477782 1159 dbSNP
rs899048491 1160 dbSNP
rs1438497402 1161 dbSNP
rs578156280 1161 dbSNP
rs911422015 1162 dbSNP
rs985201985 1163 dbSNP
rs955066686 1164 dbSNP
rs922362774 1165 dbSNP
rs753309673 1166 dbSNP
rs761442047 1167 dbSNP
rs1177306792 1168 dbSNP
rs987167833 1168 dbSNP
rs1235887114 1169 dbSNP
rs1405300326 1170 dbSNP
rs1367090243 1172 dbSNP
rs1365145954 1176 dbSNP
rs149513613 1176 dbSNP
rs886053604 1177 dbSNP
rs550753296 1178 dbSNP
rs762540557 1179 dbSNP
rs1309451542 1180 dbSNP
rs553355755 1180 dbSNP
rs1244290596 1181 dbSNP
rs991086142 1181 dbSNP
rs959516640 1182 dbSNP
rs959228366 1183 dbSNP
rs1033896632 1184 dbSNP
rs1003628667 1186 dbSNP
rs950866071 1187 dbSNP
rs562025086 1188 dbSNP
rs907273380 1189 dbSNP
rs1045808514 1190 dbSNP
rs540304901 1191 dbSNP
rs1395722984 1192 dbSNP
rs890268089 1193 dbSNP
rs1490603705 1194 dbSNP
rs1051586051 1196 dbSNP
rs934397296 1197 dbSNP
rs897173719 1198 dbSNP
rs1422616395 1199 dbSNP
rs528503408 1199 dbSNP
rs80097010 1200 dbSNP
rs886053603 1201 dbSNP
rs1377453951 1203 dbSNP
rs886053602 1204 dbSNP
rs183725401 1205 dbSNP
rs1341518568 1206 dbSNP
rs934158567 1206 dbSNP
rs1216889632 1207 dbSNP
rs558357627 1207 dbSNP
rs1231825209 1208 dbSNP
rs1309940883 1208 dbSNP
rs1280388375 1209 dbSNP
rs750030684 1210 dbSNP
rs1486470680 1211 dbSNP
rs922331952 1212 dbSNP
rs1223919421 1215 dbSNP
rs763592268 1215 dbSNP
rs982269968 1215 dbSNP
rs1347101374 1216 dbSNP
rs977858891 1217 dbSNP
rs1305799033 1219 dbSNP
rs62063111 1223 dbSNP
rs914924898 1225 dbSNP
rs995344086 1227 dbSNP
rs989169696 1228 dbSNP
rs1017582579 1229 dbSNP
rs868470035 1230 dbSNP
rs1418173925 1231 dbSNP
rs1158260415 1233 dbSNP
rs1361589825 1235 dbSNP
rs1299428974 1243 dbSNP
rs1292312548 1244 dbSNP
rs1367575705 1253 dbSNP
rs542021510 1255 dbSNP
rs1007429039 1267 dbSNP
rs1303592423 1275 dbSNP
rs959512098 1276 dbSNP
rs1237520220 1280 dbSNP
rs1033576472 1281 dbSNP
rs886053601 1286 dbSNP
rs1317328133 1291 dbSNP
rs1404574350 1294 dbSNP
rs1237059816 1295 dbSNP
rs762379967 1301 dbSNP
rs574820085 1308 dbSNP
rs1194187047 1312 dbSNP
rs1255026308 1319 dbSNP
rs1437844381 1321 dbSNP
rs1178263571 1322 dbSNP
rs1381110428 1324 dbSNP
rs1176275210 1330 dbSNP
rs1480974933 1332 dbSNP
rs1349657925 1340 dbSNP
rs1328441377 1351 dbSNP
rs1372540108 1360 dbSNP
rs1443884228 1362 dbSNP
rs1024326661 1363 dbSNP
rs994701177 1364 dbSNP
rs150798403 1369 dbSNP
rs1017317171 1372 dbSNP
rs1287554934 1375 dbSNP
rs764903513 1379 dbSNP
rs1251480693 1384 dbSNP
rs775445493 1387 dbSNP
rs1274900798 1388 dbSNP
rs1456528369 1389 dbSNP
rs903031726 1390 dbSNP
rs1233493837 1392 dbSNP
rs1471318056 1394 dbSNP
rs534584342 1396 dbSNP
rs761494015 1397 dbSNP
rs1424689169 1405 dbSNP
rs890004086 1405 dbSNP
rs1262450985 1406 dbSNP
rs1050031259 1407 dbSNP
rs577589673 1408 dbSNP
rs1325581624 1409 dbSNP
rs570429563 1410 dbSNP
rs1238029005 1411 dbSNP
rs901380645 1412 dbSNP
rs558228503 1413 dbSNP
rs1197929192 1414 dbSNP
rs945084729 1415 dbSNP
rs1393814666 1417 dbSNP
rs1208282050 1418 dbSNP
rs371126383 1419 dbSNP
rs533674362 1420 dbSNP
rs1419629243 1421 dbSNP
rs1411091035 1422 dbSNP
rs1331828978 1423 dbSNP
rs1358169530 1424 dbSNP
rs937705801 1424 dbSNP
rs1470622773 1426 dbSNP
rs566108708 1427 dbSNP
rs1270625341 1428 dbSNP
rs372608165 1430 dbSNP
rs970534043 1431 dbSNP
rs1277971838 1432 dbSNP
rs1348924002 1435 dbSNP
rs1261558261 1436 dbSNP
rs573613959 1436 dbSNP
rs141383858 1438 dbSNP
rs973494054 1448 dbSNP
rs3027250 1450 dbSNP
rs961723391 1451 dbSNP
rs1244296857 1468 dbSNP
rs1017549942 1472 dbSNP
rs1170350821 1473 dbSNP
rs377086928 1473 dbSNP
rs78517666 1474 dbSNP
rs745973862 1475 dbSNP
rs1318916061 1476 dbSNP
rs112336268 1477 dbSNP
rs146427367 1478 dbSNP
rs796651282 1479 dbSNP
rs749576566 1480 dbSNP
rs1198754824 1481 dbSNP
rs945583579 1482 dbSNP
rs563756210 1483 dbSNP
rs542309190 1484 dbSNP
rs1053570811 1485 dbSNP
rs574706247 1486 dbSNP
rs926331988 1487 dbSNP
rs548364566 1488 dbSNP
rs865913194 1489 dbSNP
rs142420278 1490 dbSNP
rs753090628 1491 dbSNP
rs1307381329 1492 dbSNP
rs541328828 1493 dbSNP
rs1376505536 1494 dbSNP
rs886053600 1495 dbSNP
rs1316798758 1497 dbSNP
rs972276272 1497 dbSNP
rs963269028 1499 dbSNP
rs909936817 1500 dbSNP
rs532198935 1502 dbSNP
rs1468555536 1503 dbSNP
rs974013572 1504 dbSNP
rs984259796 1505 dbSNP
rs942209408 1506 dbSNP
rs1182067259 1508 dbSNP
rs1365339106 1510 dbSNP
rs954019032 1511 dbSNP
rs1446477162 1512 dbSNP
rs192193049 1513 dbSNP
rs571455694 1514 dbSNP
rs1329441804 1515 dbSNP
rs1395843589 1516 dbSNP
rs998188449 1517 dbSNP
rs779091221 1518 dbSNP
rs1233003363 1519 dbSNP
rs1339105759 1519 dbSNP
rs189553549 1520 dbSNP
rs757866349 1521 dbSNP
rs1358336426 1523 dbSNP
rs1252179719 1524 dbSNP
rs1440512264 1525 dbSNP
rs528569900 1525 dbSNP
rs893998442 1527 dbSNP
rs1168374955 1528 dbSNP
rs977364976 1529 dbSNP
rs1021551937 1530 dbSNP
rs558571255 1531 dbSNP
rs1313940858 1533 dbSNP
rs1034072979 1534 dbSNP
rs561385282 1534 dbSNP
rs1306445278 1537 dbSNP
rs1002652894 1538 dbSNP
rs575769594 1538 dbSNP
rs755418655 1540 dbSNP
rs554261837 1541 dbSNP
rs886053599 1542 dbSNP
rs919160398 1543 dbSNP
rs1036303703 1544 dbSNP
rs1434397163 1545 dbSNP
rs1050454758 1546 dbSNP
rs1398500084 1547 dbSNP
rs764778308 1547 dbSNP
rs1426639457 1549 dbSNP
rs1417384736 1550 dbSNP
rs909079702 1552 dbSNP
rs986375644 1553 dbSNP
rs1368137195 1554 dbSNP
rs1233112186 1555 dbSNP
rs761442327 1555 dbSNP
rs1349808372 1556 dbSNP
rs1197051184 1557 dbSNP
rs923291998 1558 dbSNP
rs535917012 1559 dbSNP
rs976720408 1560 dbSNP
rs868757497 1561 dbSNP
rs1188186571 1562 dbSNP
rs754398691 1563 dbSNP
rs1021606951 1564 dbSNP
rs1435716715 1565 dbSNP
rs886053598 1565 dbSNP
rs1009861705 1566 dbSNP
rs1455862293 1567 dbSNP
rs1292221722 1568 dbSNP
rs138405975 1569 dbSNP
rs1032479280 1570 dbSNP
rs1221712383 1570 dbSNP
rs1306093552 1571 dbSNP
rs1002332948 1572 dbSNP
rs546867578 1573 dbSNP
rs1046158119 1574 dbSNP
rs1013184422 1575 dbSNP
rs530934469 1576 dbSNP
rs1036679557 1577 dbSNP
rs535373058 1578 dbSNP
rs1394452175 1579 dbSNP
rs373660920 1582 dbSNP
rs898178309 1583 dbSNP
rs994199215 1583 dbSNP
rs536347719 1584 dbSNP
rs1037886293 1585 dbSNP
rs767456704 1587 dbSNP
rs1006454572 1588 dbSNP
rs1334122961 1591 dbSNP
rs1328322693 1593 dbSNP
rs887692813 1595 dbSNP
rs565609642 1596 dbSNP
rs886053597 1598 dbSNP
rs1050245866 1599 dbSNP
rs756474718 1599 dbSNP
rs751150794 1600 dbSNP
rs1410565854 1601 dbSNP
rs1186298837 1602 dbSNP
rs763671822 1603 dbSNP
rs886053596 1604 dbSNP
rs1398575796 1605 dbSNP
rs1174113467 1606 dbSNP
rs931815798 1609 dbSNP
rs933500736 1612 dbSNP
rs1407673752 1620 dbSNP
rs1169337461 1627 dbSNP
rs921336144 1629 dbSNP
rs77202978 1630 dbSNP
rs1443885483 1635 dbSNP
rs1310919882 1636 dbSNP
rs1354573239 1639 dbSNP
rs1415341886 1640 dbSNP
rs923313721 1644 dbSNP
rs1337554899 1649 dbSNP
rs1214110165 1651 dbSNP
rs976857663 1653 dbSNP
rs1201305747 1657 dbSNP
rs759593428 1662 dbSNP
rs552635622 1663 dbSNP
rs114198389 1668 dbSNP
rs988548208 1670 dbSNP
rs958278543 1672 dbSNP
rs1190734772 1687 dbSNP
rs914607612 1688 dbSNP
rs1475362549 1692 dbSNP
rs1204639118 1696 dbSNP
rs1438991203 1701 dbSNP
rs1033019140 1708 dbSNP
rs563822041 1711 dbSNP
rs1213138172 1712 dbSNP
rs376077043 1723 dbSNP
rs1171301657 1729 dbSNP
rs927102898 1733 dbSNP
rs547404282 1748 dbSNP
rs1314461592 1751 dbSNP
rs971257973 1754 dbSNP
rs969560298 1760 dbSNP
rs1264204915 1761 dbSNP
rs1024674941 1768 dbSNP
rs1221265421 1770 dbSNP
rs1232373074 1778 dbSNP
rs993942478 1781 dbSNP
rs1349077137 1786 dbSNP
rs1213530900 1789 dbSNP
rs886053595 1792 dbSNP
rs1282560028 1793 dbSNP
rs1447002315 1796 dbSNP
rs771198997 1798 dbSNP
rs1279136082 1802 dbSNP
rs867831505 1803 dbSNP
rs1006423678 1804 dbSNP
rs3027251 1807 dbSNP
rs796844671 1809 dbSNP
rs1382489637 1810 dbSNP
rs1050640889 1812 dbSNP
rs1014559157 1813 dbSNP
rs578097661 1816 dbSNP
rs748578956 1818 dbSNP
rs902025623 1820 dbSNP
rs1372052691 1822 dbSNP
rs1006313592 1823 dbSNP
rs1042181900 1826 dbSNP
rs946176444 1828 dbSNP
rs893125516 1830 dbSNP
rs1206249332 1835 dbSNP
rs887678388 1836 dbSNP
rs1178369088 1838 dbSNP
rs1050357501 1839 dbSNP
rs931789637 1841 dbSNP
rs1251828658 1842 dbSNP
rs1398694512 1843 dbSNP
rs3027252 1844 dbSNP
rs530097865 1847 dbSNP
rs949894182 1848 dbSNP
rs1325387053 1850 dbSNP
rs1395297136 1851 dbSNP
rs559541027 1852 dbSNP
rs540866407 1853 dbSNP
rs577097330 1854 dbSNP
rs752115178 1855 dbSNP
rs145845338 1856 dbSNP
rs886053594 1857 dbSNP
rs543282654 1858 dbSNP
rs988128139 1859 dbSNP
rs936683970 1860 dbSNP
rs868663416 1861 dbSNP
rs1029174066 1862 dbSNP
rs575656418 1863 dbSNP
rs969528226 1864 dbSNP
rs554098320 1865 dbSNP
rs992295409 1866 dbSNP
rs961793089 1867 dbSNP
rs535981109 1868 dbSNP
rs1005867893 1869 dbSNP
rs1451961685 1870 dbSNP
rs572040612 1871 dbSNP
rs1375961652 1872 dbSNP
rs553556158 1874 dbSNP
rs1054545715 1875 dbSNP
rs534886838 1876 dbSNP
rs776718938 1877 dbSNP
rs1344314488 1878 dbSNP
rs1276528594 1880 dbSNP
rs996133128 1882 dbSNP
rs901762196 1885 dbSNP
rs1425466908 1886 dbSNP
rs1040195924 1887 dbSNP
rs1372561188 1894 dbSNP
rs1462697803 1896 dbSNP
rs1010496365 1897 dbSNP
rs570989556 1898 dbSNP
rs1434435569 1899 dbSNP
rs1052969467 1902 dbSNP
rs756772692 1903 dbSNP
rs753382618 1904 dbSNP
rs1292895284 1905 dbSNP
rs1325296362 1907 dbSNP
rs1228691126 1908 dbSNP
rs1276289294 1909 dbSNP
rs1209960009 1910 dbSNP
rs1345500478 1910 dbSNP
rs1280771892 1911 dbSNP
rs925328536 1911 dbSNP
rs763742685 1912 dbSNP
rs1045049738 1913 dbSNP
rs1203249227 1913 dbSNP
rs1429157763 1914 dbSNP
rs763836924 1914 dbSNP
rs1453968142 1915 dbSNP
rs1174732433 1916 dbSNP
rs1361247506 1916 dbSNP
rs1288732541 1917 dbSNP
rs1383660524 1918 dbSNP
rs1162411379 1919 dbSNP
rs1299155487 1920 dbSNP
rs1233088413 1921 dbSNP
rs1368390167 1921 dbSNP
rs1313662135 1922 dbSNP
rs1444661948 1923 dbSNP
rs1465272730 1924 dbSNP
rs948274937 1925 dbSNP
rs1184039097 1928 dbSNP
rs1251212071 1929 dbSNP
rs1468250710 1930 dbSNP
rs780992571 1930 dbSNP
rs1427704487 1931 dbSNP
rs1417663807 1932 dbSNP
rs752512394 1933 dbSNP
rs559314337 1934 dbSNP
rs537693453 1935 dbSNP
rs941195705 1935 dbSNP
rs767476369 1936 dbSNP
rs1293710378 1937 dbSNP
rs984981225 1938 dbSNP
rs886053593 1939 dbSNP
rs1245364429 1940 dbSNP
rs886053592 1940 dbSNP
rs1360180356 1941 dbSNP
rs770796328 1942 dbSNP
rs976738676 1944 dbSNP
rs1479769796 1945 dbSNP
rs1028622506 1947 dbSNP
rs995849407 1948 dbSNP
rs965920802 1949 dbSNP
rs1018889768 1952 dbSNP
rs1010050845 1954 dbSNP
rs570074115 1956 dbSNP
rs891660367 1959 dbSNP
rs11650309 1960 dbSNP
rs775346688 1961 dbSNP
rs149848843 1962 dbSNP
rs903956424 1963 dbSNP
rs1167690919 1964 dbSNP
rs1427315698 1965 dbSNP
rs566020130 1966 dbSNP
rs1291320361 1967 dbSNP
rs1354929066 1970 dbSNP
rs1045017167 1973 dbSNP
rs905842376 1974 dbSNP
rs1045767825 1977 dbSNP
rs948075624 1982 dbSNP
rs1204082430 1983 dbSNP
rs1478976741 1984 dbSNP
rs1267050869 1985 dbSNP
rs1014578407 1986 dbSNP
rs774432083 1987 dbSNP
rs1221937572 1988 dbSNP
rs1473393331 1989 dbSNP
rs918150796 1991 dbSNP
rs897034375 1994 dbSNP
rs1057147920 1995 dbSNP
rs141982483 1998 dbSNP
rs940861856 1998 dbSNP
rs909750144 1999 dbSNP
rs1202500201 2000 dbSNP
rs1049450711 2001 dbSNP
rs1448670398 2003 dbSNP
rs1306887424 2005 dbSNP
rs57270818 2006 dbSNP
rs886053591 2007 dbSNP
rs951741216 2012 dbSNP
rs886053590 2013 dbSNP
rs1209227289 2017 dbSNP
rs377142303 2018 dbSNP
rs921692021 2019 dbSNP
rs878901998 2020 dbSNP
rs1405243801 2021 dbSNP
rs754093147 2021 dbSNP
rs1443556191 2025 dbSNP
rs1212785361 2026 dbSNP
rs564713162 2027 dbSNP
rs1474118977 2029 dbSNP
rs1187565258 2032 dbSNP
rs1390457936 2033 dbSNP
rs1295989564 2039 dbSNP
rs965723150 2043 dbSNP
rs1354485504 2046 dbSNP
rs1018858580 2049 dbSNP
rs989481335 2050 dbSNP
rs184572690 2063 dbSNP
rs1336043915 2064 dbSNP
rs772156574 2070 dbSNP
rs1033199936 2071 dbSNP
rs1001614237 2072 dbSNP
rs1232353899 2081 dbSNP
rs75503577 2087 dbSNP
rs1434033239 2089 dbSNP
rs1033226989 2090 dbSNP
rs1000047631 2097 dbSNP
rs1024816636 2103 dbSNP
rs903925098 2105 dbSNP
rs192934640 2106 dbSNP
rs1251823373 2109 dbSNP
rs187344168 2115 dbSNP
rs1466025099 2117 dbSNP
rs1191286010 2118 dbSNP
rs897162360 2119 dbSNP
rs1321321468 2120 dbSNP
rs1036940160 2123 dbSNP
rs896525431 2133 dbSNP
rs1056714829 2135 dbSNP
rs1456628790 2138 dbSNP
rs1160085167 2139 dbSNP
rs1223869516 2141 dbSNP
rs1390842184 2144 dbSNP
rs773269538 2146 dbSNP
rs1304348149 2149 dbSNP
rs1049583204 2157 dbSNP
rs932495733 2166 dbSNP
rs922338146 2170 dbSNP
rs1041209885 2171 dbSNP
rs1229539726 2174 dbSNP
rs1268209994 2176 dbSNP
rs1330528020 2177 dbSNP
rs1211478225 2188 dbSNP
rs1373339403 2194 dbSNP
rs1332784389 2197 dbSNP
rs1451802557 2200 dbSNP
rs1467695995 2202 dbSNP
rs141122520 2205 dbSNP
rs1176210839 2207 dbSNP
rs1466837714 2214 dbSNP
rs1472227698 2214 dbSNP
rs913586316 2215 dbSNP
rs1049664704 2217 dbSNP
rs1414309189 2222 dbSNP
rs115803038 2231 dbSNP
rs926099334 2238 dbSNP
rs868833357 2242 dbSNP
rs779382456 2244 dbSNP
rs1410982660 2246 dbSNP
rs974516287 2252 dbSNP
rs1354083462 2253 dbSNP
rs1024366650 2254 dbSNP
rs944354414 2255 dbSNP
rs961384917 2260 dbSNP
rs1211198066 2264 dbSNP
rs911510456 2266 dbSNP
rs1182849674 2271 dbSNP
rs988504515 2283 dbSNP
rs1005417492 2286 dbSNP
rs1258585301 2288 dbSNP
rs888330651 2294 dbSNP
rs777042904 2296 dbSNP
rs1473898989 2300 dbSNP
rs1032948479 2304 dbSNP
rs1166308043 2310 dbSNP
rs1370354866 2314 dbSNP
rs1317124151 2320 dbSNP
rs978547710 2324 dbSNP
rs1430850327 2328 dbSNP
rs1310220660 2329 dbSNP
rs1374238855 2330 dbSNP
rs1310874412 2331 dbSNP
rs1311396995 2337 dbSNP
rs1395955232 2337 dbSNP
rs8078338 2338 dbSNP
rs182973557 2340 dbSNP
rs1023668366 2341 dbSNP
rs901013646 2344 dbSNP
rs1340981008 2349 dbSNP
rs1205667906 2351 dbSNP
rs1040785981 2352 dbSNP
rs559152657 2353 dbSNP
rs1396977869 2364 dbSNP
rs892126253 2371 dbSNP
rs886053589 2372 dbSNP
rs896577538 2377 dbSNP
rs926153127 2379 dbSNP
rs936328576 2379 dbSNP
rs1450312858 2384 dbSNP
rs1453383697 2384 dbSNP
rs768845233 2397 dbSNP
rs1393588313 2400 dbSNP
rs866388906 2402 dbSNP
rs1035396824 2403 dbSNP
rs537780961 2414 dbSNP
rs886665632 2417 dbSNP
rs948903878 2419 dbSNP
rs1317931206 2423 dbSNP
rs1442810772 2427 dbSNP
rs1049340926 2433 dbSNP
rs930783375 2436 dbSNP
rs992926775 2443 dbSNP
rs1188084105 2452 dbSNP
rs1484184331 2454 dbSNP
rs1203532477 2455 dbSNP
rs961794222 2460 dbSNP
rs1444057944 2465 dbSNP
rs900703820 2466 dbSNP
rs1015639237 2483 dbSNP
rs1190694410 2488 dbSNP
rs1251546549 2494 dbSNP
rs984048030 2496 dbSNP
rs1039225112 2497 dbSNP
rs952734766 2498 dbSNP
rs1379930415 2499 dbSNP
rs1452243799 2501 dbSNP
rs1156403783 2503 dbSNP
rs950143957 2506 dbSNP
rs1028166390 2514 dbSNP
rs1322075772 2519 dbSNP
rs1358021769 2520 dbSNP
rs1365262001 2520 dbSNP
rs944407505 2520 dbSNP
rs1386058127 2521 dbSNP
rs1301710585 2524 dbSNP
rs913344207 2529 dbSNP
rs780560618 2530 dbSNP
rs1226432097 2541 dbSNP
rs900986995 2549 dbSNP
rs1329881486 2550 dbSNP
rs1246246814 2552 dbSNP
rs1210855928 2553 dbSNP
rs570362127 2555 dbSNP
rs146658783 2565 dbSNP
rs1009308833 2570 dbSNP
rs925848967 2572 dbSNP
rs1417857583 2579 dbSNP
rs536235833 2588 dbSNP
rs1316734945 2601 dbSNP
rs1053534478 2602 dbSNP
rs1381973428 2605 dbSNP
rs1361438971 2626 dbSNP
rs978683492 2628 dbSNP
rs1160694205 2639 dbSNP
rs1183856836 2641 dbSNP
rs1422824072 2646 dbSNP
rs1365106158 2654 dbSNP
rs756715930 2659 dbSNP
rs1293903273 2667 dbSNP
rs1473763984 2673 dbSNP
rs1369394747 2676 dbSNP
rs904889350 2678 dbSNP
rs748799298 2683 dbSNP
rs886053588 2685 dbSNP
rs1230362588 2686 dbSNP
rs1371234721 2689 dbSNP
rs554247382 2692 dbSNP
rs1321417610 2693 dbSNP
rs1022714334 2710 dbSNP
rs1044653043 2711 dbSNP
rs1267617280 2715 dbSNP
rs1205109986 2717 dbSNP
rs949029214 2717 dbSNP
rs917418678 2721 dbSNP
rs1477997545 2724 dbSNP
rs1264887446 2731 dbSNP
rs993372906 2737 dbSNP
rs1219884410 2751 dbSNP
rs1410905139 2757 dbSNP
rs566031493 2763 dbSNP
rs1164979065 2768 dbSNP
rs1351438040 2769 dbSNP
rs1290032410 2782 dbSNP
rs886053587 2784 dbSNP
rs1427626574 2789 dbSNP
rs992627202 2792 dbSNP
rs1371152294 2797 dbSNP
rs1211080218 2804 dbSNP
rs1411582279 2806 dbSNP
rs1282503285 2811 dbSNP
rs940206477 2814 dbSNP
rs961045873 2819 dbSNP
rs1229120697 2835 dbSNP
rs908610480 2838 dbSNP
rs1035127593 2842 dbSNP
rs1005272971 2843 dbSNP
rs73975813 2848 dbSNP
rs75818653 2865 dbSNP
rs1028311321 2872 dbSNP
rs1028303708 2877 dbSNP
rs1208572489 2881 dbSNP
rs531072065 2883 dbSNP
rs1227175066 2885 dbSNP
rs532594333 2898 dbSNP
rs1280481301 2901 dbSNP
rs756417636 2902 dbSNP
rs1039193087 2903 dbSNP
rs1009090801 2906 dbSNP
rs890184202 2908 dbSNP
rs1052903170 2910 dbSNP
rs965707001 2925 dbSNP
rs934312840 2926 dbSNP
rs925681811 2935 dbSNP
rs143203149 2936 dbSNP
rs1332052035 2942 dbSNP
rs1042706298 2945 dbSNP
rs1448895721 2948 dbSNP
rs563546157 2952 dbSNP
rs1363379687 2957 dbSNP
rs915840660 2959 dbSNP
rs1344701561 2976 dbSNP
rs992596395 2977 dbSNP
rs959921695 2983 dbSNP
rs1278589174 2987 dbSNP
rs1425581316 3003 dbSNP
rs928024191 3004 dbSNP
rs983586242 3013 dbSNP
rs1196989991 3016 dbSNP
rs1313275930 3022 dbSNP
rs71371838 3026 dbSNP
rs1210282829 3027 dbSNP
rs1027625525 3030 dbSNP
rs994854618 3032 dbSNP
rs1463272405 3037 dbSNP
rs964936931 3040 dbSNP
rs755775502 3041 dbSNP
rs1476246350 3042 dbSNP
rs549560815 3044 dbSNP
rs1424429920 3052 dbSNP
rs1414953545 3053 dbSNP
rs531526803 3054 dbSNP
rs1435511944 3057 dbSNP
rs1032082230 3063 dbSNP
rs8073526 3075 dbSNP
rs373282400 3077 dbSNP
rs890664978 3079 dbSNP
rs1053278804 3081 dbSNP
rs746259150 3085 dbSNP
rs904278997 3086 dbSNP
rs560831052 3090 dbSNP
rs1434824187 3098 dbSNP
rs1260445215 3106 dbSNP
rs1222029438 3109 dbSNP
rs1274618124 3111 dbSNP
rs1044788977 3122 dbSNP
rs1013259281 3123 dbSNP
rs896018089 3125 dbSNP
rs1057392646 3127 dbSNP
rs948407926 3138 dbSNP
rs1438718923 3143 dbSNP
rs908743542 3147 dbSNP
rs1245850289 3152 dbSNP
rs915809367 3152 dbSNP
rs1409893367 3156 dbSNP
rs761164873 3159 dbSNP
rs1057004265 3161 dbSNP
rs1328255389 3167 dbSNP
rs8072837 3168 dbSNP
rs1403810667 3169 dbSNP
rs938503997 3175 dbSNP
rs1447489075 3177 dbSNP
rs1402333279 3184 dbSNP
rs8072826 3186 dbSNP
rs983032230 3190 dbSNP
rs1439246420 3191 dbSNP
rs1286957586 3197 dbSNP
rs568877108 3198 dbSNP
rs1217122813 3202 dbSNP
rs965407449 3202 dbSNP
rs912444160 3209 dbSNP
rs988087232 3210 dbSNP
rs920697701 3216 dbSNP
rs1451932952 3217 dbSNP
rs973385288 3222 dbSNP
rs964735898 3225 dbSNP
rs139845972 3231 dbSNP
rs1178688253 3233 dbSNP
rs1183074647 3243 dbSNP
rs969095261 3246 dbSNP
rs1471939641 3249 dbSNP
rs866487002 3254 dbSNP
rs8072663 3255 dbSNP
rs1370541604 3256 dbSNP
rs955131741 3257 dbSNP
rs1467558908 3260 dbSNP
rs1031804178 3264 dbSNP
rs999441982 3266 dbSNP
rs556961840 3267 dbSNP
rs904256486 3268 dbSNP
rs1271593798 3272 dbSNP
rs1221211418 3276 dbSNP
rs1247972625 3280 dbSNP
rs1348783988 3283 dbSNP
rs1482691320 3284 dbSNP
rs1308673473 3285 dbSNP
rs1252781199 3291 dbSNP
rs1021353114 3305 dbSNP
rs1240916145 3306 dbSNP
rs1012522375 3309 dbSNP
rs894177941 3311 dbSNP
rs1334545436 3312 dbSNP
rs1389864784 3312 dbSNP
rs577802515 3322 dbSNP
rs1447026775 3336 dbSNP
rs1359599779 3340 dbSNP
rs1057419407 3348 dbSNP
rs931486638 3350 dbSNP
rs1332917071 3351 dbSNP
rs1383158909 3353 dbSNP
rs1454189678 3354 dbSNP
rs938570802 3363 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 80169.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 80169.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 80169.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ggaCGAGGUUUUUAGGuaa 5'
             |:||   :|||||   
Target 5' cagGUUC---GAAUCCugc 3'
17 - 32
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293/HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1067869. RNA binding protein: AGO2. Condition:Ago2 IP-seq (asynchronous cells) HITS-CLIP data was present in GSM1067870. RNA binding protein: AGO2. Condition:Ago2 IP-seq (mitotic cells) ...

- Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology.

Article - Kishore S; Gruber AR; Jedlinski DJ; Syed et al.
- Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A PAR-CLIP data was present in SRX1760638. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3-miR148 PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A PAR-CLIP data was present in SRX1760641. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_B ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM4850316
Method / RBP HITS-CLIP / AGO
Cell line / Condition Zika virus infected neural stem cells / AGO_CLIP_Rep2
Location of target site NM_025099 | 3UTR | GUAGUCGUGGCCGAGUGGUUAAGGCGAUGGACUAGAAAUCCAUUGGGGUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 33718276 / GSE159916
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4850317
Method / RBP HITS-CLIP / AGO
Cell line / Condition Zika virus infected neural stem cells / miRNA_WT
Location of target site NM_025099 | 3UTR | GUAGUCGUGGCCGAGUGGUUAAGGCGAUGGACUAGAAAUCCAUUGGGGUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 33718276 / GSE159916
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4850318
Method / RBP HITS-CLIP / AGO
Cell line / Condition Zika virus infected neural stem cells / miRNA_H41R
Location of target site NM_025099 | 3UTR | GUAGUCGUGGCCGAGUGGUUAAGGCGAUGGACUAGAAAUCCAUUGGGGUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 33718276 / GSE159916
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000315684.8 | 3UTR | AAAUCCAUUGGGGUCUCCCCGCGCAGGUUCGAAUCCUGCCGACUACGUCAUAUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1067869
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (asynchronous cells)
Location of target site ENST00000315684.8 | 3UTR | AAAUCCAUUGGGGUCUCCCCGCGCAGGUUCGAAUCCUGCCGACUACGUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1067870
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (mitotic cells)
Location of target site ENST00000315684.8 | 3UTR | AAAUCCAUUGGGGUCUCCCCGCGCAGGUUCGAAUCCUGCCGACUACGUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000315684.8 | 3UTR | AAAUCCAUUGGGGUCUCCCCGCGCAGGUUCGAAUCCUGCCGACUACGUCAUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000315684.8 | 3UTR | AGAAAUCCAUUGGGGUCUCCCCGCGCAGGUUCGAAUCCUGCCGACUACGUCAUAUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000315684.8 | 3UTR | AAGCCUCGUAGUCGUGGCCGAGUGGUUAAGGCGAUGGACUAGAAAUCCAUUGGGGUCUCCCCGCGCAGGUUCGAAUCCUGCCGACUACGUCAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000315684.8 | 3UTR | AAAUCCAUUGGGGUCUCCCCGCGCAGGUUCGAAUCCUGCCGACUACGUCAUAUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000315684.8 | 3UTR | AAAUCCAUUGGGGUCUCCCCGCGCAGGUUCGAAUCCUGCCGACUACGUCAUAUUUUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000315684.8 | 3UTR | AAGCCUCGUAGUCGUGGCCGAGUGGUUAAGGCGAUGGACUAGAAAUCCAUUGGGGUCUCCCCGCGCAGGUUCGAAUCCUGCCGACUACGUCAUAUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000315684.8 | 3UTR | AAAUCCAUUGGGGUCUCCCCGCGCAGGUUCGAAUCCUGCCGACUACGUCAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 14 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000315684.8 | 3UTR | UUGGGGUCUCCCCGCGCAGGUUCGAAUCCUGCCGACUACGUCAUAUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 15 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000315684.8 | 3UTR | AAAUCCAUUGGGGUCUCCCCGCGCAGGUUCGAAUCCUGCCGACUACGUCAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer -0.203 1.3e-1 -0.168 1.8e-1 32 Click to see details
GSE28260 Renal cortex and medulla 0.332 1.3e-1 0.313 1.5e-1 13 Click to see details
GSE38226 Liver fibrosis 0.208 1.8e-1 0.297 9.6e-2 21 Click to see details
GSE28544 Breast cancer 0.167 2.2e-1 0.016 4.7e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.094 3.3e-1 -0.084 3.4e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.073 3.7e-1 0.138 2.6e-1 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.028 4.5e-1 0.075 3.7e-1 23 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.809 0.03 0.486 0.16 6 Click to see details
HNSC 0.809 0.03 0.486 0.16 6 Click to see details
HNSC 0.809 0.03 0.486 0.16 6 Click to see details
52 hsa-miR-1246 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT053774 DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A 4 1
MIRT196431 TAOK1 TAO kinase 1 2 6
MIRT444394 ZNF480 zinc finger protein 480 2 2
MIRT447596 MSH3 mutS homolog 3 2 2
MIRT454049 TMBIM4 transmembrane BAX inhibitor motif containing 4 2 2
MIRT458257 ZNF85 zinc finger protein 85 2 2
MIRT461493 KIAA1009 centrosomal protein 162 1 1
MIRT474057 LMNB2 lamin B2 2 2
MIRT479231 CKS2 CDC28 protein kinase regulatory subunit 2 2 6
MIRT485663 CHD7 chromodomain helicase DNA binding protein 7 2 2
MIRT485735 CALM2 calmodulin 2 2 2
MIRT498809 SRRT serrate, RNA effector molecule 2 8
MIRT501190 SKIL SKI like proto-oncogene 2 2
MIRT502619 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 2 6
MIRT502665 CTC1 CST telomere replication complex component 1 2 13
MIRT512313 ADCY9 adenylate cyclase 9 2 6
MIRT513756 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT514651 CRADD CASP2 and RIPK1 domain containing adaptor with death domain 2 2
MIRT514865 SHOX2 short stature homeobox 2 2 2
MIRT527109 ARHGAP15 Rho GTPase activating protein 15 2 2
MIRT527145 GPATCH11 G-patch domain containing 11 2 2
MIRT528507 HTR7 5-hydroxytryptamine receptor 7 2 4
MIRT532109 RRP8 ribosomal RNA processing 8 2 2
MIRT534601 RORA RAR related orphan receptor A 2 2
MIRT538906 BRI3BP BRI3 binding protein 2 4
MIRT544541 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT547430 MED4 mediator complex subunit 4 2 2
MIRT553029 USP48 ubiquitin specific peptidase 48 2 2
MIRT555136 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT562091 KIAA0895 KIAA0895 2 2
MIRT562584 CBX3 chromobox 3 2 4
MIRT563747 ZNF763 zinc finger protein 763 2 2
MIRT573310 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT687232 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT704465 CREBRF CREB3 regulatory factor 2 2
MIRT718817 PYGO1 pygopus family PHD finger 1 2 2
MIRT731194 NFIB nuclear factor I B 2 1
MIRT732503 SPRED2 sprouty related EVH1 domain containing 2 3 0
MIRT733489 MIF macrophage migration inhibitory factor 2 0
MIRT734071 SRSF1 serine and arginine rich splicing factor 1 2 0
MIRT734733 AR androgen receptor 3 0
MIRT734755 GLS2 glutaminase 2 2 0
MIRT735248 CFTR cystic fibrosis transmembrane conductance regulator 8 1
MIRT736017 ELAVL1 ELAV like RNA binding protein 1 2 0
MIRT736329 DNAH3 dynein axonemal heavy chain 3 2 0
MIRT737381 CCNG2 cyclin G2 2 0
MIRT755524 FOXA2 forkhead box A2 3 1
MIRT755713 DIXDC1 DIX domain containing 1 2 1
MIRT755714 WNT9A Wnt family member 9A 2 1
MIRT755715 RAC2 Rac family small GTPase 2 2 1
MIRT755716 FRAT2 FRAT2, WNT signaling pathway regulator 2 1
MIRT756132 ACE2 angiotensin I converting enzyme 2 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-1246 Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 up-regulated
miR-1246 Ascorbate approved 54670067 Microarray Metastatic melanoma cell lines 25202679 2014 up-regualted
miR-1246 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 up-regulated
miR-1246 Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
miR-1246 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 up-regulated
miR-1246 Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1246 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant High Bladder Cancer cell line (RT4, J82,TCCSUP, UM-UC-3,RT112,CUBIII)
hsa-miR-1246 Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-1246 Doxorubicin 31703 NSC123127 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-1246 Vincristine 5978 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-1246 Fluorouracil 3385 NSC19893 approved resistant Low Pancreatic Cancer cell line (MIA-PaCa-2, PANC-1)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (MIA-PaCa-2, PANC-1)
hsa-miR-1246 Platinum-based doublet chemotherapy sensitive High Lung Adenocarcinoma tissue
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Ductal Adenocarcinoma cell line (BxPC-3)
hsa-miR-1246 Bortezomib 387447 NSC681239 approved resistant High Multiple Myeloma cell line
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1246 Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1246 Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer cell line (MDA-MB-231, MCF-7)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant Low Hepatocellular Carcinoma cell line (Hep3B, Huh-7)
hsa-miR-1246 Fluorouracil 3385 NSC19893 approved resistant Low Hepatocellular Carcinoma cell line (Hep3B, Huh-7)
hsa-miR-1246 Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma cell line (Hep3B, Huh-7)
hsa-miR-1246 Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-1246 Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-1246 Plx-4720 24180719 NSC757438 resistant Low Melanoma cell line (A375P, SK-MEL-2)
hsa-miR-1246 Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer cell line (BCap37, Bads-200, Bats-72)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Epirubicin 41867 NSC256942 approved resistant Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (SAS, GNM, OC3, Fadu)
hsa-miR-1246 Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (1uM)
hsa-miR-1246 Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (2uM)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (1uM)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (200nM)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-1246 Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (200nM)
hsa-miR-1246 Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (200nM)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (2uM)
hsa-miR-1246 Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (200nM)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant Low Ovarian Cancer cell line (HeyA8, SKOV3, A2780, THP-1)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant Low Tongue Squamous Cell Carcinoma cell line (CAL-27)
hsa-miR-1246 Fluorouracil 3385 NSC19893 approved resistant Low Colorectal Cancer cell line (HCT-116, HCT-8)
hsa-miR-1246 Oxaliplatin 6857599 NSC266046 approved resistant Low Colorectal Cancer cell line (HCT-116, HCT-8)
hsa-miR-1246 Erlotinib 176870 NSC718781 approved sensitive High Head And Neck Squamous Cell Carcinoma cell line (HN6)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer cell line (BCap37)
hsa-miR-1246 Trastuzumab resistant Low HER2-Positive Breast Cancer tissue
hsa-miR-1246 Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U87)
hsa-miR-1246 Doxorubicin 31703 NSC123127 approved resistant Low Leukemia cell line (K562/ADM and HL-60/RS)
hsa-miR-1246 Fluorouracil 3385 NSC19893 approved resistant Low Melanoma cell line (A375)
hsa-miR-1246 Docetaxel 148124 NSC628503 approved sensitive Low Breast Cancer tissue and cell line (MCF-7, MDA-MB-231, MDA-MB-468, SKBR3)
hsa-miR-1246 Antiepileptic Drug resistant High Pediatric Epilepsy tissue
hsa-mir-1246 Vincristine 5978 approved resistant cell line (W1)
hsa-mir-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (KYSE)
hsa-mir-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-mir-1246 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-1246 Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-1246 Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-1246 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1246 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-1246 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM47)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-miR-1246 Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-1246 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-1246 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-1246 Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-1246 Doxorubicin 31703 NSC123127 approved resistant cell line (K562)
hsa-miR-1246 Platinum-based doublet chemotherapy sensitive tissue (lung adenocarcinoma)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1246 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)
hsa-miR-1246 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)

Error report submission