miRTarBase - #MIRT503257


—
pre-miRNA Information
pre-miRNA hsa-mir-637   
Genomic Coordinates chr19: 3961414 - 3961512
Synonyms MIRN637, hsa-mir-637, MIR637
Description Homo sapiens miR-637 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-637
Sequence 61| ACUGGGGGCUUUCGGGCUCUGCGU |84
Evidence Experimental
Experiments SAGE
Expression Profile
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN518997 2 COSMIC
COSN1082357 6 COSMIC
COSN13804010 13 COSMIC
COSN1082358 14 COSMIC
COSN30450169 14 COSMIC
COSN30532059 15 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1416171403 2 dbSNP
rs200224173 4 dbSNP
rs1475121792 9 dbSNP
rs202144891 13 dbSNP
rs767027646 14 dbSNP
rs529226642 16 dbSNP
rs751534327 17 dbSNP
rs758718359 17 dbSNP
rs149472696 20 dbSNP
rs773105166 21 dbSNP
rs543903246 22 dbSNP
rs374248027 24 dbSNP
Putative Targets

Gene Information
Gene Symbol KIF18B
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 146909.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugcgucUCGGGC-UUUCGGGGGuca 5'
                | ||:|  |  | |||   
Target 5' acauccAUCCUGCUACUCACCC--- 3'
 		1 - 22
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000587309.1 | 3UTR | ACAUCCAUCCUGCUACUCACCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.518 4.8e-3 -0.478 9.1e-3 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.5 7.6e-3 -0.509 6.6e-3 23 Click to see details
GSE28260 Renal cortex and medulla -0.459 5.7e-2 -0.522 3.4e-2 13 Click to see details
GSE32688 Pancreatic cancer 0.199 1.4e-1 0.130 2.4e-1 32 Click to see details
GSE14794 Lymphoblastoid cells -0.086 2.1e-1 0.015 4.4e-1 90 Click to see details
GSE38226 Liver fibrosis 0.151 2.6e-1 -0.062 3.9e-1 21 Click to see details
GSE17498 Multiple myeloma -0.106 2.6e-1 -0.135 2.0e-1 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.132 2.6e-1 -0.039 4.3e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.092 3.3e-1 -0.188 1.9e-1 24 Click to see details
GSE17306 Multiple myeloma -0.036 4.0e-1 0.294 2.0e-2 49 Click to see details
GSE21687 Ependynoma primary tumors 0.008 4.7e-1 -0.034 3.9e-1 64 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.002 5.0e-1 0.308 9.3e-2 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.002 5.0e-1 0.308 9.3e-2 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.002 5.0e-1 0.308 9.3e-2 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.002 5.0e-1 0.308 9.3e-2 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
69 hsa-miR-637 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006147 SP7 Sp7 transcription factor 3 1
MIRT054906 COL4A1 collagen type IV alpha 1 chain 1 1
MIRT159142 NRBP1 nuclear receptor binding protein 1 2 2
MIRT358526 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 2 2
MIRT441490 NCEH1 neutral cholesterol ester hydrolase 1 2 2
MIRT443472 ACPP acid phosphatase, prostate 2 2
MIRT464631 UBE4A ubiquitination factor E4A 2 2
MIRT465259 TRIM44 tripartite motif containing 44 2 2
MIRT473975 LRRC58 leucine rich repeat containing 58 2 2
MIRT475168 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT477631 EFNA1 ephrin A1 2 2
MIRT480100 CALR calreticulin 2 2
MIRT483504 STMN3 stathmin 3 2 4
MIRT483735 THSD4 thrombospondin type 1 domain containing 4 2 2
MIRT483847 UNC5B unc-5 netrin receptor B 2 2
MIRT485973 RTBDN retbindin 2 2
MIRT486616 METTL6 methyltransferase like 6 2 2
MIRT487847 CLSTN1 calsyntenin 1 2 4
MIRT488675 WWP2 WW domain containing E3 ubiquitin protein ligase 2 2 4
MIRT489046 PRPF4B pre-mRNA processing factor 4B 2 2
MIRT490612 SLC47A1 solute carrier family 47 member 1 2 4
MIRT490990 USP22 ubiquitin specific peptidase 22 2 2
MIRT492559 PRX periaxin 2 2
MIRT494667 ARL8A ADP ribosylation factor like GTPase 8A 2 2
MIRT495880 DPY19L1 dpy-19 like C-mannosyltransferase 1 2 2
MIRT496778 ADAMTS14 ADAM metallopeptidase with thrombospondin type 1 motif 14 2 2
MIRT499742 USH1G USH1 protein network component sans 2 4
MIRT500371 ZNF385A zinc finger protein 385A 2 2
MIRT503257 KIF18B kinesin family member 18B 2 2
MIRT504511 PPP1R9B protein phosphatase 1 regulatory subunit 9B 2 2
MIRT511940 FAM127B retrotransposon Gag like 8A 2 2
MIRT514606 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 2 4
MIRT527187 CLASP1 cytoplasmic linker associated protein 1 2 2
MIRT532494 HOXA13 homeobox A13 2 2
MIRT533504 TRIM71 tripartite motif containing 71 2 2
MIRT539171 AR androgen receptor 2 2
MIRT542735 RBFOX2 RNA binding protein, fox-1 homolog 2 2 2
MIRT544647 PHF8 PHD finger protein 8 2 4
MIRT546232 TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 2 2
MIRT548372 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 4
MIRT555913 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT565381 TGOLN2 trans-golgi network protein 2 2 2
MIRT568954 RUNX3 runt related transcription factor 3 2 2
MIRT570205 RAP1GAP2 RAP1 GTPase activating protein 2 2 2
MIRT573599 CERS1 ceramide synthase 1 2 2
MIRT615364 CCNF cyclin F 2 2
MIRT616102 HOXB5 homeobox B5 2 2
MIRT619127 CD40LG CD40 ligand 2 2
MIRT634968 C8orf17 chromosome 8 open reading frame 17 2 2
MIRT646665 FNBP1 formin binding protein 1 2 2
MIRT649633 RASA4 RAS p21 protein activator 4 2 2
MIRT658443 FAM167B family with sequence similarity 167 member B 2 2
MIRT660237 BMP7 bone morphogenetic protein 7 2 2
MIRT669467 ATL3 atlastin GTPase 3 2 2
MIRT670557 SHISA2 shisa family member 2 2 2
MIRT671035 PCDHB2 protocadherin beta 2 2 2
MIRT684255 TBXA2R thromboxane A2 receptor 2 2
MIRT688619 CYBRD1 cytochrome b reductase 1 3 2
MIRT694346 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT695516 ALPI alkaline phosphatase, intestinal 2 2
MIRT697512 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT700133 RNF144B ring finger protein 144B 2 2
MIRT711667 TRMT5 tRNA methyltransferase 5 2 2
MIRT712156 TAOK1 TAO kinase 1 2 2
MIRT712463 KCNC3 potassium voltage-gated channel subfamily C member 3 2 2
MIRT720759 FAM193A family with sequence similarity 193 member A 2 2
MIRT731198 AKT1 AKT serine/threonine kinase 1 2 1
MIRT755463 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT755522 FOXM1 forkhead box M1 3 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-637 Sorafenib 216239 NSC747971 approved sensitive High Hepatocellular Carcinoma tissue
hsa-miR-637 Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-637 Cisplatin 5460033 NSC119875 approved sensitive Low Squamous Cell Carcinoma cell line (SCC-11)
hsa-miR-637 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-637 Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-637 Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (50nM)
hsa-miR-637 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (50nM)
hsa-miR-637 Tivantinib 11494412 NSC758242 resistant High Breast Cancer cell line (BT-20, BT-474, BT-549, CAMA-1, HCC1143, HCC1395, HCC1569, HCC1806, HCC-1937, HCC1954, HCC202, HCC38, HCC70, Hs578T, MCF-7, MDA-MB-175VII, MDA-MB-231, MDA-MB-361, MDA-MB-415, MDA-MB-436, MDA-MB-468, SKBR3, T47D, UACC812, EVSA-T, MPE-600 , SK-BR-
hsa-miR-637 Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HT-29, HCT-116)
hsa-miR-637 Sevoflurane 5206 NSC760367 approved sensitive Low Colorectal Cancer cell line
hsa-mir-637 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-637 Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-mir-637 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-mir-637 Androstenedione+Anastrozole sensitive cell line (MCF-7)
hsa-mir-637 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-637 Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-637 Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-637 Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-637 Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-637 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-637 Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-637 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-637 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission