pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4477a |
Genomic Coordinates | chr9: 41233755 - 41233835 |
Description | Homo sapiens miR-4477a stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4477a | ||||||||||||||||||||||||||||||||||||||||||
Sequence | 48| CUAUUAAGGACAUUUGUGAUUC |69 | ||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SAT1 | ||||||||||||||||||||
Synonyms | DC21, KFSD, KFSDX, SAT, SSAT, SSAT-1 | ||||||||||||||||||||
Description | spermidine/spermine N1-acetyltransferase 1 | ||||||||||||||||||||
Transcript | NM_002970 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on SAT1 | |||||||||||||||||||||
3'UTR of SAT1 (miRNA target sites are highlighted) |
>SAT1|NM_002970|3'UTR 1 GGAGTGCTGCTGTAGATGACAACCTCCATTCTATTTTAGAATAAATTCCCAACTTCTCTTGCTTTCTATGCTGTTTGTAG 81 TGAAATAATAGAATGAGCACCCATTCCAAAGCTTTATTACCAGTGGCGTTGTTGCATGTTTGAAATGAGGTCTGTTTAAA 161 GTGGCAATCTCAGATGCAGTTTGGAGAGTCAGATCTTTCTCCTTGAATATCTTTCGATAAACAACAAGGTGGTGTGATCT 241 TAATATATTTGAAAAAAACTTCATTCTCGTGAGTCATTTAAATGTGTACAATGTACACACTGGTACTTAGAGTTTCTGTT 321 TGATTCTTTTTTAATAAACTACTCTTTGATTTAATTGTTTGGTGTAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 6303.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 6303.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM4903838 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_c |
Location of target site | NM_002970 | 3UTR | GAUGACAACCUCCAUUCUAUUUUAGAAUAAAUUCCCAACUUCUCUUGCUUUCUAUGCUGUUUGUAGUGAAAUAAUAGAAUGAGCACCCAUUCCAAAGCUUUAUUACCAGUGGCGUUGUUGCAUGUUUGAAAUGAGGUCUGUUUAAAGUGGCAAUCUCAGAUGCAGUUUGGAGAGUCAGAUCUUUCUCCUUGAAUAUCUUUCGAUAAACAACAAGGUGGUGUGAUCUUAAUAUAUUUGAAAAAAACUUCAUUCUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000379270.4 | 3UTR | AUUCUUUUUUAAUAAACUACUCUUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000379270.4 | 3UTR | UUUGAUUCUUUUUUAAUAAACUACUCUUUGAUUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM1065670 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
Location of target site | ENST00000379270.4 | 3UTR | AUUCUUUUUUAAUAAACUACUCUUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
134 hsa-miR-4477a Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT055843 | PLEKHA1 | pleckstrin homology domain containing A1 | ![]() |
![]() |
2 | 10 | ||||||
MIRT061259 | AMOTL1 | angiomotin like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT071895 | BTF3L4 | basic transcription factor 3 like 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT076933 | MLLT6 | MLLT6, PHD finger containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT078652 | ICT1 | mitochondrial ribosomal protein L58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT083633 | PRNP | prion protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT091629 | RPL15 | ribosomal protein L15 | ![]() |
![]() |
2 | 4 | ||||||
MIRT107076 | PPP6C | protein phosphatase 6 catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT111191 | TRIM33 | tripartite motif containing 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT114515 | ARF6 | ADP ribosylation factor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT175250 | PSAT1 | phosphoserine aminotransferase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT175430 | ACSL4 | acyl-CoA synthetase long chain family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT178687 | FAM102B | family with sequence similarity 102 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT189771 | CDADC1 | cytidine and dCMP deaminase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT229450 | RPL10 | ribosomal protein L10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT244899 | PHF6 | PHD finger protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT249189 | AKIRIN1 | akirin 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT261134 | TRIM8 | tripartite motif containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT275561 | ZIC5 | Zic family member 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT275652 | ABHD13 | abhydrolase domain containing 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT288082 | UTP18 | UTP18, small subunit processome component | ![]() |
![]() |
2 | 2 | ||||||
MIRT303605 | MTHFD2 | methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase | ![]() |
![]() |
2 | 2 | ||||||
MIRT307924 | ARL8B | ADP ribosylation factor like GTPase 8B | ![]() |
![]() |
2 | 2 | ||||||
MIRT316787 | FOXC1 | forkhead box C1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT326910 | SCML2 | Scm polycomb group protein like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT327713 | SPIN4 | spindlin family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT331632 | AASDHPPT | aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT342506 | TMOD3 | tropomodulin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT354470 | LRRC58 | leucine rich repeat containing 58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT378711 | TRIM24 | tripartite motif containing 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT407462 | YDJC | YdjC chitooligosaccharide deacetylase homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT408226 | SMAD5 | SMAD family member 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT441824 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT442783 | CHD8 | chromodomain helicase DNA binding protein 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443184 | NHS | NHS actin remodeling regulator | ![]() |
![]() |
2 | 4 | ||||||
MIRT447615 | CUL3 | cullin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450156 | DSEL | dermatan sulfate epimerase-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT454801 | NEDD9 | neural precursor cell expressed, developmentally down-regulated 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463050 | ZNF644 | zinc finger protein 644 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467400 | SOCS3 | suppressor of cytokine signaling 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468174 | SGMS1 | sphingomyelin synthase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468949 | RPS14 | ribosomal protein S14 | ![]() |
![]() |
2 | 6 | ||||||
MIRT469835 | R3HDM4 | R3H domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470724 | POFUT1 | protein O-fucosyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470902 | PLIN3 | perilipin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472467 | NAPG | NSF attachment protein gamma | ![]() |
![]() |
2 | 12 | ||||||
MIRT472602 | NAA50 | N(alpha)-acetyltransferase 50, NatE catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT492350 | SEMA7A | semaphorin 7A (John Milton Hagen blood group) | ![]() |
![]() |
2 | 2 | ||||||
MIRT493840 | FOXN3 | forkhead box N3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT496318 | DOCK9 | dedicator of cytokinesis 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT500159 | CLEC2D | C-type lectin domain family 2 member D | ![]() |
![]() |
2 | 8 | ||||||
MIRT500535 | XPO4 | exportin 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT503916 | FBXL13 | F-box and leucine rich repeat protein 13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT504003 | SAT1 | spermidine/spermine N1-acetyltransferase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT505647 | SHMT1 | serine hydroxymethyltransferase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506574 | MIER3 | MIER family member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506945 | HS3ST3B1 | heparan sulfate-glucosamine 3-sulfotransferase 3B1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT508196 | RPS19 | ribosomal protein S19 | ![]() |
![]() |
2 | 6 | ||||||
MIRT511417 | HSPA13 | heat shock protein family A (Hsp70) member 13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT512326 | ACTB | actin beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT515376 | RPL7 | ribosomal protein L7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520422 | TUBG1 | tubulin gamma 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT524844 | ARPP19 | cAMP regulated phosphoprotein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT526320 | UGT2A1 | UDP glucuronosyltransferase family 2 member A1 complex locus | ![]() |
![]() |
2 | 2 | ||||||
MIRT526561 | UGT2A2 | UDP glucuronosyltransferase family 2 member A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528027 | FEZ2 | fasciculation and elongation protein zeta 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529874 | RBM43 | RNA binding motif protein 43 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530826 | CLEC4D | C-type lectin domain family 4 member D | ![]() |
![]() |
2 | 2 | ||||||
MIRT531334 | GDPD1 | glycerophosphodiester phosphodiesterase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT532068 | CCNB1 | cyclin B1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT532870 | ZNF566 | zinc finger protein 566 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535580 | NUP35 | nucleoporin 35 | ![]() |
![]() |
2 | 2 | ||||||
MIRT537644 | ERGIC2 | ERGIC and golgi 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT537725 | ELAVL2 | ELAV like RNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538894 | BRI3BP | BRI3 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT538945 | BMP2K | BMP2 inducible kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT540703 | PDPK1 | 3-phosphoinositide dependent protein kinase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT543210 | TMEM117 | transmembrane protein 117 | ![]() |
![]() |
2 | 3 | ||||||
MIRT543357 | LYRM2 | LYR motif containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544905 | CLSPN | claspin | ![]() |
![]() |
2 | 2 | ||||||
MIRT545532 | ARF3 | ADP ribosylation factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546446 | SMOC1 | SPARC related modular calcium binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546882 | PURB | purine rich element binding protein B | ![]() |
![]() |
2 | 4 | ||||||
MIRT547440 | MED13 | mediator complex subunit 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548027 | GOLIM4 | golgi integral membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548673 | CRNKL1 | crooked neck pre-mRNA splicing factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT550435 | LLGL2 | LLGL2, scribble cell polarity complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT551850 | RPS3 | ribosomal protein S3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT556072 | MRFAP1 | Morf4 family associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT556554 | LIMS1 | LIM zinc finger domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557132 | HOXA13 | homeobox A13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557875 | FEM1B | fem-1 homolog B | ![]() |
![]() |
2 | 4 | ||||||
MIRT558146 | ELK4 | ELK4, ETS transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT558862 | CD2AP | CD2 associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT558884 | CCNE1 | cyclin E1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT558907 | CBX5 | chromobox 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559175 | BRAP | BRCA1 associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT560860 | GAL3ST3 | galactose-3-O-sulfotransferase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561729 | PPIF | peptidylprolyl isomerase F | ![]() |
![]() |
2 | 2 | ||||||
MIRT564024 | CEBPB | CCAAT/enhancer binding protein beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT564366 | TRMT5 | tRNA methyltransferase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564609 | ZNF703 | zinc finger protein 703 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565494 | AZF1 | azoospermia factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565577 | SLC6A8 | solute carrier family 6 member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566947 | LEPROT | leptin receptor overlapping transcript | ![]() |
![]() |
2 | 2 | ||||||
MIRT567293 | HNRNPA2B1 | heterogeneous nuclear ribonucleoprotein A2/B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT567308 | HMGN2 | high mobility group nucleosomal binding domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568048 | CHSY1 | chondroitin sulfate synthase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571807 | PHF19 | PHD finger protein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609234 | RBM23 | RNA binding motif protein 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610328 | SSX5 | SSX family member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT611428 | UGT8 | UDP glycosyltransferase 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT611709 | SLFN13 | schlafen family member 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT612069 | CEP135 | centrosomal protein 135 | ![]() |
![]() |
2 | 4 | ||||||
MIRT617676 | JRKL | JRK like | ![]() |
![]() |
2 | 2 | ||||||
MIRT623684 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635634 | PRR15L | proline rich 15 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT636422 | MBOAT2 | membrane bound O-acyltransferase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637011 | GPATCH11 | G-patch domain containing 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644150 | C4orf3 | chromosome 4 open reading frame 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648562 | MEMO1 | mediator of cell motility 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650752 | WNT16 | Wnt family member 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651914 | UEVLD | UEV and lactate/malate dehyrogenase domains | ![]() |
![]() |
2 | 2 | ||||||
MIRT653556 | SLC38A7 | solute carrier family 38 member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT692277 | XRN2 | 5'-3' exoribonuclease 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT697650 | WNK1 | WNK lysine deficient protein kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703876 | ERCC6 | ERCC excision repair 6, chromatin remodeling factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT704615 | CLIP1 | CAP-Gly domain containing linker protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708562 | BBOX1 | gamma-butyrobetaine hydroxylase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709614 | KBTBD6 | kelch repeat and BTB domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712955 | SGCD | sarcoglycan delta | ![]() |
![]() |
2 | 2 | ||||||
MIRT713502 | DCAF17 | DDB1 and CUL4 associated factor 17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720239 | GPBP1 | GC-rich promoter binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724255 | GLUD1 | glutamate dehydrogenase 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|