miRTarBase - #MIRT504081


—
pre-miRNA Information
pre-miRNA hsa-mir-4742   
Genomic Coordinates chr1: 224398227 - 224398311
Description Homo sapiens miR-4742 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4742-5p
Sequence 1| UCAGGCAAAGGGAUAUUUACAGA |23
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1234293681 4 dbSNP
rs778464201 9 dbSNP
rs758952505 12 dbSNP
rs753463665 16 dbSNP
rs765920862 18 dbSNP
rs1205603801 20 dbSNP
rs756994761 21 dbSNP
Putative Targets

Gene Information
Gene Symbol C9orf40   
Synonyms -
Description chromosome 9 open reading frame 40
Transcript NM_017998   
Expression
Putative miRNA Targets on C9orf40
3'UTR of C9orf40
(miRNA target sites are highlighted)		 
>C9orf40|NM_017998|3'UTR
   1 TGTAAGGAGCCGAAGCAGTGGGATTGGCTGATTTGAGGAGATGTCTCTAAGTGAATTCTCGTATTCTTAAGGGAAAAGTT
  81 ATTTTCCATACTTGAAGTTATATTTCCAAACCTGAGAAATGAAGAAAGATTGTTCTGACATTAAATACCTACAGTTACTA
 161 CTGAACCTCTTAATAAGGATTTGTCAAGGATAGAGTACAGTTGTAGGGGAAGTATTTTATGTATGCATTCTTAGAGCAAA
 241 AAGTTTTGTTTAAATTCTAGAATTGAAGGTACTGATCTTATAAAAAGAAATTCTAGCAGTTTTAGAAATAGGTGGGAAAA
 321 ACTCAAATATTCCTCCTATCTGCACCAAAAAGTTTATTTGTGGTATATAAAATGAATATTGTTTTATAATAACTTGTTAA
 401 TAAAGTACTTTCTAATACATTCTATTGACTCTGTTAGTTGAACAAATAGCTGACTTGAACATCTATGCAAACTTAAGATG
 481 GGCGGGATTGTTGTAAAAGCTATTGTTTTAAAAGAGCTTTCTAAATGTAAAGTAGTGATAATTTCAATTTGGGTAGCGTG
 561 TTTGCAAAGCTTCCAATATTTGATGTTGGTTAAGCTCTACTATGGGCAACTGAAGATGGATAAAGAAAAATGAAAACTGA
 641 ATCGGTGCCTGCTTCCCCCTGTTTTCCCAGGATTAGAGGAAAAAATTTATTGTATAATCAGCTTCTTGGTTTTGAATTGC
 721 TTCGAGGCATGGTTTTATTCCTTATTACTTTAGACCTGTAGTTTTCAACACTGACAGCACTTTAAAAATCTTTGCCTGGG
 801 CCTCACTCTTGAGAGATTCTCATTTAATAGTTCTGAGGTGGGTCTTGGATATAACTATTTTTTTAAACACCTGTCCTGTT
 881 TCCCTCCATTCCTCTCATGTGCAGACAGGGTTGAGAACCAGTAGACTAATGGTCGTTTTTCCTGTTTAAAGGAGATAACT
 961 AATTTGAGCTGAAGCAATGCTTCTTAATTAGCTTTGTTTTTGTTTTGCTCTGTTGGTGGCTTTGTTACAACTGAATTATT
1041 GTGTTATTACTATTTCATTGTTAAAGAAATAAAGTAAGCAATTTGTGATGTGAGTATCAGTGATTAAGTTAACTAACTTT
1121 TGTACTGCATCCAGAATGTTGGTTTTGCAATTGAGTAACTGGTTCTTGCTTGCATTTTTTGTTGTTGATGACATTAGATC
1201 CAAAATTCAAGACAAATGGTAAATGCCATTGAGAGGGAAAGAGAAAAACTTGATTTTTTTTGTGTAATGAAGGATTTAAG
1281 AATGGGTTGACATTAATAAGAATGCTTTAGAACAGAAGACAAACTGTATTGCATTGTGGTCAGACATGGTTCAAAGTCTT
1361 GTACTGCCACTTCCTACCTATGTATCTTTAAGCCAGTTATTTTTCATCTCCAAGCCTCAAATTTCTCACCTGTAAAATGA
1441 GAAATAATAAATAGTATCTACCTCAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agACAUUUAUAGGGAAACGGACu 5'
            | |||| ||  ||||||||| 
Target 5' acTTTAAAAAT--CTTTGCCTGg 3'
 779 - 799 169.00 -17.50
2 
miRNA  3' agaCAUUUAUAGGGAAACGGACu 5'
             |||| |: ::| ||||:|| 
Target 5' tgaGTAACTGGTTC-TTGCTTGc 3'
 1152 - 1173 143.00 -10.90
3 
miRNA  3' agacAUUUAUAGGGAAACGGACu 5'
              |||  :|| :||| |||| 
Target 5' agacTAATGGTCGTTTTTCCTGt 3'
 923 - 945 131.00 -10.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30519784 4 COSMIC
COSN30503307 11 COSMIC
COSN26601743 16 COSMIC
COSN31491317 38 COSMIC
COSN30473415 47 COSMIC
COSN31565057 58 COSMIC
COSN30457010 60 COSMIC
COSN9716180 63 COSMIC
COSN30490230 70 COSMIC
COSN30707269 78 COSMIC
COSN31607064 98 COSMIC
COSN31613589 112 COSMIC
COSN31525414 121 COSMIC
COSN9716179 208 COSMIC
COSN8583202 219 COSMIC
COSN31537157 281 COSMIC
COSN25862880 360 COSMIC
COSN28198103 418 COSMIC
COSN31583936 482 COSMIC
COSN26635516 483 COSMIC
COSN22327643 553 COSMIC
COSN31555141 557 COSMIC
COSN21328659 605 COSMIC
COSN30164638 659 COSMIC
COSN31569799 760 COSMIC
COSN31539375 773 COSMIC
COSN31585686 833 COSMIC
COSN23874536 1231 COSMIC
COSN8334795 1282 COSMIC
COSN2327348 1388 COSMIC
COSN26844721 1399 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs748288518 1 dbSNP
rs781497162 2 dbSNP
rs755265761 3 dbSNP
rs747294638 7 dbSNP
rs1230428037 9 dbSNP
rs374853709 11 dbSNP
rs369913991 12 dbSNP
rs886075914 15 dbSNP
rs767956703 17 dbSNP
rs765247019 19 dbSNP
rs756684380 20 dbSNP
rs753353619 26 dbSNP
rs763648355 29 dbSNP
rs760314227 31 dbSNP
rs1436676250 36 dbSNP
rs775160241 39 dbSNP
rs766626425 40 dbSNP
rs1438958369 41 dbSNP
rs890627417 45 dbSNP
rs111660354 52 dbSNP
rs1404062872 56 dbSNP
rs902046314 60 dbSNP
rs140264373 61 dbSNP
rs932243267 62 dbSNP
rs1380901865 63 dbSNP
rs1218578825 67 dbSNP
rs1298125077 69 dbSNP
rs943498371 70 dbSNP
rs1319602216 85 dbSNP
rs540415846 88 dbSNP
rs893215464 94 dbSNP
rs1204941279 96 dbSNP
rs1310913878 102 dbSNP
rs867724046 107 dbSNP
rs774256783 114 dbSNP
rs908003591 124 dbSNP
rs1224173018 127 dbSNP
rs1263633217 134 dbSNP
rs934672913 135 dbSNP
rs924613092 149 dbSNP
rs978027112 151 dbSNP
rs1199044834 158 dbSNP
rs949275134 160 dbSNP
rs983509748 166 dbSNP
rs917794527 174 dbSNP
rs1345144431 190 dbSNP
rs1361027192 195 dbSNP
rs1289181202 197 dbSNP
rs1291116826 219 dbSNP
rs1455311858 224 dbSNP
rs1341580109 231 dbSNP
rs578041416 233 dbSNP
rs990654038 234 dbSNP
rs1343188204 242 dbSNP
rs959201030 253 dbSNP
rs11144168 269 dbSNP
rs138629715 273 dbSNP
rs1315778709 278 dbSNP
rs958902889 279 dbSNP
rs984531740 287 dbSNP
rs1431064289 290 dbSNP
rs950457012 294 dbSNP
rs999902162 298 dbSNP
rs1168103514 303 dbSNP
rs1025964302 307 dbSNP
rs1427500598 317 dbSNP
rs1407406577 322 dbSNP
rs1417381375 324 dbSNP
rs35747296 328 dbSNP
rs1161993722 329 dbSNP
rs1262898378 331 dbSNP
rs1188618335 337 dbSNP
rs997759661 338 dbSNP
rs1424496419 339 dbSNP
rs1482588682 351 dbSNP
rs1020010943 352 dbSNP
rs902103464 354 dbSNP
rs1363376106 358 dbSNP
rs1017774480 362 dbSNP
rs1009991196 363 dbSNP
rs1007691177 366 dbSNP
rs1311455633 369 dbSNP
rs893276888 375 dbSNP
rs1245033507 379 dbSNP
rs1289281197 382 dbSNP
rs1453071947 387 dbSNP
rs1222611347 389 dbSNP
rs1232453800 392 dbSNP
rs1479739452 399 dbSNP
rs1180576384 405 dbSNP
rs890604209 407 dbSNP
rs1444532679 411 dbSNP
rs1162181430 412 dbSNP
rs1387497694 414 dbSNP
rs544572606 417 dbSNP
rs181476049 424 dbSNP
rs934744193 425 dbSNP
rs900771868 426 dbSNP
rs1308260324 429 dbSNP
rs903212003 433 dbSNP
rs1358212040 435 dbSNP
rs754599185 435 dbSNP
rs1383685139 436 dbSNP
rs1228673187 438 dbSNP
rs1045759379 442 dbSNP
rs907885749 447 dbSNP
rs949992112 447 dbSNP
rs1453205788 448 dbSNP
rs917846804 465 dbSNP
rs1200649245 470 dbSNP
rs1238903288 478 dbSNP
rs144601043 483 dbSNP
rs556052232 484 dbSNP
rs993094657 485 dbSNP
rs958647991 500 dbSNP
rs909026014 505 dbSNP
rs927230245 509 dbSNP
rs978682995 510 dbSNP
rs968334751 511 dbSNP
rs1172317972 514 dbSNP
rs1400414892 516 dbSNP
rs984973217 517 dbSNP
rs558952419 522 dbSNP
rs1334698831 535 dbSNP
rs1342185551 537 dbSNP
rs1448549129 544 dbSNP
rs950486994 547 dbSNP
rs773541202 552 dbSNP
rs1220721574 556 dbSNP
rs140836016 557 dbSNP
rs1384926887 558 dbSNP
rs188645878 560 dbSNP
rs1017826885 561 dbSNP
rs1240746569 573 dbSNP
rs1478976930 579 dbSNP
rs553542472 585 dbSNP
rs1195407650 586 dbSNP
rs1423897679 596 dbSNP
rs1468890970 600 dbSNP
rs533687645 602 dbSNP
rs1184765168 609 dbSNP
rs1463007604 612 dbSNP
rs1007787212 614 dbSNP
rs1404320327 616 dbSNP
rs868048218 617 dbSNP
rs371464445 620 dbSNP
rs1030479274 631 dbSNP
rs1343229582 631 dbSNP
rs1033169025 634 dbSNP
rs35706355 640 dbSNP
rs900743669 642 dbSNP
rs184061836 643 dbSNP
rs1276657225 655 dbSNP
rs903269995 660 dbSNP
rs1006449568 661 dbSNP
rs878907286 661 dbSNP
rs1481110862 666 dbSNP
rs886414458 666 dbSNP
rs1489476119 678 dbSNP
rs1047750913 686 dbSNP
rs1045036 687 dbSNP
rs1479889880 694 dbSNP
rs545065609 705 dbSNP
rs1196703349 706 dbSNP
rs918033784 710 dbSNP
rs1314039221 712 dbSNP
rs1478037631 717 dbSNP
rs1246655591 718 dbSNP
rs1384860657 719 dbSNP
rs145070454 723 dbSNP
rs1365230325 724 dbSNP
rs1055069580 725 dbSNP
rs746789992 728 dbSNP
rs1385340577 731 dbSNP
rs192575219 732 dbSNP
rs1396848478 735 dbSNP
rs1331765446 738 dbSNP
rs937926781 753 dbSNP
rs927112730 756 dbSNP
rs909071135 758 dbSNP
rs1048885242 760 dbSNP
rs1365365443 761 dbSNP
rs1291551360 770 dbSNP
rs1164563339 779 dbSNP
rs1489948194 780 dbSNP
rs1207717159 784 dbSNP
rs1447019763 790 dbSNP
rs978651921 796 dbSNP
rs1451744309 805 dbSNP
rs568831669 806 dbSNP
rs968636229 828 dbSNP
rs1441430973 842 dbSNP
rs777916094 844 dbSNP
rs1384399941 847 dbSNP
rs1456142277 851 dbSNP
rs1165222724 854 dbSNP
rs1391713947 855 dbSNP
rs988904373 865 dbSNP
rs919016508 871 dbSNP
rs149950492 883 dbSNP
rs1030526407 884 dbSNP
rs1208303749 896 dbSNP
rs965702737 902 dbSNP
rs974523595 906 dbSNP
rs189489080 909 dbSNP
rs184119636 917 dbSNP
rs1016402384 919 dbSNP
rs1222919536 923 dbSNP
rs986816918 929 dbSNP
rs1266901834 930 dbSNP
rs547154144 934 dbSNP
rs1361570430 935 dbSNP
rs1356584154 936 dbSNP
rs1006418382 937 dbSNP
rs1235859613 941 dbSNP
rs1458677386 944 dbSNP
rs533292150 968 dbSNP
rs1242379791 971 dbSNP
rs999040366 973 dbSNP
rs564623683 976 dbSNP
rs1189338142 979 dbSNP
rs1026270602 999 dbSNP
rs967509881 1002 dbSNP
rs1014039391 1010 dbSNP
rs544345282 1012 dbSNP
rs896495225 1020 dbSNP
rs1402751376 1022 dbSNP
rs1344442703 1030 dbSNP
rs1377606503 1034 dbSNP
rs879219478 1035 dbSNP
rs938126657 1050 dbSNP
rs745845767 1053 dbSNP
rs193299226 1055 dbSNP
rs1014327885 1063 dbSNP
rs1426933378 1069 dbSNP
rs905665249 1074 dbSNP
rs894507842 1078 dbSNP
rs41287423 1079 dbSNP
rs542559137 1081 dbSNP
rs1198718180 1084 dbSNP
rs1002567608 1095 dbSNP
rs1158503570 1096 dbSNP
rs1482220281 1096 dbSNP
rs887706237 1099 dbSNP
rs187856679 1102 dbSNP
rs1427646328 1116 dbSNP
rs1191786060 1120 dbSNP
rs553713738 1124 dbSNP
rs183134955 1129 dbSNP
rs577732945 1138 dbSNP
rs1269846879 1146 dbSNP
rs1357967402 1150 dbSNP
rs1027980307 1151 dbSNP
rs944448075 1154 dbSNP
rs1468057787 1156 dbSNP
rs910251769 1172 dbSNP
rs1303885426 1187 dbSNP
rs748836716 1194 dbSNP
rs1398462639 1195 dbSNP
rs1275982264 1200 dbSNP
rs557846023 1214 dbSNP
rs1341969429 1221 dbSNP
rs1490779867 1236 dbSNP
rs537896351 1243 dbSNP
rs115436548 1248 dbSNP
rs113259722 1249 dbSNP
rs75925045 1260 dbSNP
rs1026949965 1262 dbSNP
rs967560370 1262 dbSNP
rs1013841388 1263 dbSNP
rs1265678673 1272 dbSNP
rs1459384792 1284 dbSNP
rs1221130531 1285 dbSNP
rs896454641 1286 dbSNP
rs1002685387 1287 dbSNP
rs1198919991 1287 dbSNP
rs879602817 1291 dbSNP
rs1177429809 1292 dbSNP
rs752993485 1296 dbSNP
rs567146014 1303 dbSNP
rs1042905628 1313 dbSNP
rs113629649 1318 dbSNP
rs891641161 1327 dbSNP
rs1325065894 1328 dbSNP
rs192250196 1329 dbSNP
rs1292525488 1331 dbSNP
rs1014380097 1336 dbSNP
rs1387744926 1340 dbSNP
rs958773752 1344 dbSNP
rs1469347824 1347 dbSNP
rs781569926 1348 dbSNP
rs922919585 1352 dbSNP
rs1237742453 1366 dbSNP
rs1034810866 1370 dbSNP
rs1488466441 1381 dbSNP
rs1221126897 1382 dbSNP
rs1005561945 1383 dbSNP
rs943120500 1403 dbSNP
rs536868613 1410 dbSNP
rs1191829267 1414 dbSNP
rs1250495274 1422 dbSNP
rs1438345913 1429 dbSNP
rs796250704 1429 dbSNP
rs1259521773 1433 dbSNP
rs1027593250 1435 dbSNP
rs984514210 1438 dbSNP
rs1163719125 1453 dbSNP
rs993357605 1454 dbSNP
rs1201304440 1456 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agACAUUUAUAGGGAAACGgacu 5'
            | |||| ||  ||||||    
Target 5' acUUUAAAAAU--CUUUGC---- 3'
 		18 - 34
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 55071.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 55071.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000376854.5 | 3UTR | UUUUCAACACUGACAGCACUUUAAAAAUCUUUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000376854.5 | 3UTR | UUUUCAACACUGACAGCACUUUAAAAAUCUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000376854.5 | 3UTR | UUUUCAACACUGACAGCACUUUAAAAAUCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
70 hsa-miR-4742-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT065632 CLIC4 chloride intracellular channel 4 2 4
MIRT068170 TXLNA taxilin alpha 2 2
MIRT119024 TSN translin 2 2
MIRT165212 GRAMD3 GRAM domain containing 2B 2 2
MIRT175254 PSAT1 phosphoserine aminotransferase 1 2 4
MIRT213228 REST RE1 silencing transcription factor 2 6
MIRT296337 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT316776 FOXC1 forkhead box C1 2 2
MIRT453943 XRCC6 X-ray repair cross complementing 6 2 6
MIRT454599 RPL13A ribosomal protein L13a 2 2
MIRT458485 RMI1 RecQ mediated genome instability 1 2 6
MIRT458650 SGPP2 sphingosine-1-phosphate phosphatase 2 2 2
MIRT459240 ADRBK1 G protein-coupled receptor kinase 2 2 2
MIRT461008 SYT7 synaptotagmin 7 2 2
MIRT462026 RIF1 replication timing regulatory factor 1 2 2
MIRT462103 TMEM214 transmembrane protein 214 2 2
MIRT463255 ZIC5 Zic family member 5 2 4
MIRT465190 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT470507 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT472356 TSPAN1 tetraspanin 1 2 2
MIRT473260 MIDN midnolin 2 2
MIRT477527 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 2 4
MIRT485182 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 4
MIRT486461 MDM2 MDM2 proto-oncogene 2 2
MIRT492760 PER1 period circadian clock 1 2 8
MIRT496703 TRIM39 tripartite motif containing 39 2 2
MIRT497227 MORC2 MORC family CW-type zinc finger 2 2 2
MIRT499582 INTU inturned planar cell polarity protein 2 4
MIRT504081 C9orf40 chromosome 9 open reading frame 40 2 6
MIRT505484 SRSF2 serine and arginine rich splicing factor 2 2 2
MIRT513255 FBXO17 F-box protein 17 2 2
MIRT525061 FRK fyn related Src family tyrosine kinase 2 2
MIRT528798 RAB32 RAB32, member RAS oncogene family 2 2
MIRT534357 SFT2D2 SFT2 domain containing 2 2 2
MIRT538731 CAPN1 calpain 1 2 2
MIRT550792 WARS2 tryptophanyl tRNA synthetase 2, mitochondrial 2 2
MIRT553994 SRPR SRP receptor alpha subunit 2 4
MIRT568102 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT570107 SLC18B1 solute carrier family 18 member B1 2 2
MIRT570823 RPL7L1 ribosomal protein L7 like 1 2 2
MIRT572004 HMGB1 high mobility group box 1 2 2
MIRT572352 PCYT2 phosphate cytidylyltransferase 2, ethanolamine 2 2
MIRT609716 TMEM132C transmembrane protein 132C 2 2
MIRT613982 LRRC40 leucine rich repeat containing 40 2 2
MIRT620740 CCL16 C-C motif chemokine ligand 16 2 2
MIRT625074 C15orf41 chromosome 15 open reading frame 41 2 4
MIRT627941 NNT nicotinamide nucleotide transhydrogenase 2 2
MIRT629941 IGSF6 immunoglobulin superfamily member 6 2 2
MIRT633396 FBXW8 F-box and WD repeat domain containing 8 2 2
MIRT635846 ZNF264 zinc finger protein 264 2 2
MIRT638086 ZNF652 zinc finger protein 652 2 2
MIRT643996 TCHP trichoplein keratin filament binding 2 2
MIRT660020 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 2 2
MIRT660161 BRCC3 BRCA1/BRCA2-containing complex subunit 3 2 2
MIRT668887 CSRP1 cysteine and glycine rich protein 1 2 2
MIRT676729 METTL14 methyltransferase like 14 2 2
MIRT677210 MURC caveolae associated protein 4 2 2
MIRT685949 PTGIS prostaglandin I2 synthase 2 2
MIRT687816 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 2
MIRT689900 SOD2 superoxide dismutase 2 2 2
MIRT698214 TMEM248 transmembrane protein 248 2 2
MIRT698279 TMEM2 transmembrane protein 2 2 2
MIRT698758 STK4 serine/threonine kinase 4 2 2
MIRT698789 STK38 serine/threonine kinase 38 2 2
MIRT703152 GPR137C G protein-coupled receptor 137C 2 2
MIRT704408 CTPS1 CTP synthase 1 2 2
MIRT705067 C4orf32 family with sequence similarity 241 member A 2 2
MIRT710201 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT714495 HSPA4 heat shock protein family A (Hsp70) member 4 2 2
MIRT720082 TNRC6B trinucleotide repeat containing 6B 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4742-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-4742-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4742-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4742-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-4742-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4742-5p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-4742-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-4742-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-4742-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission