miRTarBase - #MIRT504173


—
pre-miRNA Information
pre-miRNA hsa-mir-4703   
Genomic Coordinates chr13: 51552589 - 51552667
Description Homo sapiens miR-4703 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4703-3p
Sequence 49| UGUAGUUGUAUUGUAUUGCCAC |70
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1460841833 5 dbSNP
rs775733304 5 dbSNP
rs756076492 10 dbSNP
rs1378936855 11 dbSNP
rs1049480258 12 dbSNP
rs555347919 13 dbSNP
rs1343138432 18 dbSNP
rs1011011214 19 dbSNP
rs1008216326 21 dbSNP
rs1238676458 22 dbSNP
Putative Targets

Gene Information
Gene Symbol FAM127B
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 26071.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' caccgUUAUGUUAUGUUGAUGu 5'
               | |:| |  ||||||| 
Target 5' -ccagACUGCCAGCCAACUACa 3'
 		1 - 21
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000370775.2 | 3UTR | CCAGACUGCCAGCCAACUACAUCAUUCUGCCCAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
42 hsa-miR-4703-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT072026 SCP2 sterol carrier protein 2 2 2
MIRT079071 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT106648 PLEKHF2 pleckstrin homology and FYVE domain containing 2 2 4
MIRT178174 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 2
MIRT190328 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT230081 SH3BGRL SH3 domain binding glutamate rich protein like 2 2
MIRT238900 PEX3 peroxisomal biogenesis factor 3 2 2
MIRT473705 MAPK1 mitogen-activated protein kinase 1 2 6
MIRT481891 ANKRD46 ankyrin repeat domain 46 2 4
MIRT483743 ALDH9A1 aldehyde dehydrogenase 9 family member A1 2 2
MIRT488823 MRRF mitochondrial ribosome recycling factor 2 2
MIRT488990 SLC28A1 solute carrier family 28 member 1 2 2
MIRT504173 FAM127B retrotransposon Gag like 8A 2 2
MIRT524461 CMPK1 cytidine/uridine monophosphate kinase 1 2 2
MIRT529787 AP4S1 adaptor related protein complex 4 sigma 1 subunit 2 2
MIRT546449 SLC9A7 solute carrier family 9 member A7 2 2
MIRT547827 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 4
MIRT561462 TCERG1 transcription elongation regulator 1 2 2
MIRT562315 G3BP1 G3BP stress granule assembly factor 1 2 2
MIRT563644 ZNF675 zinc finger protein 675 2 2
MIRT563741 ZNF107 zinc finger protein 107 2 4
MIRT568318 BACH1 BTB domain and CNC homolog 1 2 2
MIRT571528 ZNF367 zinc finger protein 367 2 2
MIRT574840 CADM1 cell adhesion molecule 1 2 2
MIRT612262 MNT MAX network transcriptional repressor 2 4
MIRT622234 SLC25A45 solute carrier family 25 member 45 2 2
MIRT625372 IRGQ immunity related GTPase Q 2 2
MIRT628260 EFCAB14 EF-hand calcium binding domain 14 2 2
MIRT631738 NKX2-1 NK2 homeobox 1 2 2
MIRT646103 GORAB golgin, RAB6 interacting 2 2
MIRT647768 AMOTL1 angiomotin like 1 2 2
MIRT654309 RBMS3 RNA binding motif single stranded interacting protein 3 2 2
MIRT654988 PLCG2 phospholipase C gamma 2 2 2
MIRT659715 CCDC93 coiled-coil domain containing 93 2 2
MIRT666976 PHAX phosphorylated adaptor for RNA export 2 2
MIRT683247 WFDC6 WAP four-disulfide core domain 6 2 2
MIRT688424 DNAL1 dynein axonemal light chain 1 2 2
MIRT691896 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT701616 MYO1B myosin IB 2 2
MIRT702141 MAP3K1 mitogen-activated protein kinase kinase kinase 1 2 2
MIRT704403 CTPS1 CTP synthase 1 2 2
MIRT719515 RAB10 RAB10, member RAS oncogene family 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4703 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-4703-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4703-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-4703-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission