miRTarBase - #MIRT504195


—
pre-miRNA Information
pre-miRNA hsa-mir-4259   
Genomic Coordinates chr1: 159899979 - 159900079
Description Homo sapiens miR-4259 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4259
Sequence 70| CAGUUGGGUCUAGGGGUCAGGA |91
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1237551241 4 dbSNP
rs772339482 8 dbSNP
rs1314022637 15 dbSNP
rs1414601728 19 dbSNP
rs746067692 20 dbSNP
rs779101228 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FAM127B
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 26071.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agGACUGGGGAUCUGGGUUGAc 5'
            | |||: | ||  |||||| 
Target 5' -cCAGACUGCCAG--CCAACUa 3'
 		1 - 19
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000370775.2 | 3UTR | CCAGACUGCCAGCCAACUACAUCAUUCUGCCCAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
40 hsa-miR-4259 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT074403 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT082380 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 2 6
MIRT224489 NDRG1 N-myc downstream regulated 1 2 2
MIRT227807 GTF3C4 general transcription factor IIIC subunit 4 2 2
MIRT293253 DR1 down-regulator of transcription 1 2 2
MIRT455060 MEN1 menin 1 2 2
MIRT459206 RCE1 Ras converting CAAX endopeptidase 1 2 2
MIRT464866 UBB ubiquitin B 2 8
MIRT464897 UBALD1 UBA like domain containing 1 2 2
MIRT467210 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT467749 SLC36A1 solute carrier family 36 member 1 2 2
MIRT470565 POU2F1 POU class 2 homeobox 1 2 2
MIRT473523 MAX MYC associated factor X 2 2
MIRT474955 KCTD10 potassium channel tetramerization domain containing 10 2 4
MIRT478575 CTNND1 catenin delta 1 2 2
MIRT479952 CBX4 chromobox 4 2 6
MIRT486151 SIX5 SIX homeobox 5 2 6
MIRT488836 MRRF mitochondrial ribosome recycling factor 2 2
MIRT489466 MSC musculin 2 2
MIRT498922 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT501166 SLC10A7 solute carrier family 10 member 7 2 6
MIRT504195 FAM127B retrotransposon Gag like 8A 2 2
MIRT507342 FAM168A family with sequence similarity 168 member A 2 2
MIRT512629 GPX1 glutathione peroxidase 1 2 4
MIRT514365 UBBP4 ubiquitin B pseudogene 4 2 6
MIRT523321 H3F3B H3 histone family member 3B 2 2
MIRT529793 AP4S1 adaptor related protein complex 4 sigma 1 subunit 2 2
MIRT544301 TSPYL1 TSPY like 1 2 2
MIRT552985 VAT1 vesicle amine transport 1 2 2
MIRT562785 LIMA1 LIM domain and actin binding 1 2 2
MIRT653090 SSR3 signal sequence receptor subunit 3 2 2
MIRT661985 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 4
MIRT666982 PHAX phosphorylated adaptor for RNA export 2 2
MIRT683255 WFDC6 WAP four-disulfide core domain 6 2 2
MIRT684051 FOLR1 folate receptor 1 2 2
MIRT686137 B4GALT7 beta-1,4-galactosyltransferase 7 2 2
MIRT688435 DNAL1 dynein axonemal light chain 1 2 2
MIRT698391 TMED2 transmembrane p24 trafficking protein 2 2 2
MIRT698819 STK38 serine/threonine kinase 38 2 2
MIRT715754 HSD11B1L hydroxysteroid 11-beta dehydrogenase 1 like 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4259 Cisplatin 5460033 NSC119875 approved resistant High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-4259 Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PATU8988)
hsa-miR-4259 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4259 Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-4259 Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251)
hsa-mir-4259 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4259 Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-4259 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4259 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4259 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-4259 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-4259 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4259 Docetaxel+Cisplatin+5-Fluorouracil resistant tissue (hypopharyngeal squamous cell carcinoma)

Error report submission