miRTarBase - #MIRT504213


—
pre-miRNA Information
pre-miRNA hsa-mir-7107   
Genomic Coordinates chr12: 121444273 - 121444352
Description Homo sapiens miR-7107 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7107-5p
Sequence 6| UCGGCCUGGGGAGGAGGAAGGG |27
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs782634189 2 dbSNP
rs782536354 3 dbSNP
rs1230027540 4 dbSNP
rs539127530 5 dbSNP
rs782765349 9 dbSNP
rs55671311 10 dbSNP
rs183760300 11 dbSNP
rs782805318 12 dbSNP
rs782108772 19 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol VAV3   
Synonyms -
Description vav guanine nucleotide exchange factor 3
Transcript NM_001079874   
Other Transcripts NM_006113   
Expression
Putative miRNA Targets on VAV3
3'UTR of VAV3
(miRNA target sites are highlighted)		 
>VAV3|NM_001079874|3'UTR
   1 ATTCAAATCCCGTGTTGCACCCTGCACCAAAAATTTCAGAGAAGGGATAAATAGAAGCCTGCACAGCATCGTGAATTAAC
  81 TGAAGTGTTTAAAAAGCTGCATTTCTGGCTGTTCAACATCCTCCCTCCTTAGCCCCTCCTAAGTCTTAATGCTGAGATTT
 161 CTAAAGATGCTGGTACTGACAGATTAATGGCTTGCCTAGAGCTGTGCAAGAAACAGCCTGCCAGTCTGTCATTGTCAGGG
 241 ACCAGGGCAAAACCAAGAGCTGTTCTTCCCAGAAGAGCCCTGCAAACACATTGGTTCGTGCTTCCCTTTACTTCTTCTGG
 321 TCAGATACCATGAATGCCAGTCATCAGTAAATCTTAATACACTTTTGCTTTATTCTCACATGCCATTCACCAGATTATTT
 401 GATGGTACAAAGAAGCAGAAGTGTAATTTTCCTTTTCCCAGCATGACGAAAAATTGGAGTTCTGCCATTTGAGCAGCTTA
 481 CTGGAAAGATCCAGCCTTACTTGTCTTAAATTGTCCAACAAGGTGACTCATTGCCCGGCAAACACTTTTACCCTCAGATG
 561 TTACTCATGATATTATAAAATATGAGGCCAGTGCTCAGGTTTGCATCATAAGTGAGCTATCCCTGAAGGGTTTTAATTAC
 641 TTATTTGGTGTCCTGATTATATTTGCAAACTTCTTTATAAAAGGTGAAAAAAGCACACAAAAGAGAGGGTGTCTTCATAT
 721 TAAACCTTCACAACCTTCATGATTTCATAGGATTATTTTGGAAATATAGCACTTGACTTTATGAAAGGATCTGGGCTAGG
 801 TATATTAAGGGTAGTTGCCAATAACCTGAAGAAGCTGGCATTGTTTACAGAAACAGATCAAGGGCTATAATTTATGTCAT
 881 TTTATAGCAGCAGTATCTATTAATACATGCCTTTTCCTCCCATCCACCTCCCCCGCACACACACAAAGATGACCTGGGAC
 961 ATGATTTTTTTATTCCCACATTTTCTTGGAGCACAAACAACTTTGTTGAGGATTTTGGAAGGAAAGCACAACTGGGTCCT
1041 TTATTCATTTCTGGGACAGAAAGAGGGTCAGTGGACTTTTGTGGGCCTCCAGCTTCTCTCAGAGTCTCCCCCTCTGCAGC
1121 CCATCCTGGGAGTGTATTAACTGGAGGGAAGATGGGTCTTGCAGTACATTTGTTTTGCCCAGCCATCACTCTTTTTTGTG
1201 AGGAGCCTAAATACATTCTTCCTGGGGTCCAGAGTCCCCATTCAAGGCAGTCAAGTTAAGACACTAACTTGGCCCTTTCC
1281 TGATGGAAATATTTCCTCCATAGCAGAAGTTGTGTTCTGACAAGACTGAGAGAGTTACATGTTGGGAAAAAAAAGAAGCA
1361 TTAACTTAGTAGAACTGAACCAGGAGCATTAAGTTCTGAAATTTTGAATCATCTCTGAAATGAAGCAGGTGTAGCCTGCC
1441 CTCTCATCAATCCGTCTGGGTGCCAGAACTCAAGGTTCAGTGGACACATCCCCCTGTTAGAGACCCTCATGGGCTAGGAC
1521 TTTTCATCTAGGATAGATTCAAGACCTTTACCTCAGAATTATGTAAACTGTGATTGTGTTTTAGAAAAATTATTATTTGC
1601 TAAAACCATTTAAGTCTTTGTATATGTGTAAATGATCACAAAAATGTATTTTATAAAATGTTCTGTACAATAAAGTTACA
1681 CCTCAAAGTGTACTCTTGGAATGGATTCTTTCCTGTAAAGTCTTATCTGCGACTCTGTCTCGGGAATGTTTTGTCTGTTG
1761 CCGTCAGCCGAACTTTGTTATGGAGGGAGCAGCCTCACACAAGCAGAAACACTCCTGTGGATGGTATTGTAGCATGTATT
1841 GTTTATTTTAGTCAATAGACCCTCTCCTTATAAATGGTGTTTAGTCTTCCTGTTGCATTTCATGGGCCTGGGGGTTTCCT
1921 AGCAGAGGATATTGGAGCCCCTTTTTGTGACATTACCAATTACATCTTTGTCCACGTTTAATACTTTGTTTTGGAAAATT
2001 TAAATGCTGCAGATTTGTGTAGAGTTCTAATACCAAAGACAGAAGTAAATGTTTTCCATATACTTTGTCTTGCCTGTATG
2081 CAGCCCTCGTGTAATACGGTGAATTAGAGTGGTATTTCACTTTGTATTATTTTGTAAATATGTCAATATAATAAATAGTG
2161 ACTAAATTGATAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gggaAGGAGGAGGGGUCCGGcu 5'
              ||| ||||: ||| ||  
Target 5' agtcTCCCCCTCTGCAGCCCat 3'
 1103 - 1124 118.00 -19.10
2 
miRNA  3' ggGAAGGAGGAGGG--GUCCGGCu 5'
            :|||||::||||  || | || 
Target 5' atTTTCCTTTTCCCAGCATGACGa 3'
 426 - 449 114.00 -21.00
3 
miRNA  3' ggGAAGGA-GGAGGGGUCCGGcu 5'
            | |||| |||||::|| ||  
Target 5' aaCATCCTCCCTCCTTAGCCCct 3'
 115 - 137 112.00 -21.16
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31502367 4 COSMIC
COSN31586685 9 COSMIC
COSN30190063 11 COSMIC
COSN30157171 14 COSMIC
COSN30530097 39 COSMIC
COSN30467196 41 COSMIC
COSN28890895 48 COSMIC
COSN31497903 59 COSMIC
COSN30496500 66 COSMIC
COSN16130371 71 COSMIC
COSN30121012 73 COSMIC
COSN30145613 97 COSMIC
COSN5997710 200 COSMIC
COSN31604784 201 COSMIC
COSN31558367 297 COSMIC
COSN22830101 306 COSMIC
COSN30110134 312 COSMIC
COSN14630292 412 COSMIC
COSN27551202 423 COSMIC
COSN26816061 430 COSMIC
COSN30159407 534 COSMIC
COSN21079365 649 COSMIC
COSN30159411 661 COSMIC
COSN31542772 909 COSMIC
COSN1400222 998 COSMIC
COSN15787954 1128 COSMIC
COSN17690417 1347 COSMIC
COSN26549757 1448 COSMIC
COSN30159373 1456 COSMIC
COSN28453565 1533 COSMIC
COSN31529579 1543 COSMIC
COSN31608378 1590 COSMIC
COSN1400221 1608 COSMIC
COSN19490088 1639 COSMIC
COSN17181578 1730 COSMIC
COSN5196995 1743 COSMIC
COSN1400220 1858 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs899446923 2 dbSNP
rs764955911 7 dbSNP
rs1313247484 9 dbSNP
rs759402727 10 dbSNP
rs776619927 11 dbSNP
rs542122942 12 dbSNP
rs746574187 17 dbSNP
rs772705792 18 dbSNP
rs771713648 25 dbSNP
rs747774059 28 dbSNP
rs1368650134 38 dbSNP
rs1192974517 39 dbSNP
rs779276047 40 dbSNP
rs755398431 41 dbSNP
rs749808685 43 dbSNP
rs1490210379 44 dbSNP
rs780763388 48 dbSNP
rs375285827 49 dbSNP
rs373579542 50 dbSNP
rs377617538 58 dbSNP
rs1057441540 61 dbSNP
rs938783918 62 dbSNP
rs1011986853 64 dbSNP
rs927349946 67 dbSNP
rs752422079 70 dbSNP
rs767367610 71 dbSNP
rs62618754 82 dbSNP
rs1430286210 87 dbSNP
rs1333171129 91 dbSNP
rs535993365 96 dbSNP
rs182104204 105 dbSNP
rs112965883 110 dbSNP
rs989420542 114 dbSNP
rs112107766 115 dbSNP
rs1024102601 121 dbSNP
rs754798816 123 dbSNP
rs1459449943 125 dbSNP
rs546353195 149 dbSNP
rs956791059 151 dbSNP
rs1248147881 162 dbSNP
rs1480462582 167 dbSNP
rs143546591 173 dbSNP
rs17019458 185 dbSNP
rs1334557922 194 dbSNP
rs1473540188 198 dbSNP
rs1240388647 204 dbSNP
rs1406976053 209 dbSNP
rs1192088612 220 dbSNP
rs886186908 231 dbSNP
rs1451421854 239 dbSNP
rs1405589169 258 dbSNP
rs1302654247 261 dbSNP
rs189767773 262 dbSNP
rs745658316 269 dbSNP
rs1288616864 276 dbSNP
rs1210073527 279 dbSNP
rs1048831852 287 dbSNP
rs1280709403 294 dbSNP
rs188091969 298 dbSNP
rs1258507678 307 dbSNP
rs954488718 313 dbSNP
rs1490419039 314 dbSNP
rs1221018719 317 dbSNP
rs532627404 321 dbSNP
rs574887881 324 dbSNP
rs1266156824 331 dbSNP
rs1377622751 334 dbSNP
rs1483789612 340 dbSNP
rs1182424415 342 dbSNP
rs1363203875 345 dbSNP
rs1468380072 356 dbSNP
rs1164812896 361 dbSNP
rs1028679964 362 dbSNP
rs1311406281 375 dbSNP
rs1438391539 377 dbSNP
rs1330306396 387 dbSNP
rs1324383306 390 dbSNP
rs1411806851 402 dbSNP
rs1040335383 422 dbSNP
rs554999439 431 dbSNP
rs942978542 436 dbSNP
rs1335722623 438 dbSNP
rs1440413224 439 dbSNP
rs538183134 444 dbSNP
rs899350615 445 dbSNP
rs946234154 447 dbSNP
rs569111481 448 dbSNP
rs1343654559 450 dbSNP
rs552120373 456 dbSNP
rs774325091 471 dbSNP
rs1189292345 474 dbSNP
rs957581465 475 dbSNP
rs748820963 477 dbSNP
rs1057163885 480 dbSNP
rs770880777 480 dbSNP
rs1183207538 489 dbSNP
rs1383667099 494 dbSNP
rs368091734 495 dbSNP
rs927256591 498 dbSNP
rs1396337585 500 dbSNP
rs1408721878 510 dbSNP
rs971292158 512 dbSNP
rs1383973641 518 dbSNP
rs1452432835 522 dbSNP
rs1024218504 524 dbSNP
rs3187207 536 dbSNP
rs755527195 537 dbSNP
rs1337288201 539 dbSNP
rs1202100293 540 dbSNP
rs1263738274 546 dbSNP
rs947418853 551 dbSNP
rs886303044 558 dbSNP
rs1241473648 563 dbSNP
rs1027799875 567 dbSNP
rs1287991296 570 dbSNP
rs994616687 572 dbSNP
rs900137130 589 dbSNP
rs1474501789 606 dbSNP
rs1179182908 607 dbSNP
rs1344018968 611 dbSNP
rs915081911 628 dbSNP
rs989716544 644 dbSNP
rs17236113 646 dbSNP
rs1386170633 647 dbSNP
rs1438847157 664 dbSNP
rs923840301 666 dbSNP
rs1386601845 669 dbSNP
rs561891598 682 dbSNP
rs78755947 687 dbSNP
rs140026517 693 dbSNP
rs891381167 693 dbSNP
rs1297853088 694 dbSNP
rs146083978 698 dbSNP
rs954394274 703 dbSNP
rs1234842149 704 dbSNP
rs1283812866 704 dbSNP
rs1322761593 705 dbSNP
rs1051377644 708 dbSNP
rs1400613658 708 dbSNP
rs1362549407 709 dbSNP
rs1028585134 717 dbSNP
rs1269790261 718 dbSNP
rs1486110578 722 dbSNP
rs1205933131 725 dbSNP
rs766838325 731 dbSNP
rs963097724 735 dbSNP
rs1016468527 739 dbSNP
rs1005449693 742 dbSNP
rs1426276307 743 dbSNP
rs1430546531 748 dbSNP
rs550153997 752 dbSNP
rs936110112 758 dbSNP
rs1365908239 762 dbSNP
rs758971235 767 dbSNP
rs980126740 769 dbSNP
rs1406196000 776 dbSNP
rs1420977816 780 dbSNP
rs373675100 787 dbSNP
rs2769668 808 dbSNP
rs1044378034 810 dbSNP
rs947491284 813 dbSNP
rs563214531 818 dbSNP
rs1317273321 821 dbSNP
rs1053654190 824 dbSNP
rs1485027172 826 dbSNP
rs1224736003 827 dbSNP
rs546154570 835 dbSNP
rs3187208 842 dbSNP
rs528500620 843 dbSNP
rs1490225090 848 dbSNP
rs1197876290 850 dbSNP
rs1253342668 854 dbSNP
rs1207931766 856 dbSNP
rs1420015641 856 dbSNP
rs950532634 857 dbSNP
rs923772107 859 dbSNP
rs1441817268 861 dbSNP
rs987359773 862 dbSNP
rs1027501550 863 dbSNP
rs765520249 867 dbSNP
rs17019453 869 dbSNP
rs921645000 877 dbSNP
rs1315843135 879 dbSNP
rs1402617184 893 dbSNP
rs974374964 899 dbSNP
rs373735946 918 dbSNP
rs563642212 918 dbSNP
rs1390553724 922 dbSNP
rs1304612408 925 dbSNP
rs963190594 928 dbSNP
rs1248436241 930 dbSNP
rs1292852902 931 dbSNP
rs890153607 934 dbSNP
rs536707914 935 dbSNP
rs753959740 937 dbSNP
rs1481254697 946 dbSNP
rs1176918973 947 dbSNP
rs1248856445 948 dbSNP
rs1446882752 950 dbSNP
rs1051328282 965 dbSNP
rs1282542428 989 dbSNP
rs1016410770 991 dbSNP
rs1354977703 992 dbSNP
rs891926535 993 dbSNP
rs1054634502 996 dbSNP
rs1384704360 998 dbSNP
rs983199526 1004 dbSNP
rs1315957874 1005 dbSNP
rs570780511 1010 dbSNP
rs1226626878 1016 dbSNP
rs552512219 1019 dbSNP
rs1447921069 1030 dbSNP
rs1360204420 1033 dbSNP
rs191620266 1035 dbSNP
rs1204427813 1038 dbSNP
rs1256770005 1040 dbSNP
rs927395397 1044 dbSNP
rs1204749985 1047 dbSNP
rs368492930 1052 dbSNP
rs1400050101 1054 dbSNP
rs149593145 1055 dbSNP
rs1477983792 1063 dbSNP
rs906111612 1068 dbSNP
rs567106872 1071 dbSNP
rs544578714 1078 dbSNP
rs983303718 1081 dbSNP
rs1425120002 1091 dbSNP
rs1168204884 1106 dbSNP
rs867675651 1108 dbSNP
rs1179555534 1113 dbSNP
rs1472194144 1117 dbSNP
rs1405538799 1123 dbSNP
rs374545999 1132 dbSNP
rs1011569932 1136 dbSNP
rs1446089042 1141 dbSNP
rs575511762 1148 dbSNP
rs548896793 1151 dbSNP
rs920383379 1157 dbSNP
rs558834322 1161 dbSNP
rs1326313206 1167 dbSNP
rs1224446969 1169 dbSNP
rs1262910188 1169 dbSNP
rs934732587 1177 dbSNP
rs902350114 1183 dbSNP
rs1242384609 1187 dbSNP
rs538509454 1191 dbSNP
rs139351899 1197 dbSNP
rs747889462 1198 dbSNP
rs1175706196 1206 dbSNP
rs1426927802 1214 dbSNP
rs1020643676 1221 dbSNP
rs1010454691 1224 dbSNP
rs892047097 1225 dbSNP
rs1430053202 1231 dbSNP
rs1296439391 1234 dbSNP
rs1199471683 1240 dbSNP
rs1320336264 1243 dbSNP
rs1310875756 1254 dbSNP
rs543609836 1261 dbSNP
rs1379990359 1262 dbSNP
rs1343280396 1268 dbSNP
rs1225873160 1271 dbSNP
rs1286416497 1274 dbSNP
rs1284470960 1275 dbSNP
rs933276532 1279 dbSNP
rs552738260 1289 dbSNP
rs1376626363 1296 dbSNP
rs921840358 1298 dbSNP
rs1467528616 1300 dbSNP
rs1044436615 1306 dbSNP
rs1244952400 1312 dbSNP
rs974406135 1320 dbSNP
rs1158958727 1321 dbSNP
rs941710763 1328 dbSNP
rs1129409 1329 dbSNP
rs1408916883 1330 dbSNP
rs1802379 1331 dbSNP
rs535985544 1332 dbSNP
rs370668561 1338 dbSNP
rs1404179662 1340 dbSNP
rs908850743 1346 dbSNP
rs768422800 1347 dbSNP
rs983614699 1350 dbSNP
rs1157152392 1352 dbSNP
rs1367513776 1355 dbSNP
rs1405674672 1355 dbSNP
rs917213841 1355 dbSNP
rs950458991 1359 dbSNP
rs1035899707 1360 dbSNP
rs1444752002 1371 dbSNP
rs1280516317 1377 dbSNP
rs1372074901 1380 dbSNP
rs1413963112 1381 dbSNP
rs1237491083 1388 dbSNP
rs761872931 1393 dbSNP
rs1293556920 1403 dbSNP
rs530360002 1406 dbSNP
rs56410431 1411 dbSNP
rs1221133339 1414 dbSNP
rs970325658 1421 dbSNP
rs1047722427 1427 dbSNP
rs1437791232 1428 dbSNP
rs1023203867 1436 dbSNP
rs1011806255 1439 dbSNP
rs563299706 1446 dbSNP
rs1437652997 1449 dbSNP
rs1176976128 1451 dbSNP
rs919809531 1452 dbSNP
rs893138574 1453 dbSNP
rs74111051 1454 dbSNP
rs1263836035 1460 dbSNP
rs1425335701 1463 dbSNP
rs781683950 1475 dbSNP
rs1162762264 1484 dbSNP
rs550229468 1488 dbSNP
rs973754898 1490 dbSNP
rs999345492 1500 dbSNP
rs759493161 1504 dbSNP
rs1330217154 1505 dbSNP
rs1354291460 1513 dbSNP
rs891205375 1514 dbSNP
rs1051577275 1517 dbSNP
rs997287286 1521 dbSNP
rs1292203844 1527 dbSNP
rs900322065 1528 dbSNP
rs1238575081 1529 dbSNP
rs530552622 1531 dbSNP
rs1196288767 1533 dbSNP
rs954448915 1537 dbSNP
rs1020758011 1546 dbSNP
rs571112299 1547 dbSNP
rs1245143859 1551 dbSNP
rs1038941537 1552 dbSNP
rs987800478 1558 dbSNP
rs941924291 1578 dbSNP
rs1366791935 1590 dbSNP
rs1476461272 1598 dbSNP
rs769181464 1601 dbSNP
rs1168970016 1607 dbSNP
rs17236120 1609 dbSNP
rs1464347463 1611 dbSNP
rs1365939793 1613 dbSNP
rs1406275866 1614 dbSNP
rs1395089871 1620 dbSNP
rs1047388701 1622 dbSNP
rs1327651610 1628 dbSNP
rs1227567302 1629 dbSNP
rs1435397170 1632 dbSNP
rs1316011880 1634 dbSNP
rs1225057997 1635 dbSNP
rs1263531094 1639 dbSNP
rs929080545 1646 dbSNP
rs1164985019 1648 dbSNP
rs928355612 1665 dbSNP
rs1417347940 1668 dbSNP
rs1033247611 1669 dbSNP
rs1254384215 1676 dbSNP
rs981629755 1682 dbSNP
rs1448770518 1687 dbSNP
rs1379572106 1694 dbSNP
rs1194021377 1696 dbSNP
rs532687105 1698 dbSNP
rs1477132505 1704 dbSNP
rs1441255521 1706 dbSNP
rs1265082211 1711 dbSNP
rs906003413 1717 dbSNP
rs916051162 1720 dbSNP
rs780657392 1723 dbSNP
rs1014252925 1726 dbSNP
rs115069908 1730 dbSNP
rs376103235 1737 dbSNP
rs770804893 1738 dbSNP
rs957603106 1741 dbSNP
rs1032126686 1742 dbSNP
rs998856787 1745 dbSNP
rs749127768 1746 dbSNP
rs1406691573 1748 dbSNP
rs1283912908 1753 dbSNP
rs150886240 1762 dbSNP
rs777266713 1763 dbSNP
rs530251979 1769 dbSNP
rs376782453 1770 dbSNP
rs542013070 1775 dbSNP
rs910352499 1777 dbSNP
rs1487384683 1793 dbSNP
rs1202204168 1797 dbSNP
rs1270281050 1798 dbSNP
rs1432921843 1804 dbSNP
rs181718082 1812 dbSNP
rs758949728 1813 dbSNP
rs987301431 1814 dbSNP
rs1453998469 1834 dbSNP
rs558637805 1836 dbSNP
rs1038804274 1838 dbSNP
rs964515486 1843 dbSNP
rs1426053855 1849 dbSNP
rs1303645747 1855 dbSNP
rs1366850268 1857 dbSNP
rs988322999 1858 dbSNP
rs1308890915 1860 dbSNP
rs1336201545 1864 dbSNP
rs1241138883 1875 dbSNP
rs1006591258 1877 dbSNP
rs190950060 1880 dbSNP
rs957705633 1883 dbSNP
rs887693081 1884 dbSNP
rs1298723189 1892 dbSNP
rs1032438723 1902 dbSNP
rs747605006 1904 dbSNP
rs1293072349 1912 dbSNP
rs1488446515 1919 dbSNP
rs1189772998 1920 dbSNP
rs745880260 1924 dbSNP
rs780738472 1927 dbSNP
rs1177599996 1929 dbSNP
rs970717612 1934 dbSNP
rs1023211549 1939 dbSNP
rs1349165479 1940 dbSNP
rs1456327538 1941 dbSNP
rs1299877273 1948 dbSNP
rs1396921642 1951 dbSNP
rs141569623 1955 dbSNP
rs572795705 1959 dbSNP
rs896014040 1962 dbSNP
rs1374978389 1964 dbSNP
rs552773395 1972 dbSNP
rs1313534567 1973 dbSNP
rs139302493 1975 dbSNP
rs1458464976 1976 dbSNP
rs994006723 1978 dbSNP
rs567097555 1981 dbSNP
rs899136499 1983 dbSNP
rs1482590224 1985 dbSNP
rs916082227 1989 dbSNP
rs990329599 1992 dbSNP
rs1421600166 2000 dbSNP
rs1376031830 2004 dbSNP
rs1314315099 2010 dbSNP
rs1284743336 2011 dbSNP
rs957888776 2013 dbSNP
rs889029854 2014 dbSNP
rs1398293157 2019 dbSNP
rs750890540 2046 dbSNP
rs879458292 2051 dbSNP
rs1303699545 2053 dbSNP
rs147326269 2054 dbSNP
rs544350115 2058 dbSNP
rs779421069 2059 dbSNP
rs1298308415 2063 dbSNP
rs1319231742 2067 dbSNP
rs1218335995 2069 dbSNP
rs1383831641 2070 dbSNP
rs8676 2088 dbSNP
rs1029585429 2089 dbSNP
rs571262744 2094 dbSNP
rs996890816 2096 dbSNP
rs8458 2097 dbSNP
rs1408097988 2102 dbSNP
rs1187784358 2108 dbSNP
rs1017889783 2113 dbSNP
rs924934096 2115 dbSNP
rs1424397322 2121 dbSNP
rs532870032 2123 dbSNP
rs1431137212 2132 dbSNP
rs1195355110 2134 dbSNP
rs1470169198 2141 dbSNP
rs1006039851 2146 dbSNP
rs3790681 2148 dbSNP
rs1445839002 2150 dbSNP
rs1290717101 2158 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 10451.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 "HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10451.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293/HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1067869. RNA binding protein: AGO2. Condition:Ago2 IP-seq (asynchronous cells) HITS-CLIP data was present in GSM1067870. RNA binding protein: AGO2. Condition:Ago2 IP-seq (mitotic cells) ...

- Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology.

Article - Kishore S; Gruber AR; Jedlinski DJ; Syed et al.
- Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gggaaggaggaggggUCCGGCu 5'
                         |||||| 
Target 5' ------------caaAGGCCGa 3'
 		1 - 10
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions MCF7 , MDA-MB-231
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1395165. RNA binding protein: AGO. Condition:MCF7 AGO HITS-CLIP Replicate 3 HITS-CLIP data was present in GSM1395171. RNA binding protein: AGO. Condition:MDA-MB-231 AGO HITS-CLIP Replicate 3 ...

- Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al., 2014, Breast cancer research and treatment.

Article - Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al.
- Breast cancer research and treatment, 2014
miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.
LinkOut: [PMID: 24906430]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177605. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_7 PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8 PAR-CLIP data was present in ERX177620. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_10 PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8 PAR-CLIP data was present in ERX177609. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_11 PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7 PAR-CLIP data was present in ERX177621. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_11 PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7 PAR-CLIP data was present in ERX177633. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_11 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
Experimental Support 8 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760637. RNA binding protein: AGO2. Condition:AGO-CLIP-DU145_A PAR-CLIP data was present in SRX1760638. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3-miR148 PAR-CLIP data was present in SRX1760591. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_B PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A PAR-CLIP data was present in SRX1760597. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_C ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
Experimental Support 9 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Cardiac Tissues
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM2202479. RNA binding protein: AGO2. Condition:S4_LV_29yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202480. RNA binding protein: AGO2. Condition:S5_LV_36yo_Male_AGO2_bound_RNA ...

- Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research.

Article - Spengler RM; Zhang X; Cheng C; McLendon JM; et al.
- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000370056.4 | 3UTR | AAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGGACAUGGGUCAUUCGGUCCUGAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714643
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000370056.4 | 3UTR | AAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGGACAUGGGUCAUUCGGUCCUGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1067869
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (asynchronous cells)
Location of target site ENST00000370056.4 | 3UTR | AAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGGACAUGGGUCAUUCGGUCCUGAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1067870
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (mitotic cells)
Location of target site ENST00000370056.4 | 3UTR | AAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGGACAUGGGUCAUUCGGUCCUGAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000370056.4 | 3UTR | CAAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1395165
Method / RBP HITS-CLIP / AGO
Cell line / Condition MCF7 / MCF7 AGO HITS-CLIP Replicate 3
Location of target site ENST00000370056.4 | 3UTR | AAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGGACAUGGGUCAUUCGGUCCUGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24906430 / GSE57855
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1395171
Method / RBP HITS-CLIP / AGO
Cell line / Condition MDA-MB-231 / MDA-MB-231 AGO HITS-CLIP Replicate 3
Location of target site ENST00000370056.4 | 3UTR | AGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGGACAUGGGUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24906430 / GSE57855
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1013107
Method / RBP HITS-CLIP  / AGO
Cell line / Condition HUVEC / HUVEC-replicate-1
Location of target site ENST00000370056.4 | 3UTR | AAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGGACAUGGGUCAUUCGGUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24038734 / GSE41272
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1013117
Method / RBP HITS-CLIP  / AGO
Cell line / Condition TrHBMEC / TrHBMEC-replicate-2
Location of target site ENST00000370056.4 | 3UTR | AGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGGACAUGGGUCAUUCGGUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24038734 / GSE41272
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000370056.4 | 3UTR | AAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGGACAUGGGUCAUUCGGUCCUGAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000370056.4 | 3UTR | AAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGGACAUGGGUCAUUCGGUCCUGAGAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000370056.4 | 3UTR | AAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGGACAUGGGUCAUUCGGUCCUGAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000370056.4 | 3UTR | AACUUCAAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGGACAUGGGUCAUUCGGUCCUGAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 14 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000370056.4 | 3UTR | AAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGGACAUGGGUCAUUCGGUCCUGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 15 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000370056.4 | 3UTR | GAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGGACAUGGGUCAUUCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 16 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000370056.4 | 3UTR | AAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGGACAUGGGUCAUUCGGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
144 hsa-miR-7107-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT060580 CCND1 cyclin D1 2 4
MIRT451035 ZNF610 zinc finger protein 610 2 2
MIRT485711 CASP16 caspase 16, pseudogene 2 8
MIRT488402 TDRKH tudor and KH domain containing 2 2
MIRT492084 TCF21 transcription factor 21 2 2
MIRT504213 VAV3 vav guanine nucleotide exchange factor 3 2 13
MIRT505723 SERTAD3 SERTA domain containing 3 2 4
MIRT509007 FBXO6 F-box protein 6 2 2
MIRT509843 FOS Fos proto-oncogene, AP-1 transcription factor subunit 2 2
MIRT514761 RBM4B RNA binding motif protein 4B 2 2
MIRT515664 LRRC27 leucine rich repeat containing 27 2 2
MIRT516316 F8A2 coagulation factor VIII associated 2 2 2
MIRT516342 F8A3 coagulation factor VIII associated 3 2 2
MIRT517139 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT518746 C1orf35 chromosome 1 open reading frame 35 2 2
MIRT519299 MLH1 mutL homolog 1 2 2
MIRT521527 QSOX1 quiescin sulfhydryl oxidase 1 2 4
MIRT531756 TXK TXK tyrosine kinase 2 2
MIRT542208 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT542235 FUT9 fucosyltransferase 9 2 2
MIRT542791 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT554378 SETD5 SET domain containing 5 2 2
MIRT569908 PCSK9 proprotein convertase subtilisin/kexin type 9 2 2
MIRT570222 SLC27A1 solute carrier family 27 member 1 2 2
MIRT570976 RGS19 regulator of G protein signaling 19 2 2
MIRT573046 SHMT1 serine hydroxymethyltransferase 1 2 2
MIRT574954 Vav3 vav 3 oncogene 2 8
MIRT609297 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT612990 GBX2 gastrulation brain homeobox 2 2 2
MIRT613851 SHB SH2 domain containing adaptor protein B 2 2
MIRT613935 POLR3A RNA polymerase III subunit A 2 2
MIRT614243 WDR53 WD repeat domain 53 2 4
MIRT615158 SPIB Spi-B transcription factor 2 2
MIRT616145 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT616389 C1orf87 chromosome 1 open reading frame 87 2 2
MIRT617737 ATCAY ATCAY, caytaxin 2 4
MIRT621449 TCN2 transcobalamin 2 2 2
MIRT625784 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 2 2
MIRT628556 MELK maternal embryonic leucine zipper kinase 2 2
MIRT632041 ZNF430 zinc finger protein 430 2 2
MIRT634937 GTF2H2C GTF2H2 family member C 2 4
MIRT637208 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT637610 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT637832 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT638107 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT638387 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT641689 SPCS1 signal peptidase complex subunit 1 2 2
MIRT642611 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT643850 LACTB lactamase beta 2 4
MIRT649575 PALD1 phosphatase domain containing, paladin 1 2 2
MIRT649860 WDR12 WD repeat domain 12 2 2
MIRT651026 ZNF699 zinc finger protein 699 2 2
MIRT652336 TMOD3 tropomodulin 3 2 4
MIRT653286 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 2 2
MIRT656292 METTL14 methyltransferase like 14 2 2
MIRT656458 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT659539 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 2 2
MIRT661537 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT668042 GTPBP10 GTP binding protein 10 2 2
MIRT668147 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT668800 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT669818 STOML1 stomatin like 1 2 2
MIRT670490 DCUN1D2 defective in cullin neddylation 1 domain containing 2 2 2
MIRT670615 NPHP1 nephrocystin 1 2 2
MIRT670892 CYTIP cytohesin 1 interacting protein 2 2
MIRT670943 LIPG lipase G, endothelial type 2 2
MIRT671268 MTRNR2L5 MT-RNR2-like 5 2 2
MIRT671903 GBP4 guanylate binding protein 4 2 2
MIRT672239 ABHD15 abhydrolase domain containing 15 2 2
MIRT672326 C9orf3 chromosome 9 open reading frame 3 2 2
MIRT673113 MFSD2A major facilitator superfamily domain containing 2A 2 2
MIRT674412 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 2 2
MIRT677718 IRF1 interferon regulatory factor 1 2 2
MIRT678585 PPP1R3B protein phosphatase 1 regulatory subunit 3B 2 2
MIRT678726 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT679338 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT679614 RRP36 ribosomal RNA processing 36 2 2
MIRT679695 SLC1A5 solute carrier family 1 member 5 2 4
MIRT679715 RPL24 ribosomal protein L24 2 2
MIRT680065 CD96 CD96 molecule 2 2
MIRT683379 ESR2 estrogen receptor 2 2 2
MIRT683683 MICA MHC class I polypeptide-related sequence A 2 2
MIRT683865 OCIAD1 OCIA domain containing 1 2 2
MIRT684073 TLR7 toll like receptor 7 2 2
MIRT684126 CEP104 centrosomal protein 104 2 2
MIRT684485 GPR137B G protein-coupled receptor 137B 2 2
MIRT684736 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT684778 MYO1F myosin IF 2 2
MIRT685028 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT685189 DCTN5 dynactin subunit 5 2 2
MIRT685307 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT685514 MSH3 mutS homolog 3 2 2
MIRT685702 BHMT2 betaine--homocysteine S-methyltransferase 2 2 2
MIRT685944 PTGIS prostaglandin I2 synthase 2 2
MIRT686311 VPS53 VPS53, GARP complex subunit 2 2
MIRT686686 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT687641 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT687923 HOOK3 hook microtubule tethering protein 3 2 2
MIRT688117 GEMIN8 gem nuclear organelle associated protein 8 2 2
MIRT688460 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 2 2
MIRT688629 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT688823 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT689117 ZBTB25 zinc finger and BTB domain containing 25 2 2
MIRT689166 ZNF665 zinc finger protein 665 2 2
MIRT690070 MBD1 methyl-CpG binding domain protein 1 2 2
MIRT690733 IRAK4 interleukin 1 receptor associated kinase 4 2 2
MIRT691324 KIAA1841 KIAA1841 2 2
MIRT691517 ZNF682 zinc finger protein 682 2 2
MIRT691607 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT692314 RFK riboflavin kinase 2 2
MIRT692376 LY6G5B lymphocyte antigen 6 family member G5B 2 2
MIRT692436 METTL8 methyltransferase like 8 2 2
MIRT692782 SYNPO2L synaptopodin 2 like 2 2
MIRT693136 THEM4 thioesterase superfamily member 4 2 2
MIRT693422 TECPR2 tectonin beta-propeller repeat containing 2 2 2
MIRT693871 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT694049 PRIM1 DNA primase subunit 1 2 2
MIRT694092 KIAA0930 KIAA0930 2 2
MIRT694190 ZNF347 zinc finger protein 347 2 2
MIRT695177 SLC25A33 solute carrier family 25 member 33 2 2
MIRT696180 GNB5 G protein subunit beta 5 2 2
MIRT697387 ZMAT3 zinc finger matrin-type 3 2 2
MIRT698924 SPEM1 spermatid maturation 1 2 2
MIRT699314 SLC35F5 solute carrier family 35 member F5 2 4
MIRT701106 PAPD5 poly(A) RNA polymerase D5, non-canonical 2 2
MIRT701575 MYPN myopalladin 2 2
MIRT701825 MRPL37 mitochondrial ribosomal protein L37 2 2
MIRT702047 METTL21A methyltransferase like 21A 2 2
MIRT703034 HAS2 hyaluronan synthase 2 2 4
MIRT704143 DNAL1 dynein axonemal light chain 1 2 2
MIRT704759 CDKN2AIPNL CDKN2A interacting protein N-terminal like 2 2
MIRT705079 C4orf29 abhydrolase domain containing 18 2 2
MIRT705346 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT706104 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT709070 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT709534 ZBED1 zinc finger BED-type containing 1 2 2
MIRT712356 NAT14 N-acetyltransferase 14 (putative) 2 2
MIRT713713 PAOX polyamine oxidase 2 2
MIRT714304 ZNF454 zinc finger protein 454 2 2
MIRT714919 PPP1R12C protein phosphatase 1 regulatory subunit 12C 2 2
MIRT715792 TBL3 transducin beta like 3 2 2
MIRT717376 RBM41 RNA binding motif protein 41 2 2
MIRT719069 ACOX1 acyl-CoA oxidase 1 2 2
MIRT724548 HAUS2 HAUS augmin like complex subunit 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-7107-5p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-7107-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-7107-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-7107-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-7107-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-7107-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission