miRTarBase - #MIRT504256


—
pre-miRNA Information
pre-miRNA hsa-mir-155   
Genomic Coordinates chr21: 25573980 - 25574044
Description Homo sapiens miR-155 stem-loop
Comment Human mir-155 is predicted based on homology to a cloned miR from mouse (MIR:MI0000177) .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-155-3p
Sequence 43| CUCCUACAUAUUAGCAUUAACA |64
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1181188719 6 dbSNP
rs759895287 7 dbSNP
rs200351615 8 dbSNP
rs377265631 10 dbSNP
rs1038360714 20 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BA4I1F miR-155 Safety Biomarker (SAF) Clinical/Experimental Data Expression Decrease Blood and urinary supernatants Quantitative real-time PCR
BA4I1F miR-155 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Kidney tissue Quantitative real-time PCR
Gene Information
Gene Symbol C1orf147
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 574431.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' acaAUUACGAUUAU-ACAUCCUc 5'
             ||: || ::|: ||||||| 
Target 5' guaUAGGGCAGGUGUUGUAGGAg 3'
 		4 - 26
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 574431.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000367119.1 | 3UTR | ACUGUAUAGGGCAGGUGUUGUAGGAGUAAAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000367119.1 | 3UTR | GUAUAGGGCAGGUGUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000367119.1 | 3UTR | ACUGUAUAGGGCAGGUGUUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.632 1.0e-2 0.588 1.7e-2 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.422 2.0e-2 -0.485 8.1e-3 24 Click to see details
GSE38226 Liver fibrosis -0.157 2.5e-1 -0.286 1.0e-1 21 Click to see details
GSE28544 Breast cancer -0.052 4.0e-1 -0.053 4.0e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
73 hsa-miR-155-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005808 IRAK3 interleukin 1 receptor associated kinase 3 4 1
MIRT082844 ZNF460 zinc finger protein 460 2 4
MIRT256047 UBE2K ubiquitin conjugating enzyme E2 K 2 4
MIRT437787 PTEN phosphatase and tensin homolog 2 1
MIRT456168 ZDHHC6 zinc finger DHHC-type containing 6 2 2
MIRT464916 TXNIP thioredoxin interacting protein 2 4
MIRT475559 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 2
MIRT499608 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT504220 MYO6 myosin VI 2 4
MIRT504256 C1orf147 chromosome 1 open reading frame 147 2 4
MIRT507642 CREBRF CREB3 regulatory factor 2 2
MIRT522858 KIAA1551 KIAA1551 2 2
MIRT527505 MYD88 myeloid differentiation primary response 88 5 2
MIRT530713 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT532851 ZNF699 zinc finger protein 699 2 2
MIRT535952 MIA3 MIA family member 3, ER export factor 2 2
MIRT539041 ATXN1L ataxin 1 like 2 4
MIRT556391 LUC7L LUC7 like 2 2
MIRT558617 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 2
MIRT559869 ATXN3 ataxin 3 2 2
MIRT569208 SHC3 SHC adaptor protein 3 2 2
MIRT573122 C18orf25 chromosome 18 open reading frame 25 2 2
MIRT575076 Ddit4 DNA-damage-inducible transcript 4 2 2
MIRT607597 ABCF3 ATP binding cassette subfamily F member 3 2 6
MIRT609386 PHEX phosphate regulating endopeptidase homolog X-linked 2 2
MIRT610550 MDN1 midasin AAA ATPase 1 2 2
MIRT612390 TCF7L2 transcription factor 7 like 2 2 2
MIRT612910 GTDC1 glycosyltransferase like domain containing 1 2 6
MIRT613314 ARL5C ADP ribosylation factor like GTPase 5C 2 2
MIRT613356 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 2 4
MIRT613541 CLMP CXADR like membrane protein 2 2
MIRT617029 SYT6 synaptotagmin 6 2 2
MIRT618044 MRVI1 murine retrovirus integration site 1 homolog 2 2
MIRT619307 KIRREL kirre like nephrin family adhesion molecule 1 2 2
MIRT623209 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT625448 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT634551 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT640740 EPB41 erythrocyte membrane protein band 4.1 2 2
MIRT640906 RAB13 RAB13, member RAS oncogene family 2 2
MIRT644025 ZNF792 zinc finger protein 792 2 2
MIRT651489 WT1 Wilms tumor 1 2 2
MIRT652037 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT669093 CDK6 cyclin dependent kinase 6 2 2
MIRT696720 WNT3 Wnt family member 3 2 2
MIRT698085 TPM1 tropomyosin 1 2 2
MIRT703284 GID4 GID complex subunit 4 homolog 2 2
MIRT707183 ARHGEF33 Rho guanine nucleotide exchange factor 33 2 2
MIRT710362 CREB5 cAMP responsive element binding protein 5 2 2
MIRT713501 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT717153 LRRC3C leucine rich repeat containing 3C 2 2
MIRT719038 ATP1A1 ATPase Na+/K+ transporting subunit alpha 1 2 2
MIRT719489 LSG1 large 60S subunit nuclear export GTPase 1 2 2
MIRT720284 DPYSL3 dihydropyrimidinase like 3 2 2
MIRT732474 NLRP3 NLR family pyrin domain containing 3 2 0
MIRT732620 MS multiple sclerosis 1 0
MIRT732968 TGFBR2 transforming growth factor beta receptor 2 3 0
MIRT733063 AGTR1 angiotensin II receptor type 1 3 0
MIRT733206 ADAM10 ADAM metallopeptidase domain 10 1 0
MIRT733302 CRP C-reactive protein 2 0
MIRT734202 PDCD4 programmed cell death 4 3 0
MIRT734467 SIRT1 sirtuin 1 2 0
MIRT734701 Foxo3 forkhead box O3 1 0
MIRT734889 SP4 Sp4 transcription factor 2 0
MIRT735047 BATF basic leucine zipper ATF-like transcription factor 1 0
MIRT735048 SPI1 Spi-1 proto-oncogene 1 0
MIRT735734 PICALM phosphatidylinositol binding clathrin assembly protein 3 0
MIRT735944 TNF tumor necrosis factor 1 0
MIRT736131 MYLK myosin light chain kinase 2 0
MIRT736780 FOXP3 forkhead box P3 1 0
MIRT736781 CEBPB CCAAT/enhancer binding protein beta 1 0
MIRT736858 WEE1 WEE1 G2 checkpoint kinase 2 0
MIRT736873 TLR3 toll like receptor 3 2 0
MIRT736902 CFH complement factor H 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-155 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-155 Cyclophosphamide approved 2907 Quantitative real-time PCR p53+/+ pregnant mice 20170545 2010 down-regulated
miR-155 Estrogen NULL NULL Microarray mouse uterus 20720260 2010 up-regulated
miR-155 Estrogen NULL NULL Quantitative real-time PCR mouse uterus 20720260 2010 up-regulated
miR-155 Camptothecin NULL 24360 Microarray human cancer cells 24252850 2014 down-regulated
miR-155 Cocaine NULL 446220 Quantitative real-time PCR monocyte derived dendritic cells 24391808 2014 down-regulated
miR-155 Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-155 Triptolide NULL 107985 Quantitative real-time PCR peripheral blood mononuclear cells (PBMCs) of RA (rheumatoid arthritis) 24909288 2014 down-regulated
miR-155 Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
miR-155 Lithium (Li) approved 3028194 Quantitative real-time PCR lymphoblastoid cell lines (LCLs) 19254429 2009 up-regulated
miR-155 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 down-regulated
miR-155 Bisphenol A NULL 6623 Microarray immortalized cytotrophoblast cell lines HTR-8 20417706 2010 up-regulated
miR-155 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-155 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 down-regulated
miR-155 Gemcitabine approved 60750 Quantitative real-time PCR pancreatic cancer 21738581 2011 down-regulated
miR-155 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-155 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-155 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-155 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 up-regulated
miR-155 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 up-regulated
miR-155 Glucocorticoid NULL NULL Microarray RAW264.7 cells 22326887 2012 down-regulated
miR-155 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-155 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-155 Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-155 Adrenaline approved 5816 Quantitative real-time PCR colon cancer HT29 cells 23036199 2012 up-regulated
miR-155 Leptin NULL NULL Quantitative real-time PCR muscles 20800581 2010 down-regulated
miR-155 Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 up-regulated
miR-155 Sinomenine NULL 5459308 Quantitative real-time PCR Colitis 24066068 2013 down-regualted
miR-155 Praziquantel approved 4891 Quantitative real-time PCR liver cell lines 25051829 2014 down-regualted
miR-155 Uric acid NULL 1175 Quantitative real-time PCR endothelial cells 23996753 2013 up-regualted
miR-155 Hydroxychloroquine approved 3652 Microarray mesangial cells 24121037 2013 down-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-155 Tripterygium wilfordii Hook F resistant tissue
hsa-mir-155 Doxorubicin 31703 NSC123127 approved resistant cell line (W1)
hsa-mir-155 Vincristine 5978 approved resistant cell line (W1)
hsa-mir-155 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-155-3p Cisplatin 5460033 NSC119875 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-miR-155-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-155-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H358, H1993)
hsa-miR-155-3p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MCF-7, SKBR3, MDA-MB-231)
hsa-miR-155-3p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (A172, U87)
hsa-miR-155-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-155-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-155-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-155-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-155-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-155-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-155-3p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-155-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission