miRTarBase - #MIRT504616


—
pre-miRNA Information
pre-miRNA hsa-mir-4660   
Genomic Coordinates chr8: 9048445 - 9048518
Description Homo sapiens miR-4660 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4660
Sequence 9| UGCAGCUCUGGUGGAAAAUGGAG |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs559566816 2 dbSNP
rs1206645118 3 dbSNP
rs1022883625 18 dbSNP
rs968295961 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PLK1   
Synonyms PLK, STPK13
Description polo like kinase 1
Transcript NM_005030   
Expression
Putative miRNA Targets on PLK1
3'UTR of PLK1
(miRNA target sites are highlighted)		 
>PLK1|NM_005030|3'UTR
   1 TAGCTGCCCTCCCCTCCGGACTGGTGCCCTCCTCACTCCCACCTGCATCTGGGGCCCATACTGGTTGGCTCCCGCGGTGC
  81 CATGTCTGCAGTGTGCCCCCCAGCCCCGGTGGCTGGGCAGAGCTGCATCATCCTTGCAGGTGGGGGTTGCTGTATAAGTT
 161 ATTTTTGTACATGTTCGGGTGTGGGTTCTACAGCCTTGTCCCCCTCCCCCTCAACCCCACCATATGAATTGTACAGAATA
 241 TTTCTATTGAATTCGGAACTGTCCTTTCCTTGGCTTTATGCACATTAAACAGATGTGAATATTCAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaGGUAAAAGG-UGGUCUCGACGu 5'
            ||: |  |: : ||||||||| 
Target 5' ccCCGGTGGCTGGGCAGAGCTGCa 3'
 104 - 127 153.00 -21.50
2 
miRNA  3' gagguaaaagguggucUCGACGu 5'
                          |||||| 
Target 5' ---------------tAGCTGCc 3'
 1 - 8 120.00 -6.60
3 
miRNA  3' gaGGUA-AAAGGU--GGUCUCGACGu 5'
            :|||  || ||  : :|:|:||| 
Target 5' caTCATCCTTGCAGGTGGGGGTTGCt 3'
 126 - 151 119.00 -11.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30105320 3 COSMIC
COSN30489212 14 COSMIC
COSN31533391 18 COSMIC
COSN30100936 41 COSMIC
COSN30171687 50 COSMIC
COSN20945411 58 COSMIC
COSN21155734 72 COSMIC
COSN29513387 73 COSMIC
COSN30747352 74 COSMIC
COSN28617157 75 COSMIC
COSN31578436 76 COSMIC
COSN24393275 77 COSMIC
COSN32067634 105 COSMIC
COSN28772595 107 COSMIC
COSN19727361 108 COSMIC
COSN31603000 174 COSMIC
COSN9091913 247 COSMIC
COSN31571454 255 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs912897939 2 dbSNP
rs1311646227 5 dbSNP
rs1183110333 7 dbSNP
rs759718205 10 dbSNP
rs1396740266 12 dbSNP
rs375371315 13 dbSNP
rs1305778240 14 dbSNP
rs148809210 18 dbSNP
rs371615853 19 dbSNP
rs1362637363 20 dbSNP
rs1344099472 21 dbSNP
rs764357662 32 dbSNP
rs756878874 34 dbSNP
rs1485955793 39 dbSNP
rs200807454 40 dbSNP
rs745344825 44 dbSNP
rs1427367563 51 dbSNP
rs1193502911 54 dbSNP
rs115943337 59 dbSNP
rs1432077073 63 dbSNP
rs931257241 64 dbSNP
rs1172155341 67 dbSNP
rs779912371 68 dbSNP
rs1338624029 71 dbSNP
rs746907972 72 dbSNP
rs1305055607 74 dbSNP
rs2230915 75 dbSNP
rs541916380 76 dbSNP
rs561786165 77 dbSNP
rs530916260 79 dbSNP
rs1231896097 81 dbSNP
rs1302419738 83 dbSNP
rs1312499631 87 dbSNP
rs544604911 93 dbSNP
rs767691125 95 dbSNP
rs766871722 96 dbSNP
rs775702940 97 dbSNP
rs1208794902 98 dbSNP
rs1387482862 101 dbSNP
rs761051290 102 dbSNP
rs1802572 107 dbSNP
rs764707657 108 dbSNP
rs754099077 109 dbSNP
rs901302765 112 dbSNP
rs564820510 116 dbSNP
rs764805610 120 dbSNP
rs750094170 123 dbSNP
rs533422133 124 dbSNP
rs547221953 133 dbSNP
rs1321295875 136 dbSNP
rs1390842065 137 dbSNP
rs1439005012 140 dbSNP
rs754851291 141 dbSNP
rs1368087007 143 dbSNP
rs78049595 144 dbSNP
rs1028552208 147 dbSNP
rs1448349421 148 dbSNP
rs1316264644 153 dbSNP
rs1228856341 154 dbSNP
rs27770 155 dbSNP
rs1466710618 156 dbSNP
rs1209007439 162 dbSNP
rs1354012457 168 dbSNP
rs1212714598 177 dbSNP
rs769722618 177 dbSNP
rs373051341 178 dbSNP
rs1489040865 180 dbSNP
rs1356118867 183 dbSNP
rs1193277742 186 dbSNP
rs1050294 189 dbSNP
rs1406516082 190 dbSNP
rs1021299648 192 dbSNP
rs956838996 201 dbSNP
rs1160482541 202 dbSNP
rs988981078 203 dbSNP
rs1414313132 204 dbSNP
rs1347174679 209 dbSNP
rs912956950 211 dbSNP
rs1405075071 215 dbSNP
rs558525437 216 dbSNP
rs1167679718 217 dbSNP
rs567994154 219 dbSNP
rs1462445113 220 dbSNP
rs1423606513 222 dbSNP
rs1190837612 226 dbSNP
rs1042717415 227 dbSNP
rs1242280243 229 dbSNP
rs537072214 231 dbSNP
rs114601938 239 dbSNP
rs773170164 244 dbSNP
rs1040949508 247 dbSNP
rs570733642 255 dbSNP
rs555101658 256 dbSNP
rs1354797494 257 dbSNP
rs1247436102 259 dbSNP
rs760437116 265 dbSNP
rs929799982 266 dbSNP
rs1047611142 267 dbSNP
rs1329660799 275 dbSNP
rs952628441 276 dbSNP
rs1269380655 283 dbSNP
rs984036530 287 dbSNP
rs539301168 300 dbSNP
rs1169181999 303 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 5347.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaGGUA-AAAGGU--GGUCUCGAcgu 5'
            :|||  || ||  : :|:|:|   
Target 5' caUCAUCCUUGCAGGUGGGGGUU--- 3'
 		1 - 23
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000300093.4 | 3UTR | CAUCAUCCUUGCAGGUGGGGGUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
73 hsa-miR-4660 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064842 ZBTB18 zinc finger and BTB domain containing 18 2 4
MIRT090784 MBNL1 muscleblind like splicing regulator 1 2 2
MIRT163239 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 2
MIRT214144 LMNB1 lamin B1 2 2
MIRT292479 ZNF507 zinc finger protein 507 2 2
MIRT306038 SKIL SKI like proto-oncogene 2 2
MIRT310459 REST RE1 silencing transcription factor 2 2
MIRT329710 SCD stearoyl-CoA desaturase 2 2
MIRT457833 ITPRIP inositol 1,4,5-trisphosphate receptor interacting protein 2 2
MIRT460747 SRP14 signal recognition particle 14 2 2
MIRT461545 ACTR3B ARP3 actin related protein 3 homolog B 2 4
MIRT486956 HLA-B major histocompatibility complex, class I, B 2 2
MIRT487933 HLA-C major histocompatibility complex, class I, C 2 2
MIRT490515 LIMD1 LIM domains containing 1 2 2
MIRT492314 SETD1B SET domain containing 1B 2 2
MIRT501513 PPTC7 PTC7 protein phosphatase homolog 2 6
MIRT504616 PLK1 polo like kinase 1 2 2
MIRT505714 SESN2 sestrin 2 2 2
MIRT506199 PHF19 PHD finger protein 19 2 2
MIRT506827 KIF23 kinesin family member 23 2 6
MIRT512815 ARRDC2 arrestin domain containing 2 2 4
MIRT527014 MAGI2 membrane associated guanylate kinase, WW and PDZ domain containing 2 2 4
MIRT528520 SLC1A7 solute carrier family 1 member 7 2 2
MIRT531346 PLEKHG4B pleckstrin homology and RhoGEF domain containing G4B 2 2
MIRT537154 GID8 GID complex subunit 8 homolog 2 2
MIRT541104 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 2 2
MIRT543397 DROSHA drosha ribonuclease III 2 2
MIRT551860 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT554775 RHEBP1 RHEB pseudogene 1 2 4
MIRT556479 LIPA lipase A, lysosomal acid type 2 2
MIRT556662 KMT2D lysine methyltransferase 2D 2 4
MIRT558213 EFCAB14 EF-hand calcium binding domain 14 2 4
MIRT558819 CDCA4 cell division cycle associated 4 2 4
MIRT559142 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT560981 ZNF333 zinc finger protein 333 2 2
MIRT562066 KLHL15 kelch like family member 15 2 2
MIRT564703 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT565904 SCAMP2 secretory carrier membrane protein 2 2 2
MIRT566320 POTEM POTE ankyrin domain family member M 2 2
MIRT566331 POTEG POTE ankyrin domain family member G 2 2
MIRT575253 Timp3 tissue inhibitor of metalloproteinase 3 2 2
MIRT609975 HERPUD2 HERPUD family member 2 2 2
MIRT614318 C1orf220 chromosome 1 open reading frame 220 2 2
MIRT618784 AGTRAP angiotensin II receptor associated protein 2 2
MIRT619894 NPTXR neuronal pentraxin receptor 2 2
MIRT631517 CTBS chitobiase 2 2
MIRT640707 MRS2 MRS2, magnesium transporter 2 2
MIRT642218 RUVBL2 RuvB like AAA ATPase 2 2 2
MIRT654661 PSMG1 proteasome assembly chaperone 1 2 2
MIRT663725 GLUL glutamate-ammonia ligase 2 2
MIRT690653 RPF2 ribosome production factor 2 homolog 2 2
MIRT703189 GPBP1 GC-rich promoter binding protein 1 2 2
MIRT705896 ADCY9 adenylate cyclase 9 2 2
MIRT706984 XPO5 exportin 5 2 2
MIRT710566 KIAA1958 KIAA1958 2 2
MIRT712526 CYTH2 cytohesin 2 2 2
MIRT714072 RUNDC3B RUN domain containing 3B 2 2
MIRT716299 PAX1 paired box 1 2 2
MIRT716748 C19orf24 chromosome 19 open reading frame 24 2 2
MIRT716933 FAM13A family with sequence similarity 13 member A 2 2
MIRT717344 RAB40A RAB40A, member RAS oncogene family 2 2
MIRT717387 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT718298 MOGAT1 monoacylglycerol O-acyltransferase 1 2 2
MIRT718569 SLC25A22 solute carrier family 25 member 22 2 2
MIRT718642 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT718690 BTBD9 BTB domain containing 9 2 2
MIRT719650 ARL3 ADP ribosylation factor like GTPase 3 2 2
MIRT721035 TRIM67 tripartite motif containing 67 2 2
MIRT721130 TLK1 tousled like kinase 1 2 2
MIRT722968 SLC25A26 solute carrier family 25 member 26 2 2
MIRT723114 ZSCAN16 zinc finger and SCAN domain containing 16 2 2
MIRT723708 RNF166 ring finger protein 166 2 2
MIRT736594 MAFG MAF bZIP transcription factor G 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4660 Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4660 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-4660 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)

Error report submission