pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3622b |
Genomic Coordinates | chr8: 27701673 - 27701767 |
Description | Homo sapiens miR-3622b stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3622b-3p | |||||||||||||||||||||||||||
Sequence | 58| UCACCUGAGCUCCCGUGCCUG |78 | |||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | CCDC86 | ||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||
Description | coiled-coil domain containing 86 | ||||||||||||||||||||
Transcript | NM_024098 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on CCDC86 | |||||||||||||||||||||
3'UTR of CCDC86 (miRNA target sites are highlighted) |
>CCDC86|NM_024098|3'UTR 1 GCTCAGGACGGCCCGAGGCCTTCCATGGCCAACAACCATGTCAGACACAGCACCTCAGGCCGCTGCTCAGATGCCTCTGC 81 TGGAGCTGGCACTCCAAACCCATGGCTCCAGAACAGGGACCCCCACCCCGACCGGGGCTCCTCGGCCTTTGAAGGCTTCC 161 AGGCAGGTCTGTGTGGGACAGAAGCCCAGAGGGGGCCTGGGACCTGGCAGAGATGGGGGCGGGAAGAGATTCAGCTCCCA 241 TCCCTCCTTCCTCTCCTTCTCCAAGTGCCTTCAAACCAAGAACTGTACATTCTTCTGGTTCCTCAGTGAGCTGGTGACTG 321 GCAGGTGACTCCCTCAGCAGTGTATGCCCTTTCTCAGCATCCTAGGTCCATCCCAGGCCTGGAGGCTGACAGTTGGGAAT 401 CCAGCTTCCCCCACACCTTCCCAAAGGCTGCTCTGAGCACCTCCACACCCCACTGCCTCTGTCCCCAGCAAACTGAATCC 481 GGTTCCTCTCCACTTTTCAATACTGAAAGATTAAAATGGGGAGGTTGCAGGGAGCAGAGCTTTTCCCTAGCACCCACTTT 561 CCCAAACCAGTCTCTGCAGAAGCCCCAGAGAATCTAACTCATGCCTGTCCAGTCTACAGCAAAAATATTTATTGAGTGCC 641 TGTTGCATACAGGCACAATCCTAGGCACCGGCAAATACAGACAATAGACCAAAGTCCCTGCCCTCGAGGAGCTTTCATTC 721 TGATGGAGAGAAAACATAATAAACAAGCAAAATGCACCACGTGAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 79080.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HCT116 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177620. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_10
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
CLIP-seq Support 1 for dataset GSM1065668 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
Location of target site | ENST00000227520.5 | 3UTR | CUGGUGACUGGCAGGUGA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1065670 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
Location of target site | ENST00000227520.5 | 3UTR | CUGGUGACUGGCAGGUGA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
102 hsa-miR-3622b-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT076713 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | 2 | 2 | ||||||||
MIRT080212 | PRKACB | protein kinase cAMP-activated catalytic subunit beta | 2 | 2 | ||||||||
MIRT081398 | GTPBP3 | GTP binding protein 3, mitochondrial | 2 | 2 | ||||||||
MIRT107158 | ZBTB43 | zinc finger and BTB domain containing 43 | 2 | 2 | ||||||||
MIRT254071 | BACH1 | BTB domain and CNC homolog 1 | 2 | 2 | ||||||||
MIRT409790 | FOXO3 | forkhead box O3 | 2 | 2 | ||||||||
MIRT448679 | MAPK9 | mitogen-activated protein kinase 9 | 2 | 2 | ||||||||
MIRT450206 | ABHD15 | abhydrolase domain containing 15 | 2 | 2 | ||||||||
MIRT486621 | PDK3 | pyruvate dehydrogenase kinase 3 | 2 | 2 | ||||||||
MIRT489267 | TTLL1 | tubulin tyrosine ligase like 1 | 2 | 2 | ||||||||
MIRT493117 | MKNK2 | MAP kinase interacting serine/threonine kinase 2 | 2 | 4 | ||||||||
MIRT494570 | BAK1 | BCL2 antagonist/killer 1 | 2 | 2 | ||||||||
MIRT497395 | RALY | RALY heterogeneous nuclear ribonucleoprotein | 2 | 2 | ||||||||
MIRT504900 | CCDC86 | coiled-coil domain containing 86 | 2 | 2 | ||||||||
MIRT505192 | USP46 | ubiquitin specific peptidase 46 | 2 | 4 | ||||||||
MIRT506522 | MSANTD4 | Myb/SANT DNA binding domain containing 4 with coiled-coils | 2 | 6 | ||||||||
MIRT508162 | ABCC5 | ATP binding cassette subfamily C member 5 | 2 | 8 | ||||||||
MIRT508545 | PARVG | parvin gamma | 2 | 4 | ||||||||
MIRT509850 | BIRC5 | baculoviral IAP repeat containing 5 | 2 | 6 | ||||||||
MIRT510088 | PPWD1 | peptidylprolyl isomerase domain and WD repeat containing 1 | 2 | 8 | ||||||||
MIRT512094 | CRK | CRK proto-oncogene, adaptor protein | 2 | 4 | ||||||||
MIRT515381 | RPL7 | ribosomal protein L7 | 2 | 2 | ||||||||
MIRT519176 | SCO1 | SCO1, cytochrome c oxidase assembly protein | 2 | 2 | ||||||||
MIRT519964 | ZCCHC8 | zinc finger CCHC-type containing 8 | 2 | 2 | ||||||||
MIRT522292 | NKAP | NFKB activating protein | 2 | 2 | ||||||||
MIRT523160 | HMGB2 | high mobility group box 2 | 2 | 4 | ||||||||
MIRT525314 | FANCA | Fanconi anemia complementation group A | 2 | 2 | ||||||||
MIRT528194 | PLEKHM2 | pleckstrin homology and RUN domain containing M2 | 2 | 2 | ||||||||
MIRT532885 | ZNF451 | zinc finger protein 451 | 2 | 2 | ||||||||
MIRT538209 | CYR61 | cysteine rich angiogenic inducer 61 | 2 | 2 | ||||||||
MIRT539497 | ACTN4 | actinin alpha 4 | 2 | 2 | ||||||||
MIRT554600 | RRAGC | Ras related GTP binding C | 2 | 2 | ||||||||
MIRT562444 | DCTN6 | dynactin subunit 6 | 2 | 2 | ||||||||
MIRT562748 | AOC3 | amine oxidase, copper containing 3 | 2 | 2 | ||||||||
MIRT565798 | SEC14L5 | SEC14 like lipid binding 5 | 2 | 2 | ||||||||
MIRT565838 | SCML2 | Scm polycomb group protein like 2 | 2 | 2 | ||||||||
MIRT566072 | RCC2 | regulator of chromosome condensation 2 | 2 | 2 | ||||||||
MIRT566104 | RBPJ | recombination signal binding protein for immunoglobulin kappa J region | 2 | 2 | ||||||||
MIRT572407 | MRPS14 | mitochondrial ribosomal protein S14 | 2 | 2 | ||||||||
MIRT576198 | Vsig2 | V-set and immunoglobulin domain containing 2 | 2 | 2 | ||||||||
MIRT576313 | Acbd7 | acyl-Coenzyme A binding domain containing 7 | 2 | 2 | ||||||||
MIRT576651 | Mill2 | MHC I like leukocyte 2 | 1 | 1 | ||||||||
MIRT576859 | Socs6 | suppressor of cytokine signaling 6 | 2 | 2 | ||||||||
MIRT606819 | BICD2 | BICD cargo adaptor 2 | 2 | 2 | ||||||||
MIRT610738 | NUDT16 | nudix hydrolase 16 | 2 | 4 | ||||||||
MIRT614798 | RORA | RAR related orphan receptor A | 2 | 2 | ||||||||
MIRT619006 | NTMT1 | N-terminal Xaa-Pro-Lys N-methyltransferase 1 | 2 | 2 | ||||||||
MIRT619420 | NOS1AP | nitric oxide synthase 1 adaptor protein | 2 | 2 | ||||||||
MIRT620405 | MYO1H | myosin IH | 2 | 2 | ||||||||
MIRT624869 | ABHD13 | abhydrolase domain containing 13 | 2 | 2 | ||||||||
MIRT633527 | ZFP30 | ZFP30 zinc finger protein | 2 | 2 | ||||||||
MIRT633927 | DNAH9 | dynein axonemal heavy chain 9 | 2 | 2 | ||||||||
MIRT636611 | CLIC5 | chloride intracellular channel 5 | 2 | 2 | ||||||||
MIRT640616 | MIOX | myo-inositol oxygenase | 2 | 2 | ||||||||
MIRT642605 | C14orf180 | chromosome 14 open reading frame 180 | 2 | 2 | ||||||||
MIRT644624 | SRSF2 | serine and arginine rich splicing factor 2 | 2 | 2 | ||||||||
MIRT655113 | PHLDA3 | pleckstrin homology like domain family A member 3 | 2 | 2 | ||||||||
MIRT658976 | DNAJB5 | DnaJ heat shock protein family (Hsp40) member B5 | 2 | 4 | ||||||||
MIRT661495 | CHMP1B | charged multivesicular body protein 1B | 2 | 2 | ||||||||
MIRT662996 | TMEM59 | transmembrane protein 59 | 2 | 2 | ||||||||
MIRT663075 | SFR1 | SWI5 dependent homologous recombination repair protein 1 | 2 | 2 | ||||||||
MIRT665405 | WEE1 | WEE1 G2 checkpoint kinase | 2 | 2 | ||||||||
MIRT666106 | SSR1 | signal sequence receptor subunit 1 | 2 | 2 | ||||||||
MIRT669562 | ALDOA | aldolase, fructose-bisphosphate A | 2 | 2 | ||||||||
MIRT670070 | ZNF783 | zinc finger family member 783 | 2 | 2 | ||||||||
MIRT671192 | ZNF891 | zinc finger protein 891 | 2 | 2 | ||||||||
MIRT675361 | KLHL26 | kelch like family member 26 | 2 | 2 | ||||||||
MIRT678857 | LINC00598 | long intergenic non-protein coding RNA 598 | 2 | 2 | ||||||||
MIRT679443 | C19orf52 | translocase of inner mitochondrial membrane 29 | 2 | 2 | ||||||||
MIRT684163 | ALDH1B1 | aldehyde dehydrogenase 1 family member B1 | 2 | 2 | ||||||||
MIRT684543 | ZNF460 | zinc finger protein 460 | 2 | 2 | ||||||||
MIRT684674 | SLC2A11 | solute carrier family 2 member 11 | 2 | 2 | ||||||||
MIRT684971 | MINOS1 | mitochondrial inner membrane organizing system 1 | 2 | 2 | ||||||||
MIRT686006 | NEK4 | NIMA related kinase 4 | 2 | 2 | ||||||||
MIRT687758 | KIAA1328 | KIAA1328 | 2 | 2 | ||||||||
MIRT688961 | ATXN3 | ataxin 3 | 2 | 2 | ||||||||
MIRT689409 | UQCR11 | ubiquinol-cytochrome c reductase, complex III subunit XI | 2 | 2 | ||||||||
MIRT690001 | MMP17 | matrix metallopeptidase 17 | 2 | 2 | ||||||||
MIRT690165 | ELP3 | elongator acetyltransferase complex subunit 3 | 2 | 2 | ||||||||
MIRT690202 | C5orf45 | MRN complex interacting protein | 2 | 2 | ||||||||
MIRT690477 | ZNF33A | zinc finger protein 33A | 2 | 2 | ||||||||
MIRT690566 | MICA | MHC class I polypeptide-related sequence A | 2 | 2 | ||||||||
MIRT692160 | C10orf111 | chromosome 10 open reading frame 111 | 2 | 2 | ||||||||
MIRT693430 | PLGLB2 | plasminogen-like B2 | 2 | 2 | ||||||||
MIRT693547 | ZNF708 | zinc finger protein 708 | 2 | 2 | ||||||||
MIRT693697 | PLGLB1 | plasminogen-like B1 | 2 | 2 | ||||||||
MIRT695006 | HSPA6 | heat shock protein family A (Hsp70) member 6 | 2 | 2 | ||||||||
MIRT698525 | TFRC | transferrin receptor | 2 | 2 | ||||||||
MIRT699574 | SIKE1 | suppressor of IKBKE 1 | 2 | 2 | ||||||||
MIRT703446 | FYTTD1 | forty-two-three domain containing 1 | 2 | 2 | ||||||||
MIRT704397 | CTSS | cathepsin S | 2 | 2 | ||||||||
MIRT704485 | CPT1A | carnitine palmitoyltransferase 1A | 2 | 2 | ||||||||
MIRT709822 | STPG1 | sperm tail PG-rich repeat containing 1 | 2 | 2 | ||||||||
MIRT710859 | COQ7 | coenzyme Q7, hydroxylase | 2 | 2 | ||||||||
MIRT711893 | INSIG2 | insulin induced gene 2 | 2 | 2 | ||||||||
MIRT713796 | CPLX2 | complexin 2 | 2 | 2 | ||||||||
MIRT718800 | C1GALT1C1 | C1GALT1 specific chaperone 1 | 2 | 2 | ||||||||
MIRT719501 | SEC24B | SEC24 homolog B, COPII coat complex component | 2 | 2 | ||||||||
MIRT719722 | PDE6B | phosphodiesterase 6B | 2 | 2 | ||||||||
MIRT722204 | URM1 | ubiquitin related modifier 1 | 2 | 2 | ||||||||
MIRT723523 | CLPTM1L | CLPTM1 like | 2 | 2 | ||||||||
MIRT725471 | GRAP2 | GRB2-related adaptor protein 2 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|