miRTarBase - #MIRT505628


—
pre-miRNA Information
pre-miRNA hsa-mir-656   
Genomic Coordinates chr14: 101066724 - 101066801
Synonyms MIRN656, hsa-mir-656, MIR656
Description Homo sapiens miR-656 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-656-3p
Sequence 43| AAUAUUAUACAGUCAACCUCU |63
Evidence Experimental
Experiments Microarray
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs774217405 2 dbSNP
rs761669303 7 dbSNP
rs767470396 8 dbSNP
rs563910660 14 dbSNP
rs1289907362 17 dbSNP
rs1329300008 19 dbSNP
rs375626394 20 dbSNP
rs185468172 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC16A1   
Synonyms HHF7, MCT, MCT1, MCT1D
Description solute carrier family 16 member 1
Transcript NM_003051   
Other Transcripts NM_001166496   
Expression
Putative miRNA Targets on SLC16A1
3'UTR of SLC16A1
(miRNA target sites are highlighted)		 
>SLC16A1|NM_003051|3'UTR
   1 ATCCATGGGGCTGAAGGGTAAATTGAGCAGTTCATGACCCAGGATATCTGAAAATATTCTACTGGCCTGTAATCTACCAG
  81 TGGTGCTCAATGCAAATAGTAGACATTTGTGTGGAAATCATACCAGTTGTTCATTGATGGGATTTTTGTTTGACTCCTTA
 161 CCAATAGCCTGAATTTGAGGAGGGAATGATTGGTAGCAAAGGATGGGGGAAAGAAGTAGGTTCTGTTTTGTTTTGTTTTA
 241 ATCTTAGCTTTTAATAGTGTCATAAAGATTATAATATGTGCCTTAAGTTTTAGTCTTTAGAACTCTAGAGAGCCTTAACT
 321 TCTTAAACCATTTTTGCTGAATTCATCTATTTCGAGTGTTGTGTTAAAAGGAAAAATAACAACTAACTTGTTTGAGGCAA
 401 ATCTAAAATTTAAAATTAATCTTGCTTCATTGTTACATGTAATATATTTCAGACATTTTCACTGGAAGATTTATGAACAG
 481 AAATATTGGTTGAAAGTTAGAGATTTTACAAAATGCTGACAAAAATATTTTCCTAGCATCAGTAGATTTCTGGCATATGT
 561 TTCTGCTAGCTATATATTTAGGAAATTCAAAGCATAAAACTTTGGCAACATCTTGGCTGTTCTAGACACAGTGTACTTGT
 641 CAACCCCTCTCAGGTACCTTTTCTTGGGATGCTTATTAGAAGCCAAGTAAAGTGCTTAAGGTTTGTTTTCATTAAATTAG
 721 CTATTTCTGCTCCCCTGTTCAAAGATGCATTTTGAGTGTTTATAGATCACTGCCCTTTTTGAAATCACCTGGTATTATTT
 801 TTCTTACTGGAAAAGTTAGTATTAAAATCTACAGAACTACATATTTGTGCCTCCTTGGTAAATACAACACATCTAATTAA
 881 ATGTAGACAGATATTTCAAACATCAGCTGAATTCACTTAAGTTTTTCCAAAACCTCAGTTAAACTGTGAAGCTATTGGAA
 961 TTTTTTTTTCCTGGAATTTTTCCCCTTTGATTCACAGTGGTCCCATTTATATCTGCTTCTAGCTTAGTGCTATGTGTGAG
1041 ATATGTGTGTGTTTGGTGTTTTTGTTTTTTTGTTTTTTTTTTTTTAAGGTTTGCAAATTAAAAAGGGCCAGAAAAATTTG
1121 GCACCAGGCAAACGAATAAAGATAGGATTGGGAAAGAAGTTGCTAAGTGTGCTTAGTTTTAATAAGTAATTCCTTCTCTT
1201 TTTTCAGAGAAGGCCTTACAGAAAATTGTTGTGCTTAGAATTGCTGGATGCATTTTTACCCTCCACACAAACCTAAAAAT
1281 TTTGTGACCCCTTTCACTTACCTGAAAAGTAGAGAAATGGATTCAGTATAAGGATAAGGAGGGAAGGTGGACCAGAATGA
1361 AAACTGTAAATATTTTTTTAACCTAATATCACTTAAATCGAGGCAGAAAGATACAGACATTCAATGAATTATATTCAATG
1441 CATTTAAAATACCACTGTAATTGACAGAGTAAAAGTATAGATACAAAACCTTGTGTAAGAGGCTGACTTTTCCAAATAAA
1521 CATTTTTTAAGAAAACATTTCTTCTCCCAAATGTCTATTTTCTTGAGGAAAATATTGCTGTGTCTTCATTTTCATTACCA
1601 GGTTTCATTTTGGGCCTTGCTAAATTGATTGAATTAAATCCTCCAGCTTTTGAACCTTGATATTTGTGTATATGATTTAT
1681 TTTCATTTGAATTTCTCCTTTCCTCTTCTTTGCTGTAAGGCAAGGAGGAGGGGAATTTTAAAACCATCTTATTTGAACTG
1761 AGAGCATCCAGAGCAGTTAACCTTAAGGAAACAATGAAAAACTCCCTTTGTATGCCTGGGCATCATGGCAGATAGAGGAA
1841 GAGTGTTAGAGGAGAAAACTGCTGCTGAGAGTATTGGCAGGCTTGGCCTCAGTTTGGACTCTGTAATTTTCTTTGGACCC
1921 AAGTCTGTAACCTCTGCGTACTTCTTCTCTCTTACCTTCTATAAAAATGAGGATTACTGTTGGTGAGGGAATAAGGAATG
2001 TAAGTAAAGGAAATCTGAAAAAATAAAAGTAAAGCAAGTATAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucUCCAACUGACAUAUUAUAa 5'
            ||| |  ||| | ||||| 
Target 5' ccAGGATATCTG-AAAATATt 3'
 39 - 58 126.00 -5.60
2 
miRNA  3' ucUCCAA-CUGACAUAUUAUAa 5'
            || || |||| |:|||| | 
Target 5' tcAGTTTGGACTCTGTAATTTt 3'
 1889 - 1910 123.00 -6.72
3 
miRNA  3' ucUCCAACUGACA-----UAUUauaa 5'
            ||| ||||| |     ||||    
Target 5' agAGGCTGACTTTTCCAAATAAacat 3'
 1498 - 1523 103.00 -9.85
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
291850 77 ClinVar
291849 104 ClinVar
291848 136 ClinVar
875015 137 ClinVar
291847 145 ClinVar
875014 332 ClinVar
875013 361 ClinVar
291846 516 ClinVar
291845 603 ClinVar
291844 629 ClinVar
874083 657 ClinVar
291843 739 ClinVar
874082 739 ClinVar
291842 815 ClinVar
874081 946 ClinVar
291841 948 ClinVar
291840 970 ClinVar
291839 1018 ClinVar
876885 1044 ClinVar
291838 1051 ClinVar
291837 1064 ClinVar
876884 1071 ClinVar
291836 1072 ClinVar
291834 1086 ClinVar
291835 1086 ClinVar
876883 1134 ClinVar
291833 1281 ClinVar
291832 1312 ClinVar
291831 1414 ClinVar
291830 1624 ClinVar
875888 1654 ClinVar
291829 1801 ClinVar
291828 1876 ClinVar
291827 1942 ClinVar
COSN26994890 23 COSMIC
COSN31511435 25 COSMIC
COSN30518036 33 COSMIC
COSN31509080 39 COSMIC
COSN31511259 59 COSMIC
COSN31572771 152 COSMIC
COSN30519759 189 COSMIC
COSN22926961 353 COSMIC
COSN31582671 353 COSMIC
COSN31479514 394 COSMIC
COSN20090302 1071 COSMIC
COSN27387007 1072 COSMIC
COSN28993464 1073 COSMIC
COSN25753216 1110 COSMIC
COSN17131949 1314 COSMIC
COSN20940623 1419 COSMIC
COSN20260050 1907 COSMIC
COSN28993451 2037 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1485932156 5 dbSNP
rs769850222 9 dbSNP
rs200899632 13 dbSNP
rs1441171574 16 dbSNP
rs746267011 20 dbSNP
rs781372315 29 dbSNP
rs775843298 34 dbSNP
rs1266710860 35 dbSNP
rs775431954 39 dbSNP
rs771469619 41 dbSNP
rs747489976 43 dbSNP
rs1420091719 50 dbSNP
rs1199883735 51 dbSNP
rs1314519976 57 dbSNP
rs1435111517 58 dbSNP
rs1157275710 65 dbSNP
rs1038815542 71 dbSNP
rs868304120 77 dbSNP
rs772229085 85 dbSNP
rs568540802 92 dbSNP
rs1160935186 95 dbSNP
rs1364258827 96 dbSNP
rs772491316 97 dbSNP
rs549674452 101 dbSNP
rs182505461 104 dbSNP
rs1304118200 110 dbSNP
rs1370263270 111 dbSNP
rs531834730 112 dbSNP
rs1402452765 115 dbSNP
rs1014668931 122 dbSNP
rs1005138921 124 dbSNP
rs1409239404 125 dbSNP
rs1394093138 126 dbSNP
rs890357791 126 dbSNP
rs1164753419 127 dbSNP
rs1240598034 129 dbSNP
rs1289420603 132 dbSNP
rs886045066 136 dbSNP
rs1223206132 137 dbSNP
rs1270765883 138 dbSNP
rs11585690 145 dbSNP
rs1175656741 148 dbSNP
rs1250122953 154 dbSNP
rs1349598321 158 dbSNP
rs1419683661 162 dbSNP
rs544367247 179 dbSNP
rs1180604397 180 dbSNP
rs1383533455 188 dbSNP
rs967591481 191 dbSNP
rs1164819238 201 dbSNP
rs1384212747 202 dbSNP
rs1181291023 217 dbSNP
rs1460808194 217 dbSNP
rs1297209120 218 dbSNP
rs913492108 229 dbSNP
rs771246960 242 dbSNP
rs957396161 247 dbSNP
rs1053489884 251 dbSNP
rs1448272942 257 dbSNP
rs1312258943 278 dbSNP
rs936367752 279 dbSNP
rs372111105 281 dbSNP
rs1034423079 289 dbSNP
rs1246578515 294 dbSNP
rs1291971132 306 dbSNP
rs1305512932 310 dbSNP
rs1203568964 322 dbSNP
rs902272056 329 dbSNP
rs41306207 332 dbSNP
rs564739570 334 dbSNP
rs1200832749 337 dbSNP
rs1241322638 342 dbSNP
rs762874265 353 dbSNP
rs544957165 354 dbSNP
rs918115077 357 dbSNP
rs1211979397 360 dbSNP
rs1407575522 361 dbSNP
rs749944822 361 dbSNP
rs558340194 365 dbSNP
rs869254501 365 dbSNP
rs1466857696 368 dbSNP
rs1334325292 371 dbSNP
rs1404687853 379 dbSNP
rs1360511274 384 dbSNP
rs573079650 393 dbSNP
rs753287227 403 dbSNP
rs1213975454 404 dbSNP
rs552877966 408 dbSNP
rs938309713 426 dbSNP
rs1261523700 429 dbSNP
rs886319287 436 dbSNP
rs1204390327 443 dbSNP
rs772304161 448 dbSNP
rs974044913 455 dbSNP
rs542497983 458 dbSNP
rs780545287 471 dbSNP
rs961416174 479 dbSNP
rs35915464 484 dbSNP
rs1333888069 501 dbSNP
rs1414701451 501 dbSNP
rs1479033357 511 dbSNP
rs1173768144 513 dbSNP
rs1428176249 515 dbSNP
rs754537571 516 dbSNP
rs771207029 526 dbSNP
rs954689632 527 dbSNP
rs868289161 536 dbSNP
rs751131068 545 dbSNP
rs1429902344 553 dbSNP
rs1289423653 555 dbSNP
rs994455061 572 dbSNP
rs1342091078 574 dbSNP
rs1364657806 582 dbSNP
rs1030199587 589 dbSNP
rs1281539537 600 dbSNP
rs527658261 603 dbSNP
rs1220090857 605 dbSNP
rs996494283 608 dbSNP
rs1215671150 622 dbSNP
rs559633094 626 dbSNP
rs1489439384 628 dbSNP
rs540946001 629 dbSNP
rs1031977722 631 dbSNP
rs1268699732 631 dbSNP
rs1174009524 636 dbSNP
rs1000546889 637 dbSNP
rs549914123 643 dbSNP
rs529133124 652 dbSNP
rs1159694358 653 dbSNP
rs911644501 657 dbSNP
rs902240805 663 dbSNP
rs1302288595 678 dbSNP
rs1042510857 686 dbSNP
rs1051236692 701 dbSNP
rs1276877363 715 dbSNP
rs946198084 727 dbSNP
rs1470116508 730 dbSNP
rs1223300775 731 dbSNP
rs1287301448 733 dbSNP
rs570060559 739 dbSNP
rs761816040 742 dbSNP
rs1452599727 744 dbSNP
rs1202129668 748 dbSNP
rs537157869 755 dbSNP
rs1469121815 757 dbSNP
rs1268549526 766 dbSNP
rs927295424 772 dbSNP
rs1178728244 773 dbSNP
rs1381686191 774 dbSNP
rs1038311763 786 dbSNP
rs571679096 792 dbSNP
rs908580698 793 dbSNP
rs1406896257 794 dbSNP
rs1325727821 797 dbSNP
rs1334219603 808 dbSNP
rs556305447 815 dbSNP
rs1441834456 824 dbSNP
rs987283861 829 dbSNP
rs1310076510 832 dbSNP
rs1379264564 841 dbSNP
rs1244397502 846 dbSNP
rs1314996416 847 dbSNP
rs1285110467 853 dbSNP
rs35467660 855 dbSNP
rs1357449485 862 dbSNP
rs971472364 867 dbSNP
rs955524221 869 dbSNP
rs1024813516 874 dbSNP
rs923058774 882 dbSNP
rs531389492 889 dbSNP
rs186642038 894 dbSNP
rs776682946 899 dbSNP
rs535043546 906 dbSNP
rs765393120 908 dbSNP
rs1369015932 915 dbSNP
rs1000808169 917 dbSNP
rs1027514156 918 dbSNP
rs1165931146 945 dbSNP
rs867810008 946 dbSNP
rs771999428 947 dbSNP
rs543171131 948 dbSNP
rs1402489796 953 dbSNP
rs1450584549 955 dbSNP
rs1008985495 958 dbSNP
rs1341605664 959 dbSNP
rs1247696659 960 dbSNP
rs886045065 970 dbSNP
rs1426573524 978 dbSNP
rs1339181976 1000 dbSNP
rs890170693 1009 dbSNP
rs774371594 1018 dbSNP
rs1042568469 1019 dbSNP
rs1481020494 1032 dbSNP
rs1202485238 1034 dbSNP
rs946188241 1038 dbSNP
rs891993887 1042 dbSNP
rs1190989254 1044 dbSNP
rs771156799 1045 dbSNP
rs886045064 1051 dbSNP
rs1054648966 1052 dbSNP
rs566060825 1053 dbSNP
rs898693801 1058 dbSNP
rs886045063 1064 dbSNP
rs1468245184 1065 dbSNP
rs936210939 1065 dbSNP
rs927546585 1066 dbSNP
rs886045062 1072 dbSNP
rs940312896 1072 dbSNP
rs1398272700 1073 dbSNP
rs1316900675 1075 dbSNP
rs1326162232 1076 dbSNP
rs1242914464 1079 dbSNP
rs1279623348 1080 dbSNP
rs980087492 1080 dbSNP
rs1051105613 1086 dbSNP
rs1222597862 1086 dbSNP
rs886045060 1086 dbSNP
rs886045061 1086 dbSNP
rs934034749 1088 dbSNP
rs921372648 1096 dbSNP
rs1195596438 1100 dbSNP
rs1266581619 1105 dbSNP
rs1479575522 1108 dbSNP
rs749571038 1116 dbSNP
rs950134280 1118 dbSNP
rs778106916 1134 dbSNP
rs1378252959 1141 dbSNP
rs1467665390 1149 dbSNP
rs865824562 1152 dbSNP
rs1224083691 1159 dbSNP
rs1420628909 1167 dbSNP
rs1300432165 1182 dbSNP
rs1322693981 1186 dbSNP
rs1385858877 1189 dbSNP
rs1301575565 1191 dbSNP
rs1332279456 1193 dbSNP
rs943165754 1197 dbSNP
rs376074000 1205 dbSNP
rs950534514 1209 dbSNP
rs549737147 1219 dbSNP
rs770192227 1220 dbSNP
rs529607926 1223 dbSNP
rs964624469 1226 dbSNP
rs1218787789 1233 dbSNP
rs570268438 1237 dbSNP
rs979334766 1238 dbSNP
rs1216092840 1247 dbSNP
rs1017939681 1248 dbSNP
rs150392969 1270 dbSNP
rs1190779464 1272 dbSNP
rs966654757 1273 dbSNP
rs184445532 1281 dbSNP
rs868435505 1301 dbSNP
rs1379823005 1305 dbSNP
rs1336767970 1306 dbSNP
rs1161030278 1307 dbSNP
rs886045059 1312 dbSNP
rs1405981030 1317 dbSNP
rs1457747429 1324 dbSNP
rs893574793 1328 dbSNP
rs1392447788 1333 dbSNP
rs960705347 1353 dbSNP
rs1389378016 1354 dbSNP
rs1307890309 1368 dbSNP
rs192518061 1368 dbSNP
rs1242199370 1369 dbSNP
rs1312859920 1380 dbSNP
rs1358408720 1382 dbSNP
rs1222029889 1383 dbSNP
rs1420596296 1386 dbSNP
rs1001940458 1397 dbSNP
rs544755844 1399 dbSNP
rs867956711 1400 dbSNP
rs548861929 1409 dbSNP
rs7169 1414 dbSNP
rs1017098671 1416 dbSNP
rs1204359673 1419 dbSNP
rs1440427382 1420 dbSNP
rs188974082 1432 dbSNP
rs1383931160 1441 dbSNP
rs1423544741 1441 dbSNP
rs887376241 1456 dbSNP
rs1261173700 1457 dbSNP
rs1051506707 1461 dbSNP
rs950068854 1462 dbSNP
rs934026053 1467 dbSNP
rs1307868958 1470 dbSNP
rs1330319803 1477 dbSNP
rs751091821 1478 dbSNP
rs1212472067 1482 dbSNP
rs1448392627 1484 dbSNP
rs899854151 1488 dbSNP
rs1378361156 1489 dbSNP
rs1228875486 1490 dbSNP
rs917261005 1503 dbSNP
rs1305602814 1509 dbSNP
rs1216979726 1510 dbSNP
rs1257706093 1511 dbSNP
rs983434304 1518 dbSNP
rs936103362 1523 dbSNP
rs1315214886 1527 dbSNP
rs542561326 1529 dbSNP
rs573557263 1538 dbSNP
rs929363776 1552 dbSNP
rs1451278533 1553 dbSNP
rs1182992118 1554 dbSNP
rs1416379636 1557 dbSNP
rs556751926 1566 dbSNP
rs973168673 1572 dbSNP
rs1169466225 1575 dbSNP
rs543575627 1580 dbSNP
rs1423897877 1588 dbSNP
rs184043512 1591 dbSNP
rs1173613438 1599 dbSNP
rs1358136773 1600 dbSNP
rs558263709 1601 dbSNP
rs1463936773 1607 dbSNP
rs1304539763 1612 dbSNP
rs1359560042 1615 dbSNP
rs1355513091 1622 dbSNP
rs140456426 1624 dbSNP
rs1277740761 1629 dbSNP
rs945249498 1644 dbSNP
rs987821069 1645 dbSNP
rs1387296515 1648 dbSNP
rs992510668 1651 dbSNP
rs761298128 1654 dbSNP
rs1239753344 1657 dbSNP
rs1223750852 1667 dbSNP
rs1485059066 1668 dbSNP
rs1193406480 1670 dbSNP
rs775807751 1672 dbSNP
rs1033798759 1675 dbSNP
rs1020605917 1682 dbSNP
rs1444088657 1696 dbSNP
rs1196883699 1699 dbSNP
rs980488617 1705 dbSNP
rs1178066211 1714 dbSNP
rs1343378987 1724 dbSNP
rs962439693 1740 dbSNP
rs1017025429 1744 dbSNP
rs1009247491 1745 dbSNP
rs779765570 1746 dbSNP
rs1402052442 1748 dbSNP
rs1273319820 1750 dbSNP
rs758115941 1758 dbSNP
rs1219892097 1759 dbSNP
rs1281266613 1766 dbSNP
rs1352126761 1768 dbSNP
rs1216602139 1775 dbSNP
rs1241291465 1784 dbSNP
rs1004351436 1792 dbSNP
rs750135904 1801 dbSNP
rs957738802 1802 dbSNP
rs1032134304 1806 dbSNP
rs887335238 1807 dbSNP
rs1245779096 1817 dbSNP
rs1250585696 1822 dbSNP
rs1029895622 1828 dbSNP
rs1202152280 1831 dbSNP
rs1361243808 1844 dbSNP
rs1405249512 1855 dbSNP
rs1000358764 1859 dbSNP
rs1159232998 1860 dbSNP
rs906055414 1861 dbSNP
rs1292062453 1863 dbSNP
rs1244719602 1864 dbSNP
rs566124124 1867 dbSNP
rs1349529833 1873 dbSNP
rs11811205 1876 dbSNP
rs1449016990 1882 dbSNP
rs190368600 1885 dbSNP
rs944009712 1891 dbSNP
rs1374813396 1892 dbSNP
rs1308469059 1905 dbSNP
rs899821920 1911 dbSNP
rs903092065 1911 dbSNP
rs1310673017 1913 dbSNP
rs1041769605 1915 dbSNP
rs1208449212 1921 dbSNP
rs1289687418 1921 dbSNP
rs1451818072 1924 dbSNP
rs896082183 1926 dbSNP
rs936029742 1936 dbSNP
rs570332067 1938 dbSNP
rs9429505 1942 dbSNP
rs1043548255 1949 dbSNP
rs1179133616 1949 dbSNP
rs539415561 1965 dbSNP
rs929311414 1988 dbSNP
rs533605414 1997 dbSNP
rs920675235 2000 dbSNP
rs1414339031 2011 dbSNP
rs866559148 2015 dbSNP
rs913756241 2031 dbSNP
rs1056379422 2035 dbSNP
rs571694112 2038 dbSNP
rs1164463603 2040 dbSNP
rs1446140587 2044 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 6566.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 6566.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000369626.3 | 3UTR | GUCAUAAAGAUUAUAAUAUGUGCCUUAAGUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000369626.3 | 3UTR | GAUUAUAAUAUGUGCCUUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000369626.3 | 3UTR | AUUAUAAUAUGUGCCUUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000369626.3 | 3UTR | AUUAUAAUAUGUGCCUUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
UCEC -0.505 0.04 -0.456 0.06 13 Click to see details
BLCA -0.406 0.05 -0.257 0.16 17 Click to see details
PCPG -0.94 0.11 -1.000 0.5 3 Click to see details
STAD -0.247 0.11 -0.307 0.06 26 Click to see details
PRAD 0.184 0.13 0.086 0.3 39 Click to see details
THCA 0.329 0.15 0.455 0.07 12 Click to see details
PAAD -0.689 0.16 -0.800 0.1 4 Click to see details
CHOL -0.439 0.19 -0.600 0.1 6 Click to see details
KICH 0.321 0.27 0.543 0.13 6 Click to see details
CESC -0.56 0.31 -0.500 0.33 3 Click to see details
KIRC 0.19 0.33 0.429 0.14 8 Click to see details
ESCA -0.189 0.34 -0.179 0.35 7 Click to see details
LIHC 0.067 0.35 0.090 0.3 35 Click to see details
HNSC 0.061 0.36 0.050 0.39 36 Click to see details
KIRP -0.104 0.4 -0.267 0.24 9 Click to see details
LUSC -0.035 0.44 -0.027 0.45 24 Click to see details
BRCA 0.022 0.44 0.037 0.39 56 Click to see details
LUAD 0.063 0.45 0.086 0.44 6 Click to see details
LUAD 0.063 0.45 0.086 0.44 6 Click to see details
117 hsa-miR-656-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT054590 BMPR1A bone morphogenetic protein receptor type 1A 3 1
MIRT070954 ZFP36L1 ZFP36 ring finger protein like 1 2 2
MIRT080090 C18ORF25 chromosome 18 open reading frame 25 2 6
MIRT107594 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT113091 CCND2 cyclin D2 2 2
MIRT156603 COQ10B coenzyme Q10B 2 2
MIRT216714 SCAMP1 secretory carrier membrane protein 1 2 2
MIRT261132 TRIM8 tripartite motif containing 8 2 2
MIRT262930 ARID5B AT-rich interaction domain 5B 2 4
MIRT267010 ZDHHC5 zinc finger DHHC-type containing 5 2 6
MIRT338333 IKZF4 IKAROS family zinc finger 4 2 6
MIRT378852 ITGB8 integrin subunit beta 8 2 2
MIRT441577 EXOC5 exocyst complex component 5 2 2
MIRT441972 RNF41 ring finger protein 41 2 2
MIRT442617 PPP3R1 protein phosphatase 3 regulatory subunit B, alpha 2 2
MIRT447730 DGKH diacylglycerol kinase eta 2 2
MIRT449237 KIAA0408 KIAA0408 2 2
MIRT449884 PRMT7 protein arginine methyltransferase 7 2 2
MIRT452912 ZNF138 zinc finger protein 138 2 2
MIRT458867 CD55 CD55 molecule (Cromer blood group) 2 2
MIRT480582 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT483118 SH3BP5 SH3 domain binding protein 5 2 2
MIRT493755 GNG5 G protein subunit gamma 5 2 8
MIRT504369 ARID1B AT-rich interaction domain 1B 2 4
MIRT505523 SPATA2 spermatogenesis associated 2 2 10
MIRT505628 SLC16A1 solute carrier family 16 member 1 2 6
MIRT506382 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT507045 HIC2 HIC ZBTB transcriptional repressor 2 2 6
MIRT507416 ELK4 ELK4, ETS transcription factor 2 4
MIRT508194 PTP4A2 protein tyrosine phosphatase type IVA, member 2 2 6
MIRT508599 CREB1 cAMP responsive element binding protein 1 2 6
MIRT508617 HOXC4 homeobox C4 2 8
MIRT508692 NRIP1 nuclear receptor interacting protein 1 2 4
MIRT509017 CUL2 cullin 2 2 8
MIRT509079 RABGAP1 RAB GTPase activating protein 1 2 10
MIRT509970 CRIM1 cysteine rich transmembrane BMP regulator 1 2 4
MIRT510172 STARD8 StAR related lipid transfer domain containing 8 2 8
MIRT510370 ZNF703 zinc finger protein 703 2 6
MIRT510667 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 2
MIRT511116 NFIB nuclear factor I B 2 6
MIRT511357 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 6
MIRT511423 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 6
MIRT512295 AMER1 APC membrane recruitment protein 1 2 6
MIRT514084 MGAT4C MGAT4 family member C 2 4
MIRT516900 RAI1 retinoic acid induced 1 2 4
MIRT516944 SLC35F6 solute carrier family 35 member F6 2 8
MIRT518816 AKAP8 A-kinase anchoring protein 8 2 4
MIRT519244 TNFSF9 TNF superfamily member 9 2 4
MIRT519573 ZXDA zinc finger, X-linked, duplicated A 2 6
MIRT519870 ZFP62 ZFP62 zinc finger protein 2 6
MIRT520892 STRN striatin 2 4
MIRT520963 SPSB1 splA/ryanodine receptor domain and SOCS box containing 1 2 6
MIRT521932 PHF8 PHD finger protein 8 2 10
MIRT522188 NR2C2 nuclear receptor subfamily 2 group C member 2 2 6
MIRT523594 FZD5 frizzled class receptor 5 2 4
MIRT523810 FAM19A1 family with sequence similarity 19 member A1, C-C motif chemokine like 2 4
MIRT527780 DNAJC21 DnaJ heat shock protein family (Hsp40) member C21 2 2
MIRT528048 ID4 inhibitor of DNA binding 4, HLH protein 2 2
MIRT528241 SPIN4 spindlin family member 4 2 2
MIRT534474 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT538907 BRI3BP BRI3 binding protein 2 2
MIRT540705 PDPK1 3-phosphoinositide dependent protein kinase 1 2 4
MIRT542593 ZBTB18 zinc finger and BTB domain containing 18 2 4
MIRT543065 BACH2 BTB domain and CNC homolog 2 2 4
MIRT543491 MDM2 MDM2 proto-oncogene 2 2
MIRT544063 KIAA1462 junctional cadherin 5 associated 2 2
MIRT545530 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase 2 2
MIRT546703 RORA RAR related orphan receptor A 2 4
MIRT548248 FBXW7 F-box and WD repeat domain containing 7 2 2
MIRT549271 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT549402 AKAP11 A-kinase anchoring protein 11 2 2
MIRT550252 EIF2B1 eukaryotic translation initiation factor 2B subunit alpha 2 2
MIRT550552 ARSK arylsulfatase family member K 2 2
MIRT550793 WARS2 tryptophanyl tRNA synthetase 2, mitochondrial 2 2
MIRT551098 TTC8 tetratricopeptide repeat domain 8 2 2
MIRT551417 LRRC31 leucine rich repeat containing 31 2 2
MIRT551883 EPHA1 EPH receptor A1 2 2
MIRT552558 ZFP36L2 ZFP36 ring finger protein like 2 2 2
MIRT553764 TAGLN2 transgelin 2 2 2
MIRT553817 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT554978 RAB5C RAB5C, member RAS oncogene family 2 2
MIRT556427 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT556464 LMNB2 lamin B2 2 4
MIRT559180 BRAP BRCA1 associated protein 2 2
MIRT559549 ARGLU1 arginine and glutamate rich 1 2 2
MIRT560578 ZNF460 zinc finger protein 460 2 2
MIRT561173 TMEM30A transmembrane protein 30A 2 2
MIRT563712 SVIP small VCP interacting protein 2 4
MIRT564563 CCDC80 coiled-coil domain containing 80 2 2
MIRT567650 EXOC8 exocyst complex component 8 2 2
MIRT568539 ALKBH5 alkB homolog 5, RNA demethylase 2 2
MIRT571343 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT573904 SRP9 signal recognition particle 9 2 2
MIRT611915 RAB3GAP1 RAB3 GTPase activating protein catalytic subunit 1 2 2
MIRT612269 SEMA3F semaphorin 3F 2 2
MIRT614457 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT615492 AJAP1 adherens junctions associated protein 1 2 4
MIRT639515 FYB FYN binding protein 1 2 2
MIRT674959 PEX2 peroxisomal biogenesis factor 2 2 2
MIRT687808 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT698408 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT698527 TFRC transferrin receptor 2 2
MIRT702313 L1CAM L1 cell adhesion molecule 2 4
MIRT707252 SIK3 SIK family kinase 3 2 2
MIRT707265 RRAGC Ras related GTP binding C 2 2
MIRT707519 HHIP hedgehog interacting protein 2 2
MIRT707529 CXCL5 C-X-C motif chemokine ligand 5 2 2
MIRT707762 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT707793 TTYH3 tweety family member 3 2 2
MIRT707815 TMEM178B transmembrane protein 178B 2 2
MIRT708108 HERPUD2 HERPUD family member 2 2 2
MIRT708173 C16orf52 chromosome 16 open reading frame 52 2 2
MIRT711910 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT714484 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT715016 LIN9 lin-9 DREAM MuvB core complex component 2 2
MIRT715669 SCOC short coiled-coil protein 2 2
MIRT725386 METTL8 methyltransferase like 8 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-656 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-656 Fluorouracil 3385 NSC19893 approved resistant cell line (KYSE)
hsa-mir-656 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-656-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-656-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (NCM460, SW480, RKO, DLD1, SW48, HCT-116, LOVO, HT-29, HCT8, SW620)
hsa-miR-656-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-656-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-656-3p Tripterygium wilfordii Hook F sensitive tissue
hsa-miR-656-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-656-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-656-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-656-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM47)
hsa-miR-656-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-656-3p Sunitinib 5329102 NSC750690 approved sensitive tissue (CardB)
hsa-miR-656-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-656-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-656-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission