miRTarBase - #MIRT505723


—
pre-miRNA Information
pre-miRNA hsa-mir-7107   
Genomic Coordinates chr12: 121444273 - 121444352
Description Homo sapiens miR-7107 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7107-5p
Sequence 6| UCGGCCUGGGGAGGAGGAAGGG |27
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs782634189 2 dbSNP
rs782536354 3 dbSNP
rs1230027540 4 dbSNP
rs539127530 5 dbSNP
rs782765349 9 dbSNP
rs55671311 10 dbSNP
rs183760300 11 dbSNP
rs782805318 12 dbSNP
rs782108772 19 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SERTAD3   
Synonyms RBT1
Description SERTA domain containing 3
Transcript NM_013368   
Other Transcripts NM_203344   
Expression
Putative miRNA Targets on SERTAD3
3'UTR of SERTAD3
(miRNA target sites are highlighted)		 
>SERTAD3|NM_013368|3'UTR
   1 AACTGTGATAGAGGGGATCGATCCTTCCTCATGTCATCTTCGGTGGCCTGGATCCCTGAATGCAACTCTGGGTGTGTGTT
  81 TTTGTGGGGGCTCGAAGCAGTGACTATGGCCTCCTTTGTTCCCATTTCAGGGTTCCACAAACTGTCTTGCATGTGTGTGT
 161 GTGTCTGGTTACCCCGACCTTCTGTGAAGGTGGGTCTTCCTGAATTAATTTATCTATTCCAAATGCCTTAACGAGACTCT
 241 GTTTCTGGGAGTCTGATTTTCCACTTACACATTTCTTCCACCTTTCCTGCTAGTTCCCACTCCCCTGTGACCACTGGGGC
 321 CTCAGGGAAGATAAAGAAAGCTGGGCCTGTCGAAGGATGACAGGGATGTGCTGCCAGGTTGCTATAGAAACCCAGGCTCT
 401 GCCTCTTGCACCTTGAGGGGGTGGGAGGGGCTGGTGTCCTCCCTCCAGGCTGAACCCCACTTCCTCGGCAGGACCCCAGT
 481 CTCAGCAGCCTCCTGATTTCATAACCAGGCCGGACCACGTGCAATAGGGTGGAAACCAAACTGCTCCATGCCGGGTTATT
 561 TAAAAGAAAGGCAGAGTTTGTGGTGGCTTTTTTTTTTTTTTTTGGATTGTTTGTAATTTTTTTAAATAAAAGTATTTTGG
 641 AAGGAGGGAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gggaAGGAGGAGGGGUCCGGCu 5'
              |||||| |:||||||:| 
Target 5' ggtgTCCTCC-CTCCAGGCTGa 3'
 433 - 453 157.00 -31.30
2 
miRNA  3' ggGAAGGA--GGAG---GGGUCCGGCu 5'
            | ||||  ::||    |||||||| 
Target 5' agCCTCCTGATTTCATAACCAGGCCGg 3'
 487 - 513 154.00 -27.20
3 
miRNA  3' gggaaggaGGAGGGGUCCGGCu 5'
                  |: |:||| |||| 
Target 5' aaaccaaaCTGCTCCATGCCGg 3'
 533 - 554 122.00 -19.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31510868 7 COSMIC
COSN17153224 16 COSMIC
COSN30185136 42 COSMIC
COSN30465304 54 COSMIC
COSN30469513 55 COSMIC
COSN30677273 70 COSMIC
COSN30162229 93 COSMIC
COSN31551420 159 COSMIC
COSN31514300 175 COSMIC
COSN28190679 200 COSMIC
COSN31599286 210 COSMIC
COSN31577610 248 COSMIC
COSN16132101 415 COSMIC
COSN28696893 417 COSMIC
COSN9850306 433 COSMIC
COSN26548637 455 COSMIC
COSN26554935 518 COSMIC
COSN26553257 552 COSMIC
COSN28673239 552 COSMIC
COSN19337896 588 COSMIC
COSN19662875 604 COSMIC
COSN25727120 624 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs531778813 3 dbSNP
rs368642346 4 dbSNP
rs1325762657 5 dbSNP
rs1339505394 8 dbSNP
rs1331766963 9 dbSNP
rs1333374446 11 dbSNP
rs1027495936 13 dbSNP
rs561364491 14 dbSNP
rs779080578 16 dbSNP
rs757655004 17 dbSNP
rs1229083833 18 dbSNP
rs749424765 19 dbSNP
rs1407447319 20 dbSNP
rs1157204184 21 dbSNP
rs10560834 24 dbSNP
rs398059734 24 dbSNP
rs1017842409 25 dbSNP
rs1369585042 30 dbSNP
rs778173766 31 dbSNP
rs1213018863 33 dbSNP
rs756234146 35 dbSNP
rs76051743 38 dbSNP
rs774228636 38 dbSNP
rs1249334263 41 dbSNP
rs752875417 42 dbSNP
rs767552444 44 dbSNP
rs1446068284 46 dbSNP
rs1436496026 67 dbSNP
rs1241204560 71 dbSNP
rs890197053 72 dbSNP
rs1195346353 80 dbSNP
rs1391421624 88 dbSNP
rs760497577 89 dbSNP
rs891911954 90 dbSNP
rs1392078999 91 dbSNP
rs7259644 92 dbSNP
rs944989026 93 dbSNP
rs892057891 94 dbSNP
rs141369483 106 dbSNP
rs1353347403 108 dbSNP
rs190431548 110 dbSNP
rs1266020449 112 dbSNP
rs576705910 116 dbSNP
rs1202892737 137 dbSNP
rs936170240 144 dbSNP
rs1282976138 146 dbSNP
rs1488303029 149 dbSNP
rs927514841 150 dbSNP
rs1254873058 153 dbSNP
rs1044940265 155 dbSNP
rs1474468775 161 dbSNP
rs1187267531 165 dbSNP
rs1442327656 165 dbSNP
rs912144963 165 dbSNP
rs1384398541 168 dbSNP
rs1360009242 172 dbSNP
rs950201876 173 dbSNP
rs184499405 175 dbSNP
rs1188917276 176 dbSNP
rs1413990822 179 dbSNP
rs1388023936 189 dbSNP
rs1313117601 194 dbSNP
rs1341997439 196 dbSNP
rs771785806 201 dbSNP
rs983426071 203 dbSNP
rs377391999 204 dbSNP
rs1218157253 209 dbSNP
rs920524486 210 dbSNP
rs973086895 212 dbSNP
rs963250205 218 dbSNP
rs747762827 220 dbSNP
rs543007336 226 dbSNP
rs1444444489 228 dbSNP
rs1180310817 232 dbSNP
rs768387108 234 dbSNP
rs1033963933 245 dbSNP
rs1440473638 250 dbSNP
rs1160506797 253 dbSNP
rs575681541 255 dbSNP
rs971074162 264 dbSNP
rs1290597904 267 dbSNP
rs1389393263 268 dbSNP
rs773723615 285 dbSNP
rs1377536237 286 dbSNP
rs1241748550 287 dbSNP
rs1357490271 293 dbSNP
rs1233551463 298 dbSNP
rs1017475292 299 dbSNP
rs749460123 302 dbSNP
rs1484447749 303 dbSNP
rs1194435841 308 dbSNP
rs1314832364 318 dbSNP
rs1229560876 319 dbSNP
rs7259593 321 dbSNP
rs377221600 322 dbSNP
rs954492211 325 dbSNP
rs1020674873 326 dbSNP
rs1181002544 330 dbSNP
rs1031765947 331 dbSNP
rs370974128 339 dbSNP
rs1000655884 341 dbSNP
rs1177061352 342 dbSNP
rs1379583040 346 dbSNP
rs1009255993 351 dbSNP
rs192624391 352 dbSNP
rs1007709751 353 dbSNP
rs1053438705 356 dbSNP
rs1366310326 361 dbSNP
rs755652132 363 dbSNP
rs1331187307 366 dbSNP
rs1303043433 384 dbSNP
rs572125420 400 dbSNP
rs750958747 405 dbSNP
rs1304376401 406 dbSNP
rs111689476 411 dbSNP
rs554049973 412 dbSNP
rs7259255 417 dbSNP
rs1201085132 426 dbSNP
rs756861074 427 dbSNP
rs1271748032 428 dbSNP
rs1488236058 431 dbSNP
rs950229463 433 dbSNP
rs1046909890 435 dbSNP
rs2368579 436 dbSNP
rs866970531 441 dbSNP
rs1037320488 443 dbSNP
rs746171340 448 dbSNP
rs1193169668 449 dbSNP
rs372697105 453 dbSNP
rs1466940371 457 dbSNP
rs1162712611 460 dbSNP
rs75951686 461 dbSNP
rs538540951 464 dbSNP
rs376289897 466 dbSNP
rs1359200467 472 dbSNP
rs1399031737 473 dbSNP
rs1278366955 474 dbSNP
rs781395976 498 dbSNP
rs1247388017 502 dbSNP
rs920618344 505 dbSNP
rs148262714 511 dbSNP
rs1489932713 512 dbSNP
rs565094894 518 dbSNP
rs970555768 520 dbSNP
rs917856535 523 dbSNP
rs1484906182 527 dbSNP
rs1216181365 528 dbSNP
rs910424775 529 dbSNP
rs1264094044 533 dbSNP
rs1478721293 538 dbSNP
rs1185515919 542 dbSNP
rs1309630491 546 dbSNP
rs1424357456 547 dbSNP
rs182375818 548 dbSNP
rs1058041 552 dbSNP
rs1020731876 553 dbSNP
rs1298501765 558 dbSNP
rs973373904 566 dbSNP
rs1346273146 571 dbSNP
rs1031712137 572 dbSNP
rs143239771 575 dbSNP
rs1282755421 577 dbSNP
rs1402525121 580 dbSNP
rs957758273 582 dbSNP
rs1032049988 583 dbSNP
rs1308254128 585 dbSNP
rs1481315552 586 dbSNP
rs1429643545 587 dbSNP
rs547262323 588 dbSNP
rs1229417429 595 dbSNP
rs1315374630 600 dbSNP
rs1169421963 601 dbSNP
rs1415002973 602 dbSNP
rs1427143868 603 dbSNP
rs10660252 604 dbSNP
rs112924689 604 dbSNP
rs1198089987 604 dbSNP
rs1208516966 604 dbSNP
rs1236699001 604 dbSNP
rs1239516757 604 dbSNP
rs1287086086 604 dbSNP
rs1489383632 604 dbSNP
rs34185184 604 dbSNP
rs542682405 604 dbSNP
rs963643778 606 dbSNP
rs910790067 609 dbSNP
rs1305184646 610 dbSNP
rs986346880 613 dbSNP
rs969232050 615 dbSNP
rs1017676358 617 dbSNP
rs1008154151 621 dbSNP
rs1481709681 623 dbSNP
rs1231555566 624 dbSNP
rs1002269808 631 dbSNP
rs1355878831 632 dbSNP
rs1204223717 633 dbSNP
rs149562030 634 dbSNP
rs1278096934 639 dbSNP
rs1312622878 646 dbSNP
rs1211956354 647 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 29946.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gggaaGGAGGAGGGGUCCGGCu 5'
               ::|| |  |||||||| 
Target 5' ----aUUUCAUAACCAGGCCGg 3'
 		1 - 18
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 29946.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000392028.4 | 3UTR | AUUUCAUAACCAGGCCGGACCACGUGCAAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000392028.4 | 3UTR | AUUUCAUAACCAGGCCGGACCACGUGCAAUAGGGUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000392028.4 | 3UTR | AUUUCAUAACCAGGCCGGACCACGUGCAAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000392028.4 | 3UTR | AUUUCAUAACCAGGCCGGACCACGUGCAAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
144 hsa-miR-7107-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT060580 CCND1 cyclin D1 2 4
MIRT451035 ZNF610 zinc finger protein 610 2 2
MIRT485711 CASP16 caspase 16, pseudogene 2 8
MIRT488402 TDRKH tudor and KH domain containing 2 2
MIRT492084 TCF21 transcription factor 21 2 2
MIRT504213 VAV3 vav guanine nucleotide exchange factor 3 2 13
MIRT505723 SERTAD3 SERTA domain containing 3 2 4
MIRT509007 FBXO6 F-box protein 6 2 2
MIRT509843 FOS Fos proto-oncogene, AP-1 transcription factor subunit 2 2
MIRT514761 RBM4B RNA binding motif protein 4B 2 2
MIRT515664 LRRC27 leucine rich repeat containing 27 2 2
MIRT516316 F8A2 coagulation factor VIII associated 2 2 2
MIRT516342 F8A3 coagulation factor VIII associated 3 2 2
MIRT517139 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT518746 C1orf35 chromosome 1 open reading frame 35 2 2
MIRT519299 MLH1 mutL homolog 1 2 2
MIRT521527 QSOX1 quiescin sulfhydryl oxidase 1 2 4
MIRT531756 TXK TXK tyrosine kinase 2 2
MIRT542208 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT542235 FUT9 fucosyltransferase 9 2 2
MIRT542791 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT554378 SETD5 SET domain containing 5 2 2
MIRT569908 PCSK9 proprotein convertase subtilisin/kexin type 9 2 2
MIRT570222 SLC27A1 solute carrier family 27 member 1 2 2
MIRT570976 RGS19 regulator of G protein signaling 19 2 2
MIRT573046 SHMT1 serine hydroxymethyltransferase 1 2 2
MIRT574954 Vav3 vav 3 oncogene 2 8
MIRT609297 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT612990 GBX2 gastrulation brain homeobox 2 2 2
MIRT613851 SHB SH2 domain containing adaptor protein B 2 2
MIRT613935 POLR3A RNA polymerase III subunit A 2 2
MIRT614243 WDR53 WD repeat domain 53 2 4
MIRT615158 SPIB Spi-B transcription factor 2 2
MIRT616145 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT616389 C1orf87 chromosome 1 open reading frame 87 2 2
MIRT617737 ATCAY ATCAY, caytaxin 2 4
MIRT621449 TCN2 transcobalamin 2 2 2
MIRT625784 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 2 2
MIRT628556 MELK maternal embryonic leucine zipper kinase 2 2
MIRT632041 ZNF430 zinc finger protein 430 2 2
MIRT634937 GTF2H2C GTF2H2 family member C 2 4
MIRT637208 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT637610 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT637832 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT638107 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT638387 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT641689 SPCS1 signal peptidase complex subunit 1 2 2
MIRT642611 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT643850 LACTB lactamase beta 2 4
MIRT649575 PALD1 phosphatase domain containing, paladin 1 2 2
MIRT649860 WDR12 WD repeat domain 12 2 2
MIRT651026 ZNF699 zinc finger protein 699 2 2
MIRT652336 TMOD3 tropomodulin 3 2 4
MIRT653286 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 2 2
MIRT656292 METTL14 methyltransferase like 14 2 2
MIRT656458 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT659539 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 2 2
MIRT661537 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT668042 GTPBP10 GTP binding protein 10 2 2
MIRT668147 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT668800 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT669818 STOML1 stomatin like 1 2 2
MIRT670490 DCUN1D2 defective in cullin neddylation 1 domain containing 2 2 2
MIRT670615 NPHP1 nephrocystin 1 2 2
MIRT670892 CYTIP cytohesin 1 interacting protein 2 2
MIRT670943 LIPG lipase G, endothelial type 2 2
MIRT671268 MTRNR2L5 MT-RNR2-like 5 2 2
MIRT671903 GBP4 guanylate binding protein 4 2 2
MIRT672239 ABHD15 abhydrolase domain containing 15 2 2
MIRT672326 C9orf3 chromosome 9 open reading frame 3 2 2
MIRT673113 MFSD2A major facilitator superfamily domain containing 2A 2 2
MIRT674412 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 2 2
MIRT677718 IRF1 interferon regulatory factor 1 2 2
MIRT678585 PPP1R3B protein phosphatase 1 regulatory subunit 3B 2 2
MIRT678726 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT679338 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT679614 RRP36 ribosomal RNA processing 36 2 2
MIRT679695 SLC1A5 solute carrier family 1 member 5 2 4
MIRT679715 RPL24 ribosomal protein L24 2 2
MIRT680065 CD96 CD96 molecule 2 2
MIRT683379 ESR2 estrogen receptor 2 2 2
MIRT683683 MICA MHC class I polypeptide-related sequence A 2 2
MIRT683865 OCIAD1 OCIA domain containing 1 2 2
MIRT684073 TLR7 toll like receptor 7 2 2
MIRT684126 CEP104 centrosomal protein 104 2 2
MIRT684485 GPR137B G protein-coupled receptor 137B 2 2
MIRT684736 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT684778 MYO1F myosin IF 2 2
MIRT685028 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT685189 DCTN5 dynactin subunit 5 2 2
MIRT685307 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT685514 MSH3 mutS homolog 3 2 2
MIRT685702 BHMT2 betaine--homocysteine S-methyltransferase 2 2 2
MIRT685944 PTGIS prostaglandin I2 synthase 2 2
MIRT686311 VPS53 VPS53, GARP complex subunit 2 2
MIRT686686 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT687641 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT687923 HOOK3 hook microtubule tethering protein 3 2 2
MIRT688117 GEMIN8 gem nuclear organelle associated protein 8 2 2
MIRT688460 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 2 2
MIRT688629 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT688823 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT689117 ZBTB25 zinc finger and BTB domain containing 25 2 2
MIRT689166 ZNF665 zinc finger protein 665 2 2
MIRT690070 MBD1 methyl-CpG binding domain protein 1 2 2
MIRT690733 IRAK4 interleukin 1 receptor associated kinase 4 2 2
MIRT691324 KIAA1841 KIAA1841 2 2
MIRT691517 ZNF682 zinc finger protein 682 2 2
MIRT691607 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT692314 RFK riboflavin kinase 2 2
MIRT692376 LY6G5B lymphocyte antigen 6 family member G5B 2 2
MIRT692436 METTL8 methyltransferase like 8 2 2
MIRT692782 SYNPO2L synaptopodin 2 like 2 2
MIRT693136 THEM4 thioesterase superfamily member 4 2 2
MIRT693422 TECPR2 tectonin beta-propeller repeat containing 2 2 2
MIRT693871 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT694049 PRIM1 DNA primase subunit 1 2 2
MIRT694092 KIAA0930 KIAA0930 2 2
MIRT694190 ZNF347 zinc finger protein 347 2 2
MIRT695177 SLC25A33 solute carrier family 25 member 33 2 2
MIRT696180 GNB5 G protein subunit beta 5 2 2
MIRT697387 ZMAT3 zinc finger matrin-type 3 2 2
MIRT698924 SPEM1 spermatid maturation 1 2 2
MIRT699314 SLC35F5 solute carrier family 35 member F5 2 4
MIRT701106 PAPD5 poly(A) RNA polymerase D5, non-canonical 2 2
MIRT701575 MYPN myopalladin 2 2
MIRT701825 MRPL37 mitochondrial ribosomal protein L37 2 2
MIRT702047 METTL21A methyltransferase like 21A 2 2
MIRT703034 HAS2 hyaluronan synthase 2 2 4
MIRT704143 DNAL1 dynein axonemal light chain 1 2 2
MIRT704759 CDKN2AIPNL CDKN2A interacting protein N-terminal like 2 2
MIRT705079 C4orf29 abhydrolase domain containing 18 2 2
MIRT705346 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT706104 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT709070 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT709534 ZBED1 zinc finger BED-type containing 1 2 2
MIRT712356 NAT14 N-acetyltransferase 14 (putative) 2 2
MIRT713713 PAOX polyamine oxidase 2 2
MIRT714304 ZNF454 zinc finger protein 454 2 2
MIRT714919 PPP1R12C protein phosphatase 1 regulatory subunit 12C 2 2
MIRT715792 TBL3 transducin beta like 3 2 2
MIRT717376 RBM41 RNA binding motif protein 41 2 2
MIRT719069 ACOX1 acyl-CoA oxidase 1 2 2
MIRT724548 HAUS2 HAUS augmin like complex subunit 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-7107-5p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-7107-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-7107-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-7107-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-7107-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-7107-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission