miRTarBase - #MIRT506517


—
pre-miRNA Information
pre-miRNA hsa-mir-190b   
Genomic Coordinates chr1: 154193665 - 154193743
Description Homo sapiens miR-190b stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-190b
Sequence 11| UGAUAUGUUUGAUAUUGGGUU |31
Evidence Not_experimental
Experiments
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MSANTD4   
Synonyms KIAA1826
Description Myb/SANT DNA binding domain containing 4 with coiled-coils
Transcript NM_032424   
Expression
Putative miRNA Targets on MSANTD4
3'UTR of MSANTD4
(miRNA target sites are highlighted)		 
>MSANTD4|NM_032424|3'UTR
   1 TTTTTCCAGGCTTCCATTTAGCAAATGTTTGAAAACTCTAGATTTTTCTCATATCAGGTGATATAATGATGGTTGCTGGA
  81 TTAGCTGTGGTTTCTTGTCTAATGTCAGTGTTCAGTAGGAAAAAGTTATATGTGGATAACTGTATGCCTAAGTAGTATAT
 161 AAAAGCTGTGCCCTAGCGTAAACAGTATAGCAGAAACTTACTGTGCTGGACTCTTTACCTTATAATATTACATAGAGTCT
 241 TGTATTGTCTGTGTACCCAGAGTTTACAATTATGTCCATATAAAATTCTAGCCCAGAAGTTCTCATCTGGGGTAGATTTT
 321 GGCCTTCAGAAGACCAATTTGGTGATGTCTGGAGACATGTTGGGTTGTCAAAACTGGGGTGGGGAAAAGGTTGCTACTGT
 401 GCAATGCATACCTCCTCAACACCCCCCCACACTCAGTAAAGAATTTTCCAACCCAAAATATCATTAGTCCTGAGGTTGAG
 481 AAACCCTGTCCTAGCCTAACTGTGTACCTCTATAGCTATGTTTTATAGTTTTAGAATATTAAAACCTCAGATATTTATGT
 561 GGGTAGGTACTTAAATGGCCAAAAACTTTAACTATGAAATGTTACTGTGTAGTATATTGAATATAGGAAGTGATGAAGAT
 641 TATAGGTATTTTATTCCCATGTTTCCATCTATAAATAGCCTTCTCAGATTCAGAAAACAATACAGAGAACATCAGAAATT
 721 TTCTAAAATGGGTCACTTTGAAAAGAATTCTTTTTCTCACTATTAATGCTTTAGAAGCAAGACGCAATTTTAAAGCTTTA
 801 GTTCCTTTTCTTTCAGTCATTGTCTTAGTTTGGGTACAAAAATGTCATTTCAGTAATGTACTGAAATCTTATAAGTGAAT
 881 AGTTGAAGCTAGTAAAAATGATACCAGTATAAAAATGGTACTTGTAGTCCATGAGCTTGAACCCAATGACTGATTGTTTG
 961 ACTTTTAAAATAAGTAATAGCAGCCATTTGGGAGTAGGGGGTAGGTGGGGAAGATGTACTCCGTATCAAATAATAATGAT
1041 GTTGAAATAATGATAGTAGGTATGTATTATGGATTGGAGAAGCACTTATTACACTATCTAACCTAATATGTAGAACAATT
1121 CTTGAGAGTTGTATCTGTCGTTATTTCTGAATGTGAAGCTCAGAGAAGTGACACAGAGTAAATGGCTGATCTTCTATATT
1201 GTAGTATATTTTGTCCTTCCCTCTTCCCTGAGGAACAAAGCACGTATCTTTAGTCTCTTTGATATTTATTCTGAGACCAA
1281 GGGCTTGCTTGACCTGATGATTTTCCTTCAGCTCTCTGAAGGTGCTTTTTCCACAATCCAAGTGATTCTGATACACACTA
1361 AAGTTGAGAATCACTGCACTAGATCACTTTGTGTTTTCTGATTTTCAAGGTTGATACGTAGCTTTAATACAGCTCTTCTG
1441 TTGACAGTTATTACTTTAATTTTGCATTTGTTCCTTGTAAGAATGGCTGGAAACTGTGTGTTGACATTTGAGGATGGGTA
1521 TGCAAGGAAAAAATATACTTCTGTTTACTTACTCTGACTTTGAAATAGTGTTATTTTTCTATATCTGAAATAAATGCTTC
1601 TACCATAGAAATAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuGGG--UUAUAGUU---UGUAUAGu 5'
            |||  |: | |||   ||:|||| 
Target 5' ttCCCTGAGGAACAAAGCACGTATCt 3'
 1224 - 1249 137.00 -8.90
2 
miRNA  3' uuggGUUAUAG---UUUGUAUAGu 5'
              ::||:||   |:||||:|: 
Target 5' ttggTGATGTCTGGAGACATGTTg 3'
 339 - 362 125.00 -7.50
3 
miRNA  3' uuGGGUUAUAGUUUGUAUAGu 5'
            :|||  | | || ||||| 
Target 5' ttTCCA--ACCCAAAATATCa 3'
 445 - 463 123.00 -9.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31530993 13 COSMIC
COSN30181713 34 COSMIC
COSN31493280 38 COSMIC
COSN31561450 51 COSMIC
COSN5823042 63 COSMIC
COSN31958731 64 COSMIC
COSN30182843 72 COSMIC
COSN30131466 75 COSMIC
COSN28190697 80 COSMIC
COSN31612973 85 COSMIC
COSN30704704 88 COSMIC
COSN31493094 99 COSMIC
COSN31527094 124 COSMIC
COSN30105318 147 COSMIC
COSN31599208 162 COSMIC
COSN30518578 187 COSMIC
COSN30122369 206 COSMIC
COSN16449276 238 COSMIC
COSN17201156 707 COSMIC
COSN24698077 745 COSMIC
COSN6982995 1272 COSMIC
COSN31565497 1316 COSMIC
COSN25139148 1323 COSMIC
COSN31540744 1348 COSMIC
COSN31610891 1378 COSMIC
COSN1511806 1451 COSMIC
COSN21721326 1481 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1033704548 6 dbSNP
rs777117255 8 dbSNP
rs200813602 11 dbSNP
rs1482181566 13 dbSNP
rs745738430 16 dbSNP
rs778897015 17 dbSNP
rs770840514 20 dbSNP
rs1459950803 21 dbSNP
rs749080512 22 dbSNP
rs376127790 23 dbSNP
rs755782655 25 dbSNP
rs776577061 30 dbSNP
rs1458300792 36 dbSNP
rs1295193266 37 dbSNP
rs752431661 38 dbSNP
rs1348216020 39 dbSNP
rs1359653469 40 dbSNP
rs1381434953 40 dbSNP
rs551453640 41 dbSNP
rs749640445 48 dbSNP
rs769083850 48 dbSNP
rs1271935135 50 dbSNP
rs770891318 51 dbSNP
rs1005127549 52 dbSNP
rs1366968999 58 dbSNP
rs958633743 64 dbSNP
rs533364388 68 dbSNP
rs1259487088 76 dbSNP
rs1035907399 79 dbSNP
rs760580278 80 dbSNP
rs1485781721 84 dbSNP
rs1194761603 89 dbSNP
rs1326514428 101 dbSNP
rs1461988106 110 dbSNP
rs1474324225 124 dbSNP
rs1002721864 129 dbSNP
rs374884627 130 dbSNP
rs1414683990 143 dbSNP
rs1168485105 148 dbSNP
rs1166908958 157 dbSNP
rs1343351481 158 dbSNP
rs562588874 159 dbSNP
rs1298539633 172 dbSNP
rs544091671 176 dbSNP
rs192505307 177 dbSNP
rs1188584327 178 dbSNP
rs771836364 182 dbSNP
rs1252861989 187 dbSNP
rs898159129 192 dbSNP
rs1039373872 200 dbSNP
rs1305516194 203 dbSNP
rs1038709525 205 dbSNP
rs1217852852 206 dbSNP
rs1007079096 213 dbSNP
rs747771968 216 dbSNP
rs147255687 221 dbSNP
rs1484884350 222 dbSNP
rs944373272 227 dbSNP
rs1255582249 228 dbSNP
rs1484311350 229 dbSNP
rs1175488657 233 dbSNP
rs1405741486 240 dbSNP
rs1438952781 244 dbSNP
rs531504998 244 dbSNP
rs1381982602 246 dbSNP
rs779169203 247 dbSNP
rs1432622424 249 dbSNP
rs1307716869 256 dbSNP
rs890205607 257 dbSNP
rs891396877 262 dbSNP
rs1051672450 266 dbSNP
rs935523629 269 dbSNP
rs1295910129 271 dbSNP
rs1373283106 273 dbSNP
rs1241570470 279 dbSNP
rs1312060209 280 dbSNP
rs778582356 282 dbSNP
rs1042103784 283 dbSNP
rs945550049 287 dbSNP
rs1444303073 292 dbSNP
rs370960067 299 dbSNP
rs149584042 302 dbSNP
rs915389527 304 dbSNP
rs371192223 309 dbSNP
rs990037926 322 dbSNP
rs540441995 325 dbSNP
rs1370008601 336 dbSNP
rs1239918393 339 dbSNP
rs938272791 342 dbSNP
rs1043833189 345 dbSNP
rs1415776635 357 dbSNP
rs1442980130 358 dbSNP
rs946810359 364 dbSNP
rs1294882198 367 dbSNP
rs188001301 369 dbSNP
rs557841790 371 dbSNP
rs1369353376 374 dbSNP
rs545437314 379 dbSNP
rs575309489 381 dbSNP
rs958841738 382 dbSNP
rs1347549780 395 dbSNP
rs1213069589 396 dbSNP
rs970679011 398 dbSNP
rs1318763498 401 dbSNP
rs908637289 404 dbSNP
rs1172830843 413 dbSNP
rs1433201571 417 dbSNP
rs138232662 422 dbSNP
rs982861568 423 dbSNP
rs1197935620 424 dbSNP
rs981642227 426 dbSNP
rs951242960 428 dbSNP
rs777183423 429 dbSNP
rs995068177 429 dbSNP
rs1172111508 430 dbSNP
rs1392947188 431 dbSNP
rs1324747223 434 dbSNP
rs1455959154 437 dbSNP
rs1249122757 442 dbSNP
rs1429043720 448 dbSNP
rs1277817732 460 dbSNP
rs538526768 463 dbSNP
rs1025466194 481 dbSNP
rs1220572491 486 dbSNP
rs1176065018 490 dbSNP
rs750399563 491 dbSNP
rs1209211531 500 dbSNP
rs1008523777 502 dbSNP
rs567989487 505 dbSNP
rs890091086 513 dbSNP
rs1213317600 515 dbSNP
rs1042550378 516 dbSNP
rs1009343354 518 dbSNP
rs962459669 535 dbSNP
rs1017873650 546 dbSNP
rs1415073969 553 dbSNP
rs1006526535 556 dbSNP
rs1164397845 557 dbSNP
rs35523264 557 dbSNP
rs1053990969 559 dbSNP
rs150763527 563 dbSNP
rs1207627825 566 dbSNP
rs1361439177 575 dbSNP
rs779689853 576 dbSNP
rs1291639097 581 dbSNP
rs757897581 588 dbSNP
rs1280762877 594 dbSNP
rs1245597502 600 dbSNP
rs1236302892 602 dbSNP
rs1351330899 603 dbSNP
rs1051356143 606 dbSNP
rs1000228572 607 dbSNP
rs182237121 616 dbSNP
rs1285104743 620 dbSNP
rs1488476329 624 dbSNP
rs566812881 630 dbSNP
rs1218423365 631 dbSNP
rs1254941580 632 dbSNP
rs1441346232 650 dbSNP
rs778002677 650 dbSNP
rs551848315 659 dbSNP
rs1187553153 669 dbSNP
rs533290594 671 dbSNP
rs926866946 675 dbSNP
rs1381365971 698 dbSNP
rs946757763 699 dbSNP
rs895243359 701 dbSNP
rs1055094991 702 dbSNP
rs1311356263 703 dbSNP
rs1401697142 710 dbSNP
rs949380569 714 dbSNP
rs568894973 729 dbSNP
rs1294303767 732 dbSNP
rs908561829 736 dbSNP
rs770130356 761 dbSNP
rs1237921394 764 dbSNP
rs189908656 783 dbSNP
rs981373245 784 dbSNP
rs1174654916 785 dbSNP
rs1433366518 788 dbSNP
rs929912196 796 dbSNP
rs553987702 814 dbSNP
rs1257723905 838 dbSNP
rs973897566 842 dbSNP
rs1435540692 845 dbSNP
rs1362511768 858 dbSNP
rs1159046981 861 dbSNP
rs1419111386 866 dbSNP
rs1252009576 871 dbSNP
rs1185235101 872 dbSNP
rs755158154 877 dbSNP
rs1257788340 881 dbSNP
rs1017988148 882 dbSNP
rs186405555 883 dbSNP
rs1466701198 885 dbSNP
rs753964573 893 dbSNP
rs1174501851 897 dbSNP
rs1394506582 905 dbSNP
rs1029779749 907 dbSNP
rs540012281 923 dbSNP
rs528290251 927 dbSNP
rs902782861 932 dbSNP
rs1022449464 940 dbSNP
rs1448754455 944 dbSNP
rs1011082981 946 dbSNP
rs1020647643 949 dbSNP
rs895199504 953 dbSNP
rs766430831 955 dbSNP
rs1315594021 967 dbSNP
rs1197397416 980 dbSNP
rs1259273366 981 dbSNP
rs527830681 985 dbSNP
rs905334578 993 dbSNP
rs1434115178 994 dbSNP
rs939471444 998 dbSNP
rs564175544 1000 dbSNP
rs1416956233 1002 dbSNP
rs1371492502 1005 dbSNP
rs1048221114 1015 dbSNP
rs949643345 1016 dbSNP
rs558449515 1022 dbSNP
rs141266793 1023 dbSNP
rs757138247 1036 dbSNP
rs973837144 1037 dbSNP
rs1467163160 1052 dbSNP
rs1291686112 1062 dbSNP
rs1389835585 1063 dbSNP
rs1366123846 1067 dbSNP
rs1302976930 1073 dbSNP
rs1162090305 1074 dbSNP
rs1474602053 1088 dbSNP
rs1418064299 1092 dbSNP
rs1189660230 1096 dbSNP
rs1319358001 1097 dbSNP
rs1220089546 1100 dbSNP
rs1444960945 1102 dbSNP
rs941203314 1103 dbSNP
rs1205558240 1113 dbSNP
rs377531782 1118 dbSNP
rs556975041 1123 dbSNP
rs1261337675 1128 dbSNP
rs751412861 1133 dbSNP
rs1486805995 1139 dbSNP
rs1425919094 1140 dbSNP
rs773146979 1145 dbSNP
rs1474266790 1152 dbSNP
rs1162672450 1154 dbSNP
rs1349174848 1167 dbSNP
rs1271206536 1175 dbSNP
rs1295031105 1176 dbSNP
rs1211838486 1178 dbSNP
rs1358259714 1183 dbSNP
rs1399065083 1184 dbSNP
rs1298397813 1191 dbSNP
rs955330573 1195 dbSNP
rs767242315 1196 dbSNP
rs1312638868 1199 dbSNP
rs1294091829 1201 dbSNP
rs1247470570 1202 dbSNP
rs1284380624 1203 dbSNP
rs943223505 1204 dbSNP
rs910410553 1208 dbSNP
rs1247222901 1211 dbSNP
rs1324956364 1213 dbSNP
rs1295292107 1221 dbSNP
rs1029303864 1224 dbSNP
rs1424276907 1228 dbSNP
rs1383129700 1230 dbSNP
rs978181933 1231 dbSNP
rs1418851207 1236 dbSNP
rs1158887180 1239 dbSNP
rs1361990193 1240 dbSNP
rs541868463 1243 dbSNP
rs183015858 1244 dbSNP
rs1043142 1257 dbSNP
rs957910982 1262 dbSNP
rs1394529672 1271 dbSNP
rs1353514820 1272 dbSNP
rs1241258170 1276 dbSNP
rs1166527907 1287 dbSNP
rs138732188 1291 dbSNP
rs1372217326 1294 dbSNP
rs57384125 1298 dbSNP
rs1238174010 1306 dbSNP
rs1484260258 1324 dbSNP
rs1430101010 1325 dbSNP
rs1251013191 1331 dbSNP
rs1213024321 1333 dbSNP
rs1003617700 1342 dbSNP
rs1158983464 1343 dbSNP
rs371111670 1343 dbSNP
rs906622696 1348 dbSNP
rs904928399 1350 dbSNP
rs1047699350 1355 dbSNP
rs1174875658 1358 dbSNP
rs1025179937 1360 dbSNP
rs1470664464 1362 dbSNP
rs1329928987 1374 dbSNP
rs558102003 1376 dbSNP
rs993906971 1383 dbSNP
rs887370033 1384 dbSNP
rs1365902759 1389 dbSNP
rs1218906464 1391 dbSNP
rs1250981565 1396 dbSNP
rs1228550370 1397 dbSNP
rs1196751825 1398 dbSNP
rs191670839 1400 dbSNP
rs1047727654 1408 dbSNP
rs897041822 1410 dbSNP
rs1043144 1418 dbSNP
rs898465971 1426 dbSNP
rs748936164 1432 dbSNP
rs1190326246 1443 dbSNP
rs1425367935 1446 dbSNP
rs941319199 1450 dbSNP
rs911034828 1451 dbSNP
rs1481135621 1466 dbSNP
rs1372433380 1470 dbSNP
rs569141136 1474 dbSNP
rs1466649401 1500 dbSNP
rs1407722056 1503 dbSNP
rs1331424622 1504 dbSNP
rs1348574146 1506 dbSNP
rs1436191693 1507 dbSNP
rs942818545 1517 dbSNP
rs1369948230 1521 dbSNP
rs1168161043 1530 dbSNP
rs769361033 1533 dbSNP
rs1318656897 1534 dbSNP
rs186720148 1536 dbSNP
rs778293744 1552 dbSNP
rs966360629 1555 dbSNP
rs1393008811 1581 dbSNP
rs914950332 1596 dbSNP
rs957747443 1614 dbSNP
rs989712678 1623 dbSNP
rs959640301 1625 dbSNP
rs529257784 1626 dbSNP
rs1033822971 1628 dbSNP
rs1477860871 1629 dbSNP
rs1170208322 1632 dbSNP
rs568215588 1636 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 84437.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 84437.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000301919.4 | 3UTR | AUUUUUCUCAUAUCAGGUGAUAUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000301919.4 | 3UTR | AUUUUUCUCAUAUCAGGUGAUAUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000301919.4 | 3UTR | AUUUUUCUCAUAUCAGGUGAUAUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000301919.4 | 3UTR | AUUUUUCUCAUAUCAGGUGAUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000301919.4 | 3UTR | AUUUUUCUCAUAUCAGGUGAUAUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000301919.4 | 3UTR | AUUUUUCUCAUAUCAGGUGAUAUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000301919.4 | 3UTR | ACUCUAGAUUUUUCUCAUAUCAGGUGAUAUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000301919.4 | 3UTR | AUUUUUCUCAUAUCAGGUGAUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000301919.4 | 3UTR | AUUUUUCUCAUAUCAGGUGAUAUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000301919.4 | 3UTR | AUUUUUCUCAUAUCAGGUGAUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.709 7.6e-5 0.634 5.8e-4 23 Click to see details
GSE28544 Breast cancer -0.618 6.4e-4 -0.581 1.5e-3 24 Click to see details
GSE38226 Liver fibrosis -0.581 2.9e-3 -0.131 2.9e-1 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.44 1.4e-2 0.470 8.9e-3 25 Click to see details
GSE19350 CNS germ cell tumors -0.406 9.5e-2 0.019 4.8e-1 12 Click to see details
GSE28260 Renal cortex and medulla 0.378 1.0e-1 0.484 4.7e-2 13 Click to see details
GSE32688 Pancreatic cancer 0.211 1.2e-1 0.197 1.4e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.232 1.3e-1 -0.087 3.4e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.199 3.3e-1 0.143 3.8e-1 7 Click to see details
GSE26953 Aortic valvular endothelial cells 0.078 3.6e-1 0.150 2.4e-1 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.082 3.7e-1 -0.373 5.3e-2 20 Click to see details
GSE21687 Ependynoma primary tumors 0.034 3.9e-1 -0.115 1.8e-1 64 Click to see details
GSE19783 ER+ ER+ breast cancer 0.056 4.1e-1 -0.129 2.9e-1 20 Click to see details
GSE19536 Breast cancer 0.018 4.3e-1 0.029 3.9e-1 100 Click to see details
GSE19783 ER- ER- breast cancer -0.02 4.3e-1 0.016 4.4e-1 79 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.188 0.06 -0.160 0.09 72 Click to see details
PRAD -0.322 0.07 -0.404 0.03 23 Click to see details
KIRP 0.613 0.07 0.750 0.03 7 Click to see details
HNSC 0.269 0.11 0.085 0.35 23 Click to see details
UCEC 0.299 0.14 0.336 0.11 15 Click to see details
LIHC 0.188 0.23 0.082 0.37 18 Click to see details
KICH -0.411 0.25 -0.400 0.25 5 Click to see details
STAD -0.391 0.26 -0.500 0.2 5 Click to see details
THCA 0.106 0.31 0.067 0.38 24 Click to see details
CHOL -0.305 0.35 -0.200 0.4 4 Click to see details
LUAD 0.153 0.36 0.214 0.31 8 Click to see details
KIRC 0.107 0.36 0.044 0.44 13 Click to see details
ESCA -0.234 0.38 -0.600 0.2 4 Click to see details
LUSC 0.033 0.45 0.102 0.34 19 Click to see details
LUSC 0.033 0.45 0.102 0.34 19 Click to see details
LUSC 0.033 0.45 0.102 0.34 19 Click to see details
LUSC 0.033 0.45 0.102 0.34 19 Click to see details
LUSC 0.033 0.45 0.102 0.34 19 Click to see details
LUSC 0.033 0.45 0.102 0.34 19 Click to see details
60 hsa-miR-190b Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT054581 IGF1 insulin like growth factor 1 4 1
MIRT066966 ATXN7L3B ataxin 7 like 3B 2 2
MIRT192449 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT250414 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT306294 KLHL24 kelch like family member 24 2 2
MIRT355845 SGMS2 sphingomyelin synthase 2 2 4
MIRT437770 MTMR6 myotubularin related protein 6 1 1
MIRT437771 MTMR6 myotubularin related protein 6 1 1
MIRT437772 Mtmr6 myotubularin related protein 6 1 1
MIRT444672 CDKL2 cyclin dependent kinase like 2 2 2
MIRT446389 PCDHB11 protocadherin beta 11 2 2
MIRT446634 SDC3 syndecan 3 2 2
MIRT449410 TRIM5 tripartite motif containing 5 2 2
MIRT449560 GPC5 glypican 5 2 2
MIRT469928 PTPRJ protein tyrosine phosphatase, receptor type J 2 6
MIRT473736 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT474210 LDHA lactate dehydrogenase A 2 2
MIRT474583 KLF6 Kruppel like factor 6 2 2
MIRT476732 FOXN2 forkhead box N2 2 2
MIRT478455 DAB2 DAB2, clathrin adaptor protein 2 2
MIRT495327 ADAMTS8 ADAM metallopeptidase with thrombospondin type 1 motif 8 2 4
MIRT498615 MTRNR2L10 MT-RNR2-like 10 2 12
MIRT501734 OVOL1 ovo like transcriptional repressor 1 2 2
MIRT501849 MTRNR2L8 MT-RNR2-like 8 2 14
MIRT504678 CYGB cytoglobin 2 4
MIRT506517 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 6
MIRT507984 BCL2L13 BCL2 like 13 2 4
MIRT508444 ZNF608 zinc finger protein 608 2 4
MIRT511366 IL6ST interleukin 6 signal transducer 2 4
MIRT520515 TRA2B transformer 2 beta homolog 2 2
MIRT524571 CALML4 calmodulin like 4 2 4
MIRT531896 INVS inversin 2 4
MIRT533916 TATDN2 TatD DNase domain containing 2 2 2
MIRT537503 FAM13B family with sequence similarity 13 member B 2 2
MIRT541689 CCDC160 coiled-coil domain containing 160 2 8
MIRT544419 ZNF460 zinc finger protein 460 2 4
MIRT544615 CSDE1 cold shock domain containing E1 2 2
MIRT545076 IL7R interleukin 7 receptor 2 2
MIRT545849 ZNF264 zinc finger protein 264 2 4
MIRT547436 MED4 mediator complex subunit 4 2 2
MIRT550157 ZNF223 zinc finger protein 223 2 4
MIRT553948 STAMBP STAM binding protein 2 2
MIRT554395 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT555667 PGAM4 phosphoglycerate mutase family member 4 2 4
MIRT564193 PM20D2 peptidase M20 domain containing 2 2 2
MIRT566792 MKL2 MKL1/myocardin like 2 2 2
MIRT566843 LRRC58 leucine rich repeat containing 58 2 2
MIRT572516 KIAA0232 KIAA0232 2 2
MIRT607428 NOTCH2NL notch 2 N-terminal like 2 10
MIRT627779 RAB30 RAB30, member RAS oncogene family 2 2
MIRT635159 ENO4 enolase family member 4 2 2
MIRT642159 ADCYAP1R1 ADCYAP receptor type I 3 2
MIRT646205 DUSP10 dual specificity phosphatase 10 2 2
MIRT657007 KCNMB4 potassium calcium-activated channel subfamily M regulatory beta subunit 4 2 2
MIRT665817 TMEM161B transmembrane protein 161B 2 2
MIRT667488 MAP3K2 mitogen-activated protein kinase kinase kinase 2 2 2
MIRT707098 ZNF850 zinc finger protein 850 2 2
MIRT708719 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT735521 HUS1 HUS1 checkpoint clamp component 3 0
MIRT736644 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-190b Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-190b Atorvastatin approved 60823 Microarray PC3 prostate cancer cells 23936432 2013 up-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-190b Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)

Error report submission