>KIF23|NM_004856|3'UTR
   1 ACTGACAGTCCCAGTACTGAAAGAACATTTTCATTTGTGTGGATGATTTCTCGAAAGCCATGCCAGAAGCAGTCTTCCAG
  81 GTCATCTTGTAGAACTCCAGCTTTGTTGAAAATCACGGACCTCAGCTACATCATACACTGACCCAGAGCAAAGCTTTCCC
 161 TATGGTTCCAAAGACAACTAGTATTCAACAAACCTTGTATAGTATATGTTTTGCCATATTTAATATTAATAGCAGAGGAA
 241 GACTCCTTTTTTCATCACTGTATGAATTTTTTATAATGTTTTTTTAAAATATATTTCATGTATACTTATAAACTAATTCA
 321 CACAAGTGTTTGTCTTAGATGATTAAGGAAGACTATATCTAGATCATGTCTGATTTTTTATTGTGACTTCTCCAGCCCTG
 401 GTCTGAATTTCTTAAGGTTTTATAAACAAATGCTGCTATTTATTAGCTGCAAGAATGCACTTTAGAACTATTTGACAATT
 481 CAGACTTTCAAAATAAAGATGTAAATGACTGGCCAATAATAACCATTTTAGGAAGGTGTTTTGAATTCTGTATGTATATA
 561 TTCACTTTCTGACATTTAGATATGCCAAAAGAATTAAAATCAAAAGCACTAAGAAATACAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gaGGUAAAAGGUGGUCUCGACGu 5' |:|||| |:: |||||| Target 5' tgCTATTT---ATT--AGCTGCa 3'	434 - 451	125.00	-11.40
2	miRNA 3' gaGGUAAAAG---GU-GGUCUCGACGu 5' :|| |||| || ::||| ||| Target 5' atTCACTTTCTGACATTTAGATATGCc 3'	560 - 586	101.00	-7.90
3	miRNA 3' gagGUAAAAGGU-----GGUCUCGacgu 5' ||| | || ||||||| Target 5' ctaCATCATACACTGACCCAGAGCaaag 3'	126 - 153	100.00	-10.96

Mutant ID	Mutant Position	Mutant Source
COSN26981561	12	COSMIC
COSN31507378	17	COSMIC
COSN28881072	18	COSMIC
COSN21870674	22	COSMIC
COSN30124008	24	COSMIC
COSN30470362	33	COSMIC
COSN26562889	38	COSMIC
COSN30502227	51	COSMIC
COSN5859975	137	COSMIC
COSN30105721	183	COSMIC
COSN31490196	236	COSMIC
COSN30540402	434	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1281448293	3	dbSNP
rs758672998	4	dbSNP
rs766613407	5	dbSNP
rs751766866	15	dbSNP
rs781276001	16	dbSNP
rs748094759	24	dbSNP
rs1294292729	27	dbSNP
rs1224555945	28	dbSNP
rs779472548	42	dbSNP
rs202162768	43	dbSNP
rs1490032564	44	dbSNP
rs777749964	46	dbSNP
rs1234233462	48	dbSNP
rs749066955	52	dbSNP
rs368965562	53	dbSNP
rs147396564	54	dbSNP
rs553528873	62	dbSNP
rs879637957	63	dbSNP
rs993334822	65	dbSNP
rs976936584	66	dbSNP
rs1249552109	70	dbSNP
rs1286823639	71	dbSNP
rs1484090932	73	dbSNP
rs1026112601	90	dbSNP
rs954515018	91	dbSNP
rs987198871	92	dbSNP
rs1442731149	106	dbSNP
rs1211364850	111	dbSNP
rs138100506	117	dbSNP
rs1425399112	118	dbSNP
rs765561241	122	dbSNP
rs984318650	126	dbSNP
rs117120578	128	dbSNP
rs564272289	133	dbSNP
rs763191007	139	dbSNP
rs1218834259	144	dbSNP
rs1423792185	163	dbSNP
rs1427424517	165	dbSNP
rs1246158112	166	dbSNP
rs968964319	170	dbSNP
rs868763105	174	dbSNP
rs927954252	180	dbSNP
rs1360718964	190	dbSNP
rs192557685	190	dbSNP
rs1057050405	202	dbSNP
rs13613	205	dbSNP
rs948524689	219	dbSNP
rs1042921300	220	dbSNP
rs938809769	246	dbSNP
rs1364396450	257	dbSNP
rs1163840361	259	dbSNP
rs1313909421	263	dbSNP
rs904266004	265	dbSNP
rs1192142896	266	dbSNP
rs998647633	269	dbSNP
rs1057468767	273	dbSNP
rs1413227167	274	dbSNP
rs761065091	278	dbSNP
rs1280348744	279	dbSNP
rs59826363	286	dbSNP
rs915985180	286	dbSNP
rs948764724	287	dbSNP
rs1214096261	294	dbSNP
rs1359017583	294	dbSNP
rs866554926	298	dbSNP
rs1250003668	299	dbSNP
rs1227061449	301	dbSNP
rs751713501	306	dbSNP
rs1053286528	327	dbSNP
rs1313934997	341	dbSNP
rs900806617	348	dbSNP
rs754946344	353	dbSNP
rs1402718144	354	dbSNP
rs1344368610	355	dbSNP
rs997824900	360	dbSNP
rs1028503211	365	dbSNP
rs1211294613	368	dbSNP
rs1407037667	373	dbSNP
rs1279429019	374	dbSNP
rs1394200016	382	dbSNP
rs954323010	384	dbSNP
rs757455190	397	dbSNP
rs1006131762	407	dbSNP
rs34664771	414	dbSNP
rs141750449	416	dbSNP
rs1479565590	417	dbSNP
rs1246221001	424	dbSNP
rs1242368125	440	dbSNP
rs993387179	443	dbSNP
rs1485230972	451	dbSNP
rs1453834881	459	dbSNP
rs972804770	460	dbSNP
rs755128404	464	dbSNP
rs1319120500	471	dbSNP
rs753707052	472	dbSNP
rs368592079	479	dbSNP
rs1008716508	484	dbSNP
rs1322339736	486	dbSNP
rs1174638288	493	dbSNP
rs11557305	494	dbSNP
rs1017803162	496	dbSNP
rs574869613	500	dbSNP
rs1328175830	503	dbSNP
rs1447383773	506	dbSNP
rs1402253253	508	dbSNP
rs960668848	511	dbSNP
rs964488743	514	dbSNP
rs1468459022	521	dbSNP
rs1394793921	549	dbSNP
rs757125385	551	dbSNP
rs1479083633	555	dbSNP
rs533785044	555	dbSNP
rs1021979104	559	dbSNP
rs1346039225	561	dbSNP
rs1458591040	564	dbSNP
rs1430080820	568	dbSNP
rs966339439	571	dbSNP
rs977690229	578	dbSNP
rs1287235119	582	dbSNP
rs1278820448	588	dbSNP
rs145678431	596	dbSNP
rs766325609	596	dbSNP
rs752992177	609	dbSNP
rs778821746	610	dbSNP
rs960224584	615	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.