| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-19a |
| Genomic Coordinates | chr13: 91350891 - 91350972 |
| Synonyms | MIRN19A, hsa-mir-19a, miR-19a, miRNA19A, MIR19A |
| Description | Homo sapiens miR-19a stem-loop |
| Comment | This sequence maps to chromosome 13 and is named miR-19a precursor-13 in reference . |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-19a-5p | ||||||||||||||||||||||||||||||
| Sequence | 14| AGUUUUGCAUAGUUGCACUACA |35 | ||||||||||||||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||||||||||||||
| Experiments | Cloned | ||||||||||||||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||||||||||||||
| Putative Targets | |||||||||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Biomarker Information |
| ||||||
|---|---|---|---|---|---|---|---|
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | HMGA2 | ||||||||||||||||||||
| Synonyms | BABL, HMGI-C, HMGIC, LIPO, STQTL9 | ||||||||||||||||||||
| Description | high mobility group AT-hook 2 | ||||||||||||||||||||
| Transcript | NM_003483 | ||||||||||||||||||||
| Other Transcripts | NM_003484 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on HMGA2 | |||||||||||||||||||||
| 3'UTR of HMGA2 (miRNA target sites are highlighted) |
>HMGA2|NM_003483|3'UTR 1 GGGGCGCCAACGTTCGATTTCTACCTCAGCAGCAGTTGGATCTTTTGAAGGGAGAAGACACTGCAGTGACCACTTATTCT 81 GTATTGCCATGGTCTTTCCACTTTCATCTGGGGTGGGGTGGGGTGGGGTGGGGGAGGGGGGGGTGGGGTGGGGAGAAATC 161 ACATAACCTTAAAAAGGACTATATTAATCACCTTCTTTGTAATCCCTTCACAGTCCCAGGTTTAGTGAAAAACTGCTGTA 241 AACACAGGGGACACAGCTTAACAATGCAACTTTTAATTACTGTTTTCTTTTTTCTTAACCTACTAATAGTTTGTTGATCT 321 GATAAGCAAGAGTGGGCGGGTGAGAAAAACCGAATTGGGTTTAGTCAATCACTGCACTGCATGCAAACAAGAAACGTGTC 401 ACACTTGTGACGTCGGGCATTCATATAGGAAGAACGCGGTGTGTAACACTGTGTACACCTCAAATACCACCCCAACCCAC 481 TCCCTGTAGTGAATCCTCTGTTTAGAACACCAAAGATAAGGACTAGATACTACTTTCTCTTTTTCGTATAATCTTGTAGA 561 CACTTACTTGATGATTTTTAACTTTTTATTTCTAAATGAGACGAAATGCTGATGTATCCTTTCATTCAGCTAACAAACTA 641 GAAAAGGTTATGTTCATTTTTCAAAAAGGGAAGTAAGCAAACAAATATTGCCAACTCTTCTATTTATGGATATCACACAT 721 ATCAGCAGGAGTAATAAATTTACTCACAGCACTTGTTTTCAGGACAACACTTCATTTTCAGGAAATCTACTTCCTACAGA 801 GCCAAAATGCCATTTAGCAATAAATAACACTTGTCAGCCTCAGAGCATTTAAGGAAACTAGACAAGTAAAATTATCCTCT 881 TTGTAATTTAATGAAAAGGTACAACAGAATAATGCATGATGAACTCACCTAATTATGAGGTGGGAGGAGCGAAATCTAAA 961 TTTCTTTTGCTATAGTTATACATCAATTTAAAAAGCAAAAAAAAAAAAGGGGGGGGCAATCTCTCTCTGTGTCTTTCTCT 1041 CTCTCTCTTCCTCTCCCTCTCTCTTTTCATTGTGTATCAGTTTCCATGAAAGACCTGAATACCACTTACCTCAAATTAAG 1121 CATATGTGTTACTTCAAGTAATACGTTTTGACATAAGATGGTTGACCAAGGTGCTTTTCTTCGGCTTGAGTTCACCATCT 1201 CTTCATTCAAACTGCACTTTTAGCCAGAGATGCAATATATCCCCACTACTCAATACTACCTCTGAATGTTACAACGAATT 1281 TACAGTCTAGTACTTATTACATGCTGCTATACACAAGCAATGCAAGAAAAAAACTTACTGGGTAGGTGATTCTAATCATC 1361 TGCAGTTCTTTTTGTACACTTAATTACAGTTAAAGAAGCAATCTCCTTACTGTGTTTCAGCATGACTATGTATTTTTCTA 1441 TGTTTTTTTAATTAAAAATTTTTAAAATACTTGTTTCAGCTTCTCTGCTAGATTTCTACATTAACTTGAAAATTTTTTAA 1521 CCAAGTCGCTCCTAGGTTCTTAAGGATAATTTTCCTCAATCACACTACACATCACACAAGATTTGACTGTAATATTTAAA 1601 TATTACCCTCCAAGTCTGTACCTCAAATGAATTCTTTAAGGAGATGGACTAATTGACTTGCAAAGACCTACCTCCAGACT 1681 TCAAAAGGAATGAACTTGTTACTTGCAGCATTCATTTGTTTTTTCAATGTTTGAAATAGTTCAAACTGCAGCTAACCCTA 1761 GTCAAAACTATTTTTGTAAAAGACATTTGATAGAAAGGAACACGTTTTTACATACTTTTGCAAAATAAGTAAATAATAAA 1841 TAAAATAAAAGCCAACCTTCAAAGAAACTTGAAGCTTTGTAGGTGAGATGCAACAAGCCCTGCTTTTGCATAATGCAATC 1921 AAAAATATGTGTTTTTAAGATTAGTTGAATATAAGAAAATGCTTGACAAATATTTTCATGTATTTTACACAAATGTGATT 2001 TTTGTAATATGTCTCAACCAGATTTATTTTAAACGCTTCTTATGTAGAGTTTTTATGCCTTTCTCTCCTAGTGAGTGTGC 2081 TGACTTTTTAACATGGTATTATCAACTGGGCCAGGAGGTAGTTTCTCATGACGGCTTTTGTCAGTATGGCTTTTAGTACT 2161 GAAGCCAAATGAAACTCAAAACCATCTCTCTTCCAGCTGCTTCAGGGAGGTAGTTTCAAAGGCCACATACCTCTCTGAGA 2241 CTGGCAGATCGCTCACTGTTGTGAATCACCAAAGGAGCTATGGAGAGAATTAAAACTCAACATTACTGTTAACTGTGCGT 2321 TAAATAAGCAAATAAACAGTGGCTCATAAAAATAAAAGTCGCATTCCATATCTTTGGATGGGCCTTTTAGAAACCTCATT 2401 GGCCAGCTCATAAAATGGAAGCAATTGCTCATGTTGGCCAAACATGGTGCACCGAGTGATTTCCATCTCTGGTAAAGTTA 2481 CACTTTTATTTCCTGTATGTTGTACAATCAAAACACACTACTACCTCTTAAGTCCCAGTATACCTCATTTTTCATACTGA 2561 AAAAAAAAGCTTGTGGCCAATGGAACAGTAAGAACATCATAAAATTTTTATATATATAGTTTATTTTTGTGGGAGATAAA 2641 TTTTATAGGACTGTTCTTTGCTGTTGTTGGTCGCAGCTACATAAGACTGGACATTTAACTTTTCTACCATTTCTGCAAGT 2721 TAGGTATGTTTGCAGGAGAAAAGTATCAAGACGTTTAACTGCAGTTGACTTTCTCCCTGTTCCTTTGAGTGTCTTCTAAC 2801 TTTATTCTTTGTTCTTTATGTAGAATTGCTGTCTATGATTGTACTTTGAATCGCTTGCTTGTTGAAAATATTTCTCTAGT 2881 GTATTATCACTGTCTGTTCTGCACAATAAACATAACAGCCTCTGTGATCCCCATGTGTTTTGATTCCTGCTCTTTGTTAC 2961 AGTTCCATTAAATGAGTAATAAAGTTTGGTCAAAACAGAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 8091.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 8091.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5
PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5
PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7
PAR-CLIP data was present in ERX177605. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_7
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| CLIP-seq Support 1 for dataset GSM714642 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000403681.2 | 3UTR | UACAAUCAAAACACACUACUACCUCUUAAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000403681.2 | 3UTR | UACAAUCAAAACACACUACUACCUCUUAAGUC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM1065667 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
| Location of target site | ENST00000403681.2 | 3UTR | UACAAUCAAAACACACUACUACCUCUUAAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM1065670 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
| Location of target site | ENST00000403681.2 | 3UTR | UACAAUCAAAACACACUACUACCUCUUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
92 hsa-miR-19a-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT038980 | WDR96 | cilia and flagella associated protein 43 |  |
1 | 1 | |||||||
| MIRT063864 | RASSF8 | Ras association domain family member 8 | |
|
2 | 6 | ||||||
| MIRT077656 | IGF2BP1 | insulin like growth factor 2 mRNA binding protein 1 | |
|
2 | 2 | ||||||
| MIRT078461 | MAP3K3 | mitogen-activated protein kinase kinase kinase 3 | |
|
2 | 2 | ||||||
| MIRT095248 | FAM13B | family with sequence similarity 13 member B | |
|
2 | 2 | ||||||
| MIRT109490 | KLHL15 | kelch like family member 15 | |
|
2 | 6 | ||||||
| MIRT155378 | CCNT2 | cyclin T2 | |
|
2 | 2 | ||||||
| MIRT163208 | EDEM1 | ER degradation enhancing alpha-mannosidase like protein 1 | |
|
2 | 2 | ||||||
| MIRT188326 | ARID1A | AT-rich interaction domain 1A | |
|
2 | 2 | ||||||
| MIRT204723 | BZW1 | basic leucine zipper and W2 domains 1 | |
|
2 | 4 | ||||||
| MIRT236399 | HMGXB4 | HMG-box containing 4 | |
|
2 | 2 | ||||||
| MIRT237114 | P2RY1 | purinergic receptor P2Y1 | |
|
2 | 5 | ||||||
| MIRT286942 | SOCS7 | suppressor of cytokine signaling 7 | |
|
2 | 2 | ||||||
| MIRT442523 | MOB3B | MOB kinase activator 3B | |
|
2 | 2 | ||||||
| MIRT473428 | MDM4 | MDM4, p53 regulator | |
|
2 | 2 | ||||||
| MIRT476783 | FOS | Fos proto-oncogene, AP-1 transcription factor subunit | |
|
2 | 2 | ||||||
| MIRT476942 | FAM83G | family with sequence similarity 83 member G | |
|
2 | 2 | ||||||
| MIRT480184 | CALM2 | calmodulin 2 | |
|
2 | 6 | ||||||
| MIRT489620 | ZNF384 | zinc finger protein 384 | |
|
2 | 2 | ||||||
| MIRT492246 | SLC39A9 | solute carrier family 39 member 9 | |
|
2 | 2 | ||||||
| MIRT492422 | RGL2 | ral guanine nucleotide dissociation stimulator like 2 | |
|
2 | 2 | ||||||
| MIRT494860 | ZNF99 | zinc finger protein 99 | |
|
2 | 2 | ||||||
| MIRT497001 | SNAP25 | synaptosome associated protein 25 | |
|
2 | 2 | ||||||
| MIRT501973 | MAPK6 | mitogen-activated protein kinase 6 | |
|
2 | 2 | ||||||
| MIRT504917 | CD38 | CD38 molecule | |
|
2 | 4 | ||||||
| MIRT507019 | HMGA2 | high mobility group AT-hook 2 | |
|
2 | 6 | ||||||
| MIRT510820 | SBNO1 | strawberry notch homolog 1 | |
|
2 | 4 | ||||||
| MIRT514166 | PGPEP1 | pyroglutamyl-peptidase I | |
|
2 | 2 | ||||||
| MIRT514328 | PSMG2 | proteasome assembly chaperone 2 | |
|
2 | 4 | ||||||
| MIRT514429 | SLC38A7 | solute carrier family 38 member 7 | |
|
2 | 2 | ||||||
| MIRT514537 | ESR2 | estrogen receptor 2 | |
|
2 | 2 | ||||||
| MIRT516117 | SRPX2 | sushi repeat containing protein, X-linked 2 | |
|
2 | 4 | ||||||
| MIRT517759 | ZNF366 | zinc finger protein 366 | |
|
2 | 4 | ||||||
| MIRT518495 | FAM161B | family with sequence similarity 161 member B | |
|
2 | 4 | ||||||
| MIRT518512 | CASP10 | caspase 10 | |
|
2 | 2 | ||||||
| MIRT518561 | GDPD1 | glycerophosphodiester phosphodiesterase domain containing 1 | |
|
2 | 2 | ||||||
| MIRT518641 | NOM1 | nucleolar protein with MIF4G domain 1 | |
|
2 | 2 | ||||||
| MIRT518729 | ABCG8 | ATP binding cassette subfamily G member 8 | |
|
2 | 2 | ||||||
| MIRT523565 | GGCX | gamma-glutamyl carboxylase | |
|
2 | 4 | ||||||
| MIRT526523 | YIPF6 | Yip1 domain family member 6 | |
|
2 | 2 | ||||||
| MIRT530254 | ZNF620 | zinc finger protein 620 | |
|
2 | 2 | ||||||
| MIRT531658 | ZFP14 | ZFP14 zinc finger protein | |
|
2 | 2 | ||||||
| MIRT532699 | TCN2 | transcobalamin 2 | |
|
2 | 4 | ||||||
| MIRT534019 | STXBP4 | syntaxin binding protein 4 | |
|
2 | 2 | ||||||
| MIRT535748 | MYO10 | myosin X | |
|
2 | 4 | ||||||
| MIRT544509 | GTF2E2 | general transcription factor IIE subunit 2 | |
|
2 | 2 | ||||||
| MIRT546758 | RLIM | ring finger protein, LIM domain interacting | |
|
2 | 2 | ||||||
| MIRT547929 | HNRNPR | heterogeneous nuclear ribonucleoprotein R | |
|
2 | 2 | ||||||
| MIRT550130 | ZNF138 | zinc finger protein 138 | |
|
2 | 2 | ||||||
| MIRT551763 | MED21 | mediator complex subunit 21 | |
|
2 | 2 | ||||||
| MIRT557727 | FYCO1 | FYVE and coiled-coil domain containing 1 | |
|
2 | 2 | ||||||
| MIRT558924 | CBX1 | chromobox 1 | |
|
2 | 2 | ||||||
| MIRT562466 | CORO1C | coronin 1C | |
|
2 | 2 | ||||||
| MIRT562759 | ZNF846 | zinc finger protein 846 | |
|
2 | 2 | ||||||
| MIRT563061 | ZNF28 | zinc finger protein 28 | |
|
2 | 2 | ||||||
| MIRT563336 | RPLP0 | ribosomal protein lateral stalk subunit P0 | |
|
2 | 2 | ||||||
| MIRT569170 | DMD | dystrophin | |
|
2 | 2 | ||||||
| MIRT573256 | TNFAIP6 | TNF alpha induced protein 6 | |
|
2 | 2 | ||||||
| MIRT575057 | P2ry1 | purinergic receptor P2Y, G-protein coupled 1 | |
|
2 | 4 | ||||||
| MIRT575360 | Zxda | zinc finger, X-linked, duplicated A | |
|
2 | 2 | ||||||
| MIRT613233 | CCDC39 | coiled-coil domain containing 39 | |
|
2 | 2 | ||||||
| MIRT613347 | ADRBK2 | G protein-coupled receptor kinase 3 | |
|
2 | 6 | ||||||
| MIRT613952 | TMEM59 | transmembrane protein 59 | |
|
2 | 2 | ||||||
| MIRT615488 | EDN1 | endothelin 1 | |
|
2 | 2 | ||||||
| MIRT618710 | ESD | esterase D | |
|
2 | 2 | ||||||
| MIRT630609 | ARHGAP1 | Rho GTPase activating protein 1 | |
|
2 | 2 | ||||||
| MIRT630619 | CXCR6 | C-X-C motif chemokine receptor 6 | |
|
2 | 2 | ||||||
| MIRT630631 | IMPAD1 | inositol monophosphatase domain containing 1 | |
|
2 | 2 | ||||||
| MIRT630674 | KLF7 | Kruppel like factor 7 | |
|
2 | 2 | ||||||
| MIRT630746 | COG6 | component of oligomeric golgi complex 6 | |
|
2 | 2 | ||||||
| MIRT636853 | ZSCAN2 | zinc finger and SCAN domain containing 2 | |
|
2 | 2 | ||||||
| MIRT638642 | GPATCH8 | G-patch domain containing 8 | |
|
2 | 2 | ||||||
| MIRT639106 | MMAB | methylmalonic aciduria (cobalamin deficiency) cblB type | |
|
2 | 2 | ||||||
| MIRT639422 | PKP1 | plakophilin 1 | |
|
2 | 2 | ||||||
| MIRT640187 | ABCC12 | ATP binding cassette subfamily C member 12 | |
|
2 | 2 | ||||||
| MIRT641757 | SF3A1 | splicing factor 3a subunit 1 | |
|
2 | 2 | ||||||
| MIRT666577 | RHOBTB3 | Rho related BTB domain containing 3 | |
|
2 | 2 | ||||||
| MIRT672166 | FANCF | Fanconi anemia complementation group F | |
|
2 | 2 | ||||||
| MIRT688345 | ETS1 | ETS proto-oncogene 1, transcription factor | |
|
2 | 2 | ||||||
| MIRT690120 | ZFAND1 | zinc finger AN1-type containing 1 | |
|
2 | 2 | ||||||
| MIRT696939 | CERK | ceramide kinase | |
|
2 | 2 | ||||||
| MIRT701361 | NR4A3 | nuclear receptor subfamily 4 group A member 3 | |
|
2 | 2 | ||||||
| MIRT703288 | GID4 | GID complex subunit 4 homolog | |
|
2 | 2 | ||||||
| MIRT709146 | ZNF799 | zinc finger protein 799 | |
|
2 | 2 | ||||||
| MIRT710848 | FAM210A | family with sequence similarity 210 member A | |
|
2 | 2 | ||||||
| MIRT712621 | GTF2H5 | general transcription factor IIH subunit 5 | |
|
2 | 2 | ||||||
| MIRT714591 | CMBL | carboxymethylenebutenolidase homolog | |
|
2 | 2 | ||||||
| MIRT716909 | CACNB2 | calcium voltage-gated channel auxiliary subunit beta 2 | |
|
2 | 2 | ||||||
| MIRT721165 | FAM200B | family with sequence similarity 200 member B | |
|
2 | 2 | ||||||
| MIRT722404 | BCAS2 | BCAS2, pre-mRNA processing factor | |
|
2 | 2 | ||||||
| MIRT722517 | DSTYK | dual serine/threonine and tyrosine protein kinase | |
|
2 | 2 | ||||||
| MIRT724599 | AP3B1 | adaptor related protein complex 3 beta 1 subunit | |
|
2 | 2 | ||||||
| miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|