pre-miRNA Information
pre-miRNA hsa-mir-628   
Genomic Coordinates chr15: 55372940 - 55373034
Synonyms MIRN628, hsa-mir-628, MIR628
Description Homo sapiens miR-628 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-628-3p
Sequence 61| UCUAGUAAGAGUGGCAGUCGA |81
Evidence Experimental
Experiments Microarray
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 7 15 - 55372968 29233923 MiREDiBase
A-to-I 8 15 - 55372967 29233923 MiREDiBase
C-to-U 19 15 - 55372956 20591823 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN26969715 1 COSMIC
COSN30123186 10 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1410255602 2 dbSNP
rs1401315366 3 dbSNP
rs1322836365 4 dbSNP
rs1158103480 8 dbSNP
rs1216611749 11 dbSNP
rs749619551 13 dbSNP
rs778157225 18 dbSNP
rs756600789 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FAM60A
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 58516.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' agcugacggUGAGAAUGAUCu 5'
                   |||:||||||| 
Target 5' auaaucaaaACUUUUACUAG- 3'
7 - 26
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 58516.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' agcugacggUGAGAAUGAUCu 5'
                   |||:||||||| 
Target 5' auaaucaaaACUUUUACUAG- 3'
7 - 26
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 58516.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000539409.1 | 3UTR | AUACUUAUAAUCAAAACUUUUACUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000539409.1 | 3UTR | AUACUUAUAAUCAAAACUUUUACUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000539409.1 | 3UTR | AUACUUAUAAUCAAAACUUUUACUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer -0.416 8.4e-6 -0.453 1.1e-6 100 Click to see details
GSE28544 Breast cancer -0.745 1.5e-5 -0.745 1.5e-5 24 Click to see details
GSE19783 ER- ER- breast cancer -0.38 2.8e-4 -0.420 5.8e-5 79 Click to see details
GSE19783 ER+ ER+ breast cancer -0.619 1.8e-3 -0.558 5.3e-3 20 Click to see details
GSE21687 Ependynoma primary tumors -0.333 3.6e-3 -0.275 1.4e-2 64 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.477 1.7e-2 0.586 3.3e-3 20 Click to see details
GSE17306 Multiple myeloma -0.291 2.1e-2 -0.177 1.1e-1 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.289 8.1e-2 -0.314 6.3e-2 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.301 8.1e-2 -0.330 6.2e-2 23 Click to see details
GSE21849 B cell lymphoma 0.238 1.1e-1 0.238 1.1e-1 29 Click to see details
GSE28260 Renal cortex and medulla 0.336 1.3e-1 0.280 1.8e-1 13 Click to see details
GSE32688 Pancreatic cancer 0.187 1.5e-1 0.122 2.5e-1 32 Click to see details
GSE14794 Lymphoblastoid cells 0.052 3.1e-1 0.051 3.2e-1 90 Click to see details
GSE19350 CNS germ cell tumors -0.098 3.8e-1 -0.154 3.2e-1 12 Click to see details
GSE17498 Multiple myeloma 0.041 4.0e-1 -0.122 2.3e-1 40 Click to see details
GSE27834 Pluripotent stem cells -0.062 4.1e-1 -0.074 3.9e-1 16 Click to see details
GSE27834 Pluripotent stem cells -0.062 4.1e-1 -0.074 3.9e-1 16 Click to see details
GSE27834 Pluripotent stem cells -0.062 4.1e-1 -0.074 3.9e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC -0.388 0.01 -0.504 0 40 Click to see details
UCEC -0.523 0.01 -0.478 0.02 18 Click to see details
STAD 0.418 0.01 0.425 0.01 28 Click to see details
KIRP -0.398 0.02 -0.420 0.01 29 Click to see details
HNSC -0.344 0.02 -0.303 0.04 35 Click to see details
BLCA 0.342 0.09 0.434 0.04 17 Click to see details
PAAD 0.714 0.14 0.200 0.4 4 Click to see details
LUAD -0.294 0.2 -0.224 0.27 10 Click to see details
ESCA 0.247 0.23 0.291 0.19 11 Click to see details
BRCA -0.106 0.28 -0.267 0.06 34 Click to see details
THCA -0.079 0.28 -0.039 0.39 58 Click to see details
PRAD 0.101 0.28 0.121 0.24 36 Click to see details
CESC -0.553 0.31 -0.500 0.33 3 Click to see details
LUSC -0.057 0.37 -0.032 0.43 35 Click to see details
CHOL -0.097 0.42 0.071 0.44 7 Click to see details
PCPG -0.235 0.42 -0.500 0.33 3 Click to see details
KICH 0.033 0.44 -0.018 0.47 22 Click to see details
LIHC -0.001 0.5 0.007 0.48 49 Click to see details
LIHC -0.001 0.5 0.007 0.48 49 Click to see details
27 hsa-miR-628-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT039584 CDC14A cell division cycle 14A 1 1
MIRT039585 AGO1 argonaute 1, RISC catalytic component 2 3
MIRT039586 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT039587 LRP6 LDL receptor related protein 6 1 1
MIRT071876 BTF3L4 basic transcription factor 3 like 4 2 2
MIRT097443 JMY junction mediating and regulatory protein, p53 cofactor 2 4
MIRT100100 ABT1 activator of basal transcription 1 2 8
MIRT147692 CBX4 chromobox 4 2 2
MIRT408248 PURA purine rich element binding protein A 2 2
MIRT442047 LRAT lecithin retinol acyltransferase 2 2
MIRT444412 RAB3IP RAB3A interacting protein 2 2
MIRT452599 REPIN1 replication initiator 1 2 2
MIRT469515 RBFOX2 RNA binding protein, fox-1 homolog 2 2 8
MIRT498192 AKR1B10 aldo-keto reductase family 1 member B10 2 2
MIRT500151 CREBBP CREB binding protein 2 2
MIRT507319 FAM60A SIN3-HDAC complex associated factor 2 6
MIRT508343 ZNF273 zinc finger protein 273 2 6
MIRT520480 TRIM13 tripartite motif containing 13 2 2
MIRT522461 MMP16 matrix metallopeptidase 16 2 4
MIRT547116 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT548675 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 2
MIRT553756 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT559437 ARSJ arylsulfatase family member J 2 2
MIRT610490 GPC4 glypican 4 2 2
MIRT644682 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT658214 FBXO21 F-box protein 21 2 2
MIRT756083 TP53 tumor protein p53 4 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-628 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-628-3p Cisplatin 5460033 NSC119875 approved resistant High Tongue Squamous Cell Carcinoma cell line (Tca8113)
hsa-miR-628-3p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-628-3p Erlotinib 176870 NSC718781 approved sensitive High Epithelial Cancer cell line (A549, UKY-29, H460, H1975, H1650, H3255, PC-9, H358)
hsa-miR-628-3p Siop Treatment Protocol sensitive High Nephroblastoma tissue
hsa-miR-628-3p Sunitinib 5329102 NSC750690 approved resistant High Metastatic Renal Cell Carcinoma tissue and cell line (Caki-2)
hsa-miR-628-3p Chemotherapy sensitive High Epithelial Ovarian Cancer tissue
hsa-miR-628-3p Platinum-based doublet chemotherapy resistant Low Lung Adenocarcinoma tissue
hsa-miR-628-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-628-3p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (TAMR8)
hsa-miR-628-3p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-628-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-628-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-628-3p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-628-3p Platinum 23939 sensitive High High-Grade Serous Ovarian Cancer tissue
hsa-miR-628-3p Cisplatin 5460033 NSC119875 approved sensitive High Bladder Cancer cell line (CDDP-R-BOY, CDDP-R-T24)
hsa-miR-628-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-628-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-628-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-628-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-628-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR8)
hsa-miR-628-3p Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-628-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-628-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-628-3p Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)

Error report submission