miRTarBase - #MIRT508163


—
pre-miRNA Information
pre-miRNA hsa-mir-3622a   
Genomic Coordinates chr8: 27701677 - 27701759
Description Homo sapiens miR-3622a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3622a-3p
Sequence 50| UCACCUGACCUCCCAUGCCUGU |71
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 8 + 27701728 27229138, 28411194, 29165639 MiREDiBase
A-to-I 8 8 + 27701733 29233923 MiREDiBase
A-to-I 15 8 + 27701740 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs367834969 9 dbSNP
rs1444523018 11 dbSNP
rs551029921 14 dbSNP
rs569771074 15 dbSNP
rs13276615 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ABCC5   
Synonyms ABC33, EST277145, MOAT-C, MOATC, MRP5, SMRP, pABC11
Description ATP binding cassette subfamily C member 5
Transcript NM_005688   
Other Transcripts NM_001023587   
Expression
Putative miRNA Targets on ABCC5
3'UTR of ABCC5
(miRNA target sites are highlighted)		 
>ABCC5|NM_005688|3'UTR
   1 CTCCTCCCTGTTGACGAAGTCTCTTTTCTTTAGAGCATTGCCATTCCCTGCCTGGGGCGGGCCCCTCATCGCGTCCTCCT
  81 ACCGAAACCTTGCCTTTCTCGATTTTATCTTTCGCACAGCAGTTCCGGATTGGCTTGTGTGTTTCACTTTTAGGGAGAGT
 161 CATATTTTGATTATTGTATTTATTCCATATTCATGTAAACAAAATTTAGTTTTTGTTCTTAATTGCACTCTAAAAGGTTC
 241 AGGGAACCGTTATTATAATTGTATCAGAGGCCTATAATGAAGCTTTATACGTGTAGCTATATCTATATATAATTCTGTAC
 321 ATAGCCTATATTTACAGTGAAAATGTAAGCTGTTTATTTTATATTAAAATAAGCACTGTGCTAATAACAGTGCATATTCC
 401 TTTCTATCATTTTTGTACAGTTTGCTGTACTAGAGATCTGGTTTTGCTATTAGACTGTAGGAAGAGTAGCATTTCATTCT
 481 TCTCTAGCTGGTGGTTTCACGGTGCCAGGTTTTCTGGGTGTCCAAAGGAAGACGTGTGGCAATAGTGGGCCCTCCGACAG
 561 CCCCCTCTGCCGCCTCCCCACGGCCGCTCCAGGGGTGGCTGGAGACGGGTGGGCGGCTGGAGACCATGCAGAGCGCCGTG
 641 AGTTCTCAGGGCTCCTGCCTTCTGTCCTGGTGTCACTTACTGTTTCTGTCAGGAGAGCAGCGGGGCGAAGCCCAGGCCCC
 721 TTTTCACTCCCTCCATCAAGAATGGGGATCACAGAGACATTCCTCCGAGCCGGGGAGTTTCTTTCCTGCCTTCTTCTTTT
 801 TGCTGTTGTTTCTAAACAAGAATCAGTCTATCCACAGAGAGTCCCACTGCCTCAGGTTCCTATGGCTGGCCACTGCACAG
 881 AGCTCTCCAGCTCCAAGACCTGTTGGTTCCAAGCCCTGGAGCCAACTGCTGCTTTTTGAGGTGGCACTTTTTCATTTGCC
 961 TATTCCCACACCTCCACAGTTCAGTGGCAGGGCTCAGGATTTCGTGGGTCTGTTTTCCTTTCTCACCGCAGTCGTCGCAC
1041 AGTCTCTCTCTCTCTCTCCCCTCAAAGTCTGCAACTTTAAGCAGCTCTTGCTAATCAGTGTCTCACACTGGCGTAGAAGT
1121 TTTTGTACTGTAAAGAGACCTACCTCAGGTTGCTGGTTGCTGTGTGGTTTGGTGTGTTCCCGCAAACCCCCTTTGTGCTG
1201 TGGGGCTGGTAGCTCAGGTGGGCGTGGTCACTGCTGTCATCAATTGAATGGTCAGCGTTGCATGTCGTGACCAACTAGAC
1281 ATTCTGTCGCCTTAGCATGTTTGCTGAACACCTTGTGGAAGCAAAAATCTGAAAATGTGAATAAAATTATTTTGGATTTT
1361 GTAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugUCCGUACCCUCCAGUCCACu 5'
            :||| ||| || ||||||| 
Target 5' tgGGGC-TGGTAGCTCAGGTGg 3'
 1201 - 1221 167.00 -22.80
2 
miRNA  3' ugUCCGUACCCUCCAGUCCAcu 5'
            || | |   |  ||||||  
Target 5' agAGACCT---ACCTCAGGTtg 3'
 1134 - 1152 121.00 -6.60
3 
miRNA  3' uguccguacccuccAGUCCAcu 5'
                        ||||||  
Target 5' agagtcccactgccTCAGGTtc 3'
 838 - 859 120.00 -5.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30475637 6 COSMIC
COSN30456954 7 COSMIC
COSN7839824 8 COSMIC
COSN14050347 16 COSMIC
COSN30111504 22 COSMIC
COSN28655206 28 COSMIC
COSN30483052 54 COSMIC
COSN18728092 56 COSMIC
COSN31581471 58 COSMIC
COSN30466917 70 COSMIC
COSN14050345 71 COSMIC
COSN14050344 73 COSMIC
COSN30520809 78 COSMIC
COSN31481578 101 COSMIC
COSN31602416 113 COSMIC
COSN31589484 128 COSMIC
COSN31482782 157 COSMIC
COSN28657602 303 COSMIC
COSN31589474 466 COSMIC
COSN7628276 500 COSMIC
COSN31538685 572 COSMIC
COSN19664754 582 COSMIC
COSN30173866 620 COSMIC
COSN31482663 627 COSMIC
COSN26566658 658 COSMIC
COSN31486017 701 COSMIC
COSN31488024 707 COSMIC
COSN31962206 781 COSMIC
COSN31488693 837 COSMIC
COSN26640222 944 COSMIC
COSN31532322 998 COSMIC
COSN28657980 1017 COSMIC
COSN505844 1043 COSMIC
COSN30544928 1116 COSMIC
COSN31546592 1123 COSMIC
COSN31539279 1181 COSMIC
COSN26554487 1229 COSMIC
COSN31522123 1260 COSMIC
COSN26555599 1329 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1346777097 1 dbSNP
rs1257996873 8 dbSNP
rs960139633 12 dbSNP
rs764932902 15 dbSNP
rs529958391 16 dbSNP
rs1451085735 20 dbSNP
rs753358451 21 dbSNP
rs764559849 23 dbSNP
rs761232566 29 dbSNP
rs772210207 31 dbSNP
rs375714369 33 dbSNP
rs1315393541 38 dbSNP
rs1458503398 41 dbSNP
rs767877223 43 dbSNP
rs1303140209 49 dbSNP
rs1367005219 58 dbSNP
rs3749444 59 dbSNP
rs1420103392 61 dbSNP
rs545085611 68 dbSNP
rs921546094 70 dbSNP
rs944287777 71 dbSNP
rs1469376814 72 dbSNP
rs547860723 72 dbSNP
rs139248707 79 dbSNP
rs777587853 84 dbSNP
rs531457381 100 dbSNP
rs1268666590 101 dbSNP
rs755929232 103 dbSNP
rs556373968 113 dbSNP
rs899431132 114 dbSNP
rs1016493357 117 dbSNP
rs537638154 120 dbSNP
rs567576799 126 dbSNP
rs1409934831 127 dbSNP
rs1456760401 130 dbSNP
rs1035343466 137 dbSNP
rs889324041 142 dbSNP
rs1160613887 146 dbSNP
rs1051929132 147 dbSNP
rs1002980073 152 dbSNP
rs781528534 153 dbSNP
rs1302576446 156 dbSNP
rs1378001247 162 dbSNP
rs1396320839 174 dbSNP
rs1294734417 187 dbSNP
rs1348141648 189 dbSNP
rs933092733 193 dbSNP
rs1288946004 194 dbSNP
rs1022784402 201 dbSNP
rs892195084 211 dbSNP
rs1014611185 219 dbSNP
rs555210838 223 dbSNP
rs959981252 225 dbSNP
rs1052065558 226 dbSNP
rs536260735 228 dbSNP
rs1386339815 236 dbSNP
rs1483451109 240 dbSNP
rs1031375023 248 dbSNP
rs565694716 249 dbSNP
rs998487646 253 dbSNP
rs925210699 261 dbSNP
rs1410823907 263 dbSNP
rs1454595186 266 dbSNP
rs780984960 278 dbSNP
rs1175975236 290 dbSNP
rs144490627 291 dbSNP
rs1436948175 295 dbSNP
rs947993370 301 dbSNP
rs1042802337 304 dbSNP
rs1455968158 307 dbSNP
rs149253198 309 dbSNP
rs1197537279 315 dbSNP
rs759596756 317 dbSNP
rs562310476 335 dbSNP
rs1312606034 339 dbSNP
rs1236180408 351 dbSNP
rs1431004808 378 dbSNP
rs766234553 391 dbSNP
rs1272788094 393 dbSNP
rs1482822059 400 dbSNP
rs181237216 410 dbSNP
rs1205968268 415 dbSNP
rs900025930 417 dbSNP
rs1487540361 418 dbSNP
rs367954029 420 dbSNP
rs189588485 430 dbSNP
rs539705036 431 dbSNP
rs960419786 432 dbSNP
rs1455881014 433 dbSNP
rs1487810964 447 dbSNP
rs1283641224 461 dbSNP
rs1212855754 465 dbSNP
rs550384045 466 dbSNP
rs1047054821 469 dbSNP
rs1329114571 476 dbSNP
rs931291847 491 dbSNP
rs1433645590 495 dbSNP
rs751684760 496 dbSNP
rs1274232611 500 dbSNP
rs972070195 501 dbSNP
rs766475000 504 dbSNP
rs969482008 505 dbSNP
rs763190518 516 dbSNP
rs531791406 525 dbSNP
rs1016272195 533 dbSNP
rs773327218 534 dbSNP
rs1297930519 535 dbSNP
rs1400851546 536 dbSNP
rs184225181 543 dbSNP
rs953639936 548 dbSNP
rs1470176700 553 dbSNP
rs1030938342 555 dbSNP
rs1450461974 556 dbSNP
rs997668734 556 dbSNP
rs1031551812 560 dbSNP
rs892223647 563 dbSNP
rs193274857 564 dbSNP
rs1403124813 565 dbSNP
rs1172550894 566 dbSNP
rs1052099625 570 dbSNP
rs1476735440 571 dbSNP
rs371222947 572 dbSNP
rs560145406 579 dbSNP
rs73884807 581 dbSNP
rs3749445 582 dbSNP
rs1364258876 584 dbSNP
rs560762291 585 dbSNP
rs997022088 586 dbSNP
rs562430579 589 dbSNP
rs1272179366 595 dbSNP
rs1260676254 596 dbSNP
rs947989692 602 dbSNP
rs1189770733 604 dbSNP
rs1377191983 606 dbSNP
rs777271644 607 dbSNP
rs1290600381 610 dbSNP
rs540965702 615 dbSNP
rs745352135 616 dbSNP
rs1198683618 619 dbSNP
rs1207455217 625 dbSNP
rs187737115 634 dbSNP
rs1465661952 635 dbSNP
rs1041619675 637 dbSNP
rs919346065 638 dbSNP
rs1008357991 641 dbSNP
rs1801744 642 dbSNP
rs887380392 648 dbSNP
rs972183327 655 dbSNP
rs1418027026 656 dbSNP
rs1219396300 661 dbSNP
rs963450878 670 dbSNP
rs1156910616 682 dbSNP
rs1387767777 685 dbSNP
rs1401099288 688 dbSNP
rs909240419 693 dbSNP
rs1047276795 697 dbSNP
rs1416980602 698 dbSNP
rs986129213 702 dbSNP
rs542868769 706 dbSNP
rs533787704 719 dbSNP
rs757020241 724 dbSNP
rs1357502152 728 dbSNP
rs998100486 733 dbSNP
rs572797603 747 dbSNP
rs11552529 750 dbSNP
rs956855624 757 dbSNP
rs1170770219 762 dbSNP
rs1207271358 765 dbSNP
rs1464691678 766 dbSNP
rs1031126119 767 dbSNP
rs553788268 770 dbSNP
rs1000604468 771 dbSNP
rs538640581 772 dbSNP
rs903596291 773 dbSNP
rs1044729521 775 dbSNP
rs1411165696 779 dbSNP
rs1011886476 781 dbSNP
rs896402049 785 dbSNP
rs1278920244 790 dbSNP
rs1413675787 799 dbSNP
rs376672120 799 dbSNP
rs796498279 799 dbSNP
rs1056345995 803 dbSNP
rs1313760200 806 dbSNP
rs929882724 807 dbSNP
rs1377462032 814 dbSNP
rs1185237989 825 dbSNP
rs897025891 826 dbSNP
rs1038198776 832 dbSNP
rs1439484295 834 dbSNP
rs942115228 835 dbSNP
rs977363490 837 dbSNP
rs1344804057 841 dbSNP
rs968602053 842 dbSNP
rs1021337754 844 dbSNP
rs4148595 845 dbSNP
rs1202417156 862 dbSNP
rs964139167 863 dbSNP
rs1256355708 872 dbSNP
rs986548884 874 dbSNP
rs1183962499 890 dbSNP
rs1375828849 898 dbSNP
rs770380498 902 dbSNP
rs1477592087 919 dbSNP
rs1008826836 923 dbSNP
rs748926097 926 dbSNP
rs1427987576 931 dbSNP
rs923521236 932 dbSNP
rs1168190485 941 dbSNP
rs976399388 955 dbSNP
rs956944227 966 dbSNP
rs1031154034 969 dbSNP
rs1393185424 974 dbSNP
rs979547975 978 dbSNP
rs1025750832 989 dbSNP
rs995754963 996 dbSNP
rs1357426188 1002 dbSNP
rs1305999271 1004 dbSNP
rs967784854 1007 dbSNP
rs1340478288 1019 dbSNP
rs73044694 1022 dbSNP
rs538449659 1024 dbSNP
rs114133046 1027 dbSNP
rs1035092260 1028 dbSNP
rs549703085 1033 dbSNP
rs528040857 1034 dbSNP
rs897055146 1036 dbSNP
rs150079849 1037 dbSNP
rs1166576295 1042 dbSNP
rs752260148 1057 dbSNP
rs111657478 1059 dbSNP
rs1463614133 1059 dbSNP
rs150303978 1059 dbSNP
rs767239318 1059 dbSNP
rs776394998 1059 dbSNP
rs924460652 1059 dbSNP
rs1390651930 1061 dbSNP
rs887868094 1064 dbSNP
rs1328504157 1066 dbSNP
rs1161225466 1070 dbSNP
rs1471066252 1075 dbSNP
rs1434782110 1085 dbSNP
rs1380809840 1086 dbSNP
rs184559648 1090 dbSNP
rs1050493592 1091 dbSNP
rs369518015 1104 dbSNP
rs755741842 1112 dbSNP
rs532761265 1113 dbSNP
rs1274941625 1118 dbSNP
rs1463404343 1119 dbSNP
rs1185669809 1123 dbSNP
rs1289506708 1125 dbSNP
rs796764222 1129 dbSNP
rs1262716980 1130 dbSNP
rs1430456203 1135 dbSNP
rs1185685905 1137 dbSNP
rs976475347 1140 dbSNP
rs963719536 1171 dbSNP
rs1353324945 1181 dbSNP
rs1167784993 1182 dbSNP
rs143330011 1190 dbSNP
rs1240076014 1191 dbSNP
rs1289756775 1193 dbSNP
rs1385224335 1199 dbSNP
rs924167876 1200 dbSNP
rs191957272 1205 dbSNP
rs537922268 1208 dbSNP
rs1354322867 1214 dbSNP
rs1233325040 1215 dbSNP
rs35543804 1217 dbSNP
rs1025803127 1224 dbSNP
rs995598478 1234 dbSNP
rs781082097 1241 dbSNP
rs562 1243 dbSNP
rs561594029 1245 dbSNP
rs1486717597 1257 dbSNP
rs1198999343 1262 dbSNP
rs540027454 1277 dbSNP
rs990621076 1288 dbSNP
rs1190095822 1289 dbSNP
rs1410418886 1294 dbSNP
rs1418933727 1299 dbSNP
rs960725492 1311 dbSNP
rs1464837025 1313 dbSNP
rs546356591 1315 dbSNP
rs1300752662 1326 dbSNP
rs1157919751 1327 dbSNP
rs1437754690 1328 dbSNP
rs896513145 1329 dbSNP
rs572834774 1336 dbSNP
rs1396885520 1355 dbSNP
rs556712854 1357 dbSNP
rs3805114 1366 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugUCCGUACCCUCCAGUCCACu 5'
            :||| ||| || ||||||| 
Target 5' --GGGC-UGGUAGCUCAGGUGg 3'
 		1 - 19
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10057.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugUCCGUACCCUCCAGUCCACu 5'
            :||| ||| || ||||||| 
Target 5' --GGGC-UGGUAGCUCAGGUGg 3'
 		1 - 19
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 10057.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10057.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM4903825
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_NS
Location of target site NM_005688 | 3UTR | AAACCCCCUUUGUGCUGUGGGGCUGGUAGCUCAGGUGGGCGUGGUCACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_005688 | 3UTR | GCUGUGGGGCUGGUAGCUCAGGUGGGCGUGGUCACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000334444.6 | 3UTR | GGGCUGGUAGCUCAGGUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000334444.6 | 3UTR | GGGCUGGUAGCUCAGGUGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000334444.6 | 3UTR | GGGCUGGUAGCUCAGGUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000334444.6 | 3UTR | GGGCUGGUAGCUCAGGUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000334444.6 | 3UTR | GGGCUGGUAGCUCAGGUGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000334444.6 | 3UTR | GGGCUGGUAGCUCAGGUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA -0.777 0.02 -0.679 0.05 7 Click to see details
BRCA -0.448 0.05 -0.222 0.22 14 Click to see details
KIRC -0.763 0.07 -0.800 0.05 5 Click to see details
HNSC 0.441 0.16 0.429 0.17 7 Click to see details
THCA 0.134 0.18 0.113 0.22 48 Click to see details
PRAD -0.126 0.26 -0.169 0.19 28 Click to see details
STAD -0.301 0.28 -0.429 0.2 6 Click to see details
KICH -0.535 0.32 -0.500 0.33 3 Click to see details
KIRP 0.125 0.35 0.098 0.38 12 Click to see details
LUSC 0.067 0.4 0.209 0.2 18 Click to see details
UCEC -0.068 0.42 -0.014 0.48 12 Click to see details
UCEC -0.068 0.42 -0.014 0.48 12 Click to see details
UCEC -0.068 0.42 -0.014 0.48 12 Click to see details
UCEC -0.068 0.42 -0.014 0.48 12 Click to see details
UCEC -0.068 0.42 -0.014 0.48 12 Click to see details
UCEC -0.068 0.42 -0.014 0.48 12 Click to see details
UCEC -0.068 0.42 -0.014 0.48 12 Click to see details
104 hsa-miR-3622a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT052866 MRPL16 mitochondrial ribosomal protein L16 1 1
MIRT076712 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT080211 PRKACB protein kinase cAMP-activated catalytic subunit beta 2 2
MIRT081397 GTPBP3 GTP binding protein 3, mitochondrial 2 2
MIRT107157 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT254070 BACH1 BTB domain and CNC homolog 1 2 2
MIRT409789 FOXO3 forkhead box O3 2 2
MIRT448680 MAPK9 mitogen-activated protein kinase 9 2 2
MIRT450207 ABHD15 abhydrolase domain containing 15 2 2
MIRT486622 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT489268 TTLL1 tubulin tyrosine ligase like 1 2 2
MIRT493118 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 4
MIRT494571 BAK1 BCL2 antagonist/killer 1 2 2
MIRT497396 RALY RALY heterogeneous nuclear ribonucleoprotein 2 2
MIRT504901 CCDC86 coiled-coil domain containing 86 2 2
MIRT505193 USP46 ubiquitin specific peptidase 46 2 4
MIRT506524 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 6
MIRT508163 ABCC5 ATP binding cassette subfamily C member 5 2 8
MIRT508546 PARVG parvin gamma 2 4
MIRT509851 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT510089 PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 2 8
MIRT512095 CRK CRK proto-oncogene, adaptor protein 2 4
MIRT515382 RPL7 ribosomal protein L7 2 2
MIRT519177 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT519965 ZCCHC8 zinc finger CCHC-type containing 8 2 2
MIRT522293 NKAP NFKB activating protein 2 2
MIRT523161 HMGB2 high mobility group box 2 2 4
MIRT525315 FANCA Fanconi anemia complementation group A 2 2
MIRT528195 PLEKHM2 pleckstrin homology and RUN domain containing M2 2 2
MIRT532886 ZNF451 zinc finger protein 451 2 2
MIRT538210 CYR61 cysteine rich angiogenic inducer 61 2 2
MIRT539498 ACTN4 actinin alpha 4 2 2
MIRT554602 RRAGC Ras related GTP binding C 2 2
MIRT562446 DCTN6 dynactin subunit 6 2 2
MIRT562749 AOC3 amine oxidase, copper containing 3 2 2
MIRT565800 SEC14L5 SEC14 like lipid binding 5 2 2
MIRT565839 SCML2 Scm polycomb group protein like 2 2 2
MIRT566073 RCC2 regulator of chromosome condensation 2 2 2
MIRT566105 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 2
MIRT572408 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT576199 Vsig2 V-set and immunoglobulin domain containing 2 2 2
MIRT576314 Acbd7 acyl-Coenzyme A binding domain containing 7 2 2
MIRT576652 Mill2 MHC I like leukocyte 2 1 1
MIRT576860 Socs6 suppressor of cytokine signaling 6 2 2
MIRT606820 BICD2 BICD cargo adaptor 2 2 2
MIRT610739 NUDT16 nudix hydrolase 16 2 4
MIRT614799 RORA RAR related orphan receptor A 2 2
MIRT619007 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 2 2
MIRT619421 NOS1AP nitric oxide synthase 1 adaptor protein 2 2
MIRT620406 MYO1H myosin IH 2 2
MIRT624870 ABHD13 abhydrolase domain containing 13 2 2
MIRT633528 ZFP30 ZFP30 zinc finger protein 2 2
MIRT633928 DNAH9 dynein axonemal heavy chain 9 2 2
MIRT636612 CLIC5 chloride intracellular channel 5 2 2
MIRT640617 MIOX myo-inositol oxygenase 2 2
MIRT642606 C14orf180 chromosome 14 open reading frame 180 2 2
MIRT644625 SRSF2 serine and arginine rich splicing factor 2 2 2
MIRT655114 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT658977 DNAJB5 DnaJ heat shock protein family (Hsp40) member B5 2 4
MIRT661496 CHMP1B charged multivesicular body protein 1B 2 2
MIRT662997 TMEM59 transmembrane protein 59 2 2
MIRT663076 SFR1 SWI5 dependent homologous recombination repair protein 1 2 2
MIRT665406 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT666107 SSR1 signal sequence receptor subunit 1 2 2
MIRT669563 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT670071 ZNF783 zinc finger family member 783 2 2
MIRT671193 ZNF891 zinc finger protein 891 2 2
MIRT675362 KLHL26 kelch like family member 26 2 2
MIRT678858 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT679444 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT684164 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT684544 ZNF460 zinc finger protein 460 2 2
MIRT684675 SLC2A11 solute carrier family 2 member 11 2 2
MIRT684972 MINOS1 mitochondrial inner membrane organizing system 1 2 2
MIRT686007 NEK4 NIMA related kinase 4 2 2
MIRT687759 KIAA1328 KIAA1328 2 2
MIRT688962 ATXN3 ataxin 3 2 2
MIRT689410 UQCR11 ubiquinol-cytochrome c reductase, complex III subunit XI 2 2
MIRT690002 MMP17 matrix metallopeptidase 17 2 2
MIRT690166 ELP3 elongator acetyltransferase complex subunit 3 2 2
MIRT690203 C5orf45 MRN complex interacting protein 2 2
MIRT690478 ZNF33A zinc finger protein 33A 2 2
MIRT690567 MICA MHC class I polypeptide-related sequence A 2 2
MIRT692161 C10orf111 chromosome 10 open reading frame 111 2 2
MIRT693431 PLGLB2 plasminogen-like B2 2 2
MIRT693548 ZNF708 zinc finger protein 708 2 2
MIRT693698 PLGLB1 plasminogen-like B1 2 2
MIRT695007 HSPA6 heat shock protein family A (Hsp70) member 6 2 2
MIRT698526 TFRC transferrin receptor 2 2
MIRT699575 SIKE1 suppressor of IKBKE 1 2 2
MIRT703447 FYTTD1 forty-two-three domain containing 1 2 2
MIRT704398 CTSS cathepsin S 2 2
MIRT704486 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT709511 IGF2 insulin like growth factor 2 2 2
MIRT709823 STPG1 sperm tail PG-rich repeat containing 1 2 2
MIRT710860 COQ7 coenzyme Q7, hydroxylase 2 2
MIRT711894 INSIG2 insulin induced gene 2 2 2
MIRT713797 CPLX2 complexin 2 2 2
MIRT718801 C1GALT1C1 C1GALT1 specific chaperone 1 2 2
MIRT719502 SEC24B SEC24 homolog B, COPII coat complex component 2 2
MIRT719723 PDE6B phosphodiesterase 6B 2 2
MIRT722205 URM1 ubiquitin related modifier 1 2 2
MIRT723524 CLPTM1L CLPTM1 like 2 2
MIRT725473 GRAP2 GRB2-related adaptor protein 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-3622a Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-mir-3622a Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-miR-3622a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3622a-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-3622a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3622a-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-3622a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission