>MTRNR2L6|NM_001190487|3'UTR
   1 ATAAATAAGATGAGAAGATCCTATGGAGCTTTAATTTATTAATGCAAACAAAGCTCAGATAAGCCCACAGGCCTTAAACT
  81 ACTGTCCCTGCATTAAATATTTTGGTTGGGGTGACCTCGGAGCATAATTTAACCTCCGAGCAACCTATGCTAAGACTAAA
 161 CAAGTTTAAGCGAATTACTATACATATATTGACCCAATAATTTGATCAACGGAACAAGTTACCCTAGGGATAACAGCGCA
 241 ATCCTATTCTAGAGTCCATATTGACAATAGGGTTTACGACCTCGATGTTGGATCAGGACATCCTAATGGTGTAGCTGCTA
 321 TCAAGGGTTCATTTGTTCAATGATTAAAGTCCTACGTGGTCTGAGTTCAGACCGGAGCAAGCCAGGTC

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' auUUCGUCGUGU--CAUUAUAACc 5' :| ||| ||| ||||: || Target 5' tgGATCAGGACATCCTAATGGTGt 3'	289 - 312	114.00	-6.90
2	miRNA 3' auUUCGUCGUGUC----AUUauaacc 5' |||| ||||| ||| Target 5' atAAGC-CCACAGGCCTTAAactact 3'	59 - 83	65.00	-6.75
3	miRNA 3' auUUC--GUC--GUGUCAUUauaacc 5' :|| ||| |: || || Target 5' ctGAGTTCAGACCGGAGCAAgccagg 3'	361 - 386	56.00	-8.73

Mutant ID	Mutant Position	Mutant Source
COSN17182997	211	COSMIC
COSN17217902	339	COSMIC
COSN9934952	343	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1279496075	2	dbSNP
rs1239588542	3	dbSNP
rs1315537981	5	dbSNP
rs1217879952	6	dbSNP
rs546542453	8	dbSNP
rs192769711	12	dbSNP
rs1362996177	19	dbSNP
rs1385546979	21	dbSNP
rs1481000332	24	dbSNP
rs1207807656	27	dbSNP
rs539399664	29	dbSNP
rs1294526958	33	dbSNP
rs1175888760	36	dbSNP
rs1488714646	41	dbSNP
rs1196117279	46	dbSNP
rs1156449628	49	dbSNP
rs1261048941	51	dbSNP
rs557724699	54	dbSNP
rs1363817253	59	dbSNP
rs527470706	63	dbSNP
rs1197878716	64	dbSNP
rs1431333088	68	dbSNP
rs1432101744	69	dbSNP
rs748042177	76	dbSNP
rs548939142	85	dbSNP
rs1480932373	87	dbSNP
rs1490775731	91	dbSNP
rs1261386549	92	dbSNP
rs972364861	93	dbSNP
rs918253355	115	dbSNP
rs182484334	116	dbSNP
rs1231118978	119	dbSNP
rs139163997	120	dbSNP
rs1284465679	136	dbSNP
rs1318635906	138	dbSNP
rs1348777069	139	dbSNP
rs149513814	142	dbSNP
rs1398958651	151	dbSNP
rs574122366	154	dbSNP
rs773121059	156	dbSNP
rs1285036752	158	dbSNP
rs541623807	172	dbSNP
rs1227501727	173	dbSNP
rs143991237	181	dbSNP
rs1352620705	184	dbSNP
rs1039200273	185	dbSNP
rs1285291278	188	dbSNP
rs767846530	189	dbSNP
rs1220357936	194	dbSNP
rs946979304	199	dbSNP
rs376686329	202	dbSNP
rs370979486	207	dbSNP
rs578249475	211	dbSNP
rs1181783736	212	dbSNP
rs1198856273	218	dbSNP
rs1482962343	224	dbSNP
rs1264305167	228	dbSNP
rs545756675	238	dbSNP
rs1316474697	239	dbSNP
rs1277921684	244	dbSNP
rs1228578283	252	dbSNP
rs772113179	254	dbSNP
rs1326709132	257	dbSNP
rs77726778	263	dbSNP
rs373514721	264	dbSNP
rs1393857958	270	dbSNP
rs1471393038	273	dbSNP
rs563260976	278	dbSNP
rs750831237	279	dbSNP
rs1384222840	281	dbSNP
rs530558768	284	dbSNP
rs939402922	285	dbSNP
rs1422167774	291	dbSNP
rs75894321	305	dbSNP
rs1475609566	308	dbSNP
rs1375063778	314	dbSNP
rs1056941342	321	dbSNP
rs1423328991	329	dbSNP
rs56784185	332	dbSNP
rs1186003906	334	dbSNP
rs561055993	347	dbSNP
rs1257958530	355	dbSNP
rs148693693	356	dbSNP
rs1390716999	357	dbSNP
rs79106536	360	dbSNP
rs1381443951	361	dbSNP
rs1315188231	371	dbSNP
rs546390336	372	dbSNP
rs572156495	374	dbSNP
rs1016792186	375	dbSNP
rs1410326583	378	dbSNP
rs1337298549	382	dbSNP

- Cell, 2013

The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.