>RPL18|NM_000979|3'UTR
   1 CCCTGGATCCTACTCTCTTATTAAAAAGATTTTTGCTGACAGTGCAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gaccccACCCCUGUCUCcgaa 5' || ||||| | Target 5' gattttTGCTGACAGTGcaaa 3'	28 - 48	67.00	-5.70

Mutant ID	Mutant Position	Mutant Source
COSN31546521	15	COSMIC
COSN31967557	15	COSMIC
COSN31564587	19	COSMIC
COSN26993174	21	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1442545398	1	dbSNP
rs763011562	2	dbSNP
rs773088745	5	dbSNP
rs769684666	6	dbSNP
rs748026369	9	dbSNP
rs780887216	13	dbSNP
rs768209815	14	dbSNP
rs1276342067	15	dbSNP
rs1441205453	16	dbSNP
rs746463110	17	dbSNP
rs1003223107	19	dbSNP
rs776416401	19	dbSNP
rs189293719	21	dbSNP
rs1246125956	28	dbSNP
rs1167315467	30	dbSNP
rs770949433	35	dbSNP
rs750447885	36	dbSNP
rs3180952	40	dbSNP
rs3177985	42	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.