pre-miRNA Information
pre-miRNA hsa-mir-7107   
Genomic Coordinates chr12: 121444273 - 121444352
Description Homo sapiens miR-7107 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7107-5p
Sequence 6| UCGGCCUGGGGAGGAGGAAGGG |27
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs782634189 2 dbSNP
rs782536354 3 dbSNP
rs1230027540 4 dbSNP
rs539127530 5 dbSNP
rs782765349 9 dbSNP
rs55671311 10 dbSNP
rs183760300 11 dbSNP
rs782805318 12 dbSNP
rs782108772 19 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FBXO6   
Synonyms FBG2, FBS2, FBX6, Fbx6b
Description F-box protein 6
Transcript NM_018438   
Expression
Putative miRNA Targets on FBXO6
3'UTR of FBXO6
(miRNA target sites are highlighted)
>FBXO6|NM_018438|3'UTR
   1 CAGCTGTCCATCCTGTGTCTGGGTCAGCCAGAGGTTCCTCCAGGCAGGAGCTGAGCATGGGGTGGGCAGTGAGGTCCCTG
  81 TACCAGCGACTCCTGCCCCGGTTCAACCCTACCAGCTTGTGGTAACTTACTGTCACATAGCTCTGACGTTTTGTTGTAAT
 161 AAATGTTTTCAGGCCGGGCACTGTGGCTCACGCCTGTAATCCCAGCACTTTGGGAGACCGAGGCAGGTGGATCACGAGGT
 241 CAGGAGATAGAGACCATCCTGGCCAACACGGTGAAACCCTGTCTCTACTAAAAATACAAAAAATTAGCCGGGCGTGGTGG
 321 CGGGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGATGCAGAAGAATGGCGTGAACCCGGAAGGCAGAGCTTGCAGTGAGC
 401 CGAGATCACGCCACTGCACTCCAGCCTGGGTGACAGAGCGAGACTCTGGCTCATAAAATAATAATAATAATAAATAAATA
 481 AAAAATAAATGTTTTCAGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gggaaggaggAGGGGUCCGGCu 5'
                    |:::||||||| 
Target 5' gtaataaatgTTTTCAGGCCGg 3'
156 - 177 148.00 -18.10
2
miRNA  3' gggaagGAGGAGGGGUCCGGCu 5'
                :||||  |||||| | 
Target 5' cagaggTTCCT--CCAGGCAGg 3'
29 - 48 124.00 -16.50
3
miRNA  3' gggaagGAGGAGGGGUCCGGCu 5'
                || | |:|||| |:| 
Target 5' acgccaCTGCACTCCAGCCTGg 3'
408 - 429 112.00 -18.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30459943 20 COSMIC
COSN30109375 38 COSMIC
COSN31588330 101 COSMIC
COSN26885962 175 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs143630867 2 dbSNP
rs1430391587 8 dbSNP
rs1169724549 10 dbSNP
rs1435969330 12 dbSNP
rs1183751799 13 dbSNP
rs189443534 18 dbSNP
rs1315236764 19 dbSNP
rs752729384 19 dbSNP
rs1164567434 22 dbSNP
rs758508571 23 dbSNP
rs545081183 24 dbSNP
rs895915626 26 dbSNP
rs1015745669 27 dbSNP
rs1448240901 30 dbSNP
rs747248238 35 dbSNP
rs148091905 39 dbSNP
rs780913337 40 dbSNP
rs1331307056 42 dbSNP
rs1336655998 43 dbSNP
rs1014730742 46 dbSNP
rs1414545445 51 dbSNP
rs745782671 52 dbSNP
rs1359169313 55 dbSNP
rs1229991539 62 dbSNP
rs1298224656 64 dbSNP
rs762427268 66 dbSNP
rs1231761046 75 dbSNP
rs1027129825 78 dbSNP
rs28924119 88 dbSNP
rs990414701 89 dbSNP
rs1240597055 98 dbSNP
rs548891111 99 dbSNP
rs1466300437 100 dbSNP
rs750907289 101 dbSNP
rs1000360701 102 dbSNP
rs560831126 110 dbSNP
rs949300072 122 dbSNP
rs180671706 128 dbSNP
rs964272176 138 dbSNP
rs1166046950 139 dbSNP
rs1063301 142 dbSNP
rs936470578 148 dbSNP
rs571259638 149 dbSNP
rs28924118 157 dbSNP
rs1370125375 170 dbSNP
rs987588651 176 dbSNP
rs28924117 177 dbSNP
rs1348499089 179 dbSNP
rs1235035540 183 dbSNP
rs565719714 192 dbSNP
rs535852521 193 dbSNP
rs28924116 196 dbSNP
rs973240654 199 dbSNP
rs1252402575 201 dbSNP
rs1467221788 202 dbSNP
rs891157008 205 dbSNP
rs1201560217 211 dbSNP
rs1320883822 220 dbSNP
rs761044183 221 dbSNP
rs1157259943 229 dbSNP
rs1253233161 230 dbSNP
rs1008472187 234 dbSNP
rs1409269182 236 dbSNP
rs574356157 237 dbSNP
rs1204476205 238 dbSNP
rs187419277 239 dbSNP
rs897424483 240 dbSNP
rs1189234467 241 dbSNP
rs1384569018 248 dbSNP
rs1325436494 251 dbSNP
rs1055740796 255 dbSNP
rs879585824 270 dbSNP
rs1422424979 271 dbSNP
rs1229203862 272 dbSNP
rs372961686 281 dbSNP
rs1332694783 296 dbSNP
rs111774484 311 dbSNP
rs1374391772 313 dbSNP
rs1437799557 314 dbSNP
rs558082678 315 dbSNP
rs1254355328 322 dbSNP
rs541273807 323 dbSNP
rs990568020 324 dbSNP
rs1024576916 325 dbSNP
rs970393538 326 dbSNP
rs977795704 327 dbSNP
rs923830466 328 dbSNP
rs556752812 331 dbSNP
rs578102045 334 dbSNP
rs1409252915 345 dbSNP
rs1306142140 346 dbSNP
rs1416612738 347 dbSNP
rs1410223662 357 dbSNP
rs1292891414 362 dbSNP
rs1353872732 364 dbSNP
rs1247042719 371 dbSNP
rs1284903276 375 dbSNP
rs989683885 378 dbSNP
rs545528275 379 dbSNP
rs932705730 381 dbSNP
rs1277398218 385 dbSNP
rs1140272 386 dbSNP
rs1394002124 402 dbSNP
rs891230125 403 dbSNP
rs943996874 405 dbSNP
rs1037040003 407 dbSNP
rs532871466 409 dbSNP
rs572437507 410 dbSNP
rs1166578593 411 dbSNP
rs1049037786 420 dbSNP
rs895340703 430 dbSNP
rs954494281 431 dbSNP
rs1011936619 432 dbSNP
rs550926859 437 dbSNP
rs987148842 439 dbSNP
rs1015109775 440 dbSNP
rs970467151 441 dbSNP
rs1325857906 443 dbSNP
rs999558028 451 dbSNP
rs961806099 457 dbSNP
rs1030673884 470 dbSNP
rs1482497295 472 dbSNP
rs1278575364 480 dbSNP
rs1484462159 480 dbSNP
rs1201753715 483 dbSNP
rs958186852 484 dbSNP
rs1188601051 486 dbSNP
rs1445906028 488 dbSNP
rs1262837647 491 dbSNP
rs1391915153 498 dbSNP
rs1450059573 500 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 26270.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gggaaggaggaggGGUCCGgcu 5'
                       ||:|||   
Target 5' ------------gCCGGGCacu 3'
1 - 10
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000376753.4 | 3UTR | GCCGGGCACUGUGGCUCACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
144 hsa-miR-7107-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT060580 CCND1 cyclin D1 2 4
MIRT451035 ZNF610 zinc finger protein 610 2 2
MIRT485711 CASP16 caspase 16, pseudogene 2 8
MIRT488402 TDRKH tudor and KH domain containing 2 2
MIRT492084 TCF21 transcription factor 21 2 2
MIRT504213 VAV3 vav guanine nucleotide exchange factor 3 2 13
MIRT505723 SERTAD3 SERTA domain containing 3 2 4
MIRT509007 FBXO6 F-box protein 6 2 2
MIRT509843 FOS Fos proto-oncogene, AP-1 transcription factor subunit 2 2
MIRT514761 RBM4B RNA binding motif protein 4B 2 2
MIRT515664 LRRC27 leucine rich repeat containing 27 2 2
MIRT516316 F8A2 coagulation factor VIII associated 2 2 2
MIRT516342 F8A3 coagulation factor VIII associated 3 2 2
MIRT517139 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT518746 C1orf35 chromosome 1 open reading frame 35 2 2
MIRT519299 MLH1 mutL homolog 1 2 2
MIRT521527 QSOX1 quiescin sulfhydryl oxidase 1 2 4
MIRT531756 TXK TXK tyrosine kinase 2 2
MIRT542208 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT542235 FUT9 fucosyltransferase 9 2 2
MIRT542791 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT554378 SETD5 SET domain containing 5 2 2
MIRT569908 PCSK9 proprotein convertase subtilisin/kexin type 9 2 2
MIRT570222 SLC27A1 solute carrier family 27 member 1 2 2
MIRT570976 RGS19 regulator of G protein signaling 19 2 2
MIRT573046 SHMT1 serine hydroxymethyltransferase 1 2 2
MIRT574954 Vav3 vav 3 oncogene 2 8
MIRT609297 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT612990 GBX2 gastrulation brain homeobox 2 2 2
MIRT613851 SHB SH2 domain containing adaptor protein B 2 2
MIRT613935 POLR3A RNA polymerase III subunit A 2 2
MIRT614243 WDR53 WD repeat domain 53 2 4
MIRT615158 SPIB Spi-B transcription factor 2 2
MIRT616145 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT616389 C1orf87 chromosome 1 open reading frame 87 2 2
MIRT617737 ATCAY ATCAY, caytaxin 2 4
MIRT621449 TCN2 transcobalamin 2 2 2
MIRT625784 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 2 2
MIRT628556 MELK maternal embryonic leucine zipper kinase 2 2
MIRT632041 ZNF430 zinc finger protein 430 2 2
MIRT634937 GTF2H2C GTF2H2 family member C 2 4
MIRT637208 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT637610 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT637832 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT638107 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT638387 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT641689 SPCS1 signal peptidase complex subunit 1 2 2
MIRT642611 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT643850 LACTB lactamase beta 2 4
MIRT649575 PALD1 phosphatase domain containing, paladin 1 2 2
MIRT649860 WDR12 WD repeat domain 12 2 2
MIRT651026 ZNF699 zinc finger protein 699 2 2
MIRT652336 TMOD3 tropomodulin 3 2 4
MIRT653286 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 2 2
MIRT656292 METTL14 methyltransferase like 14 2 2
MIRT656458 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT659539 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 2 2
MIRT661537 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT668042 GTPBP10 GTP binding protein 10 2 2
MIRT668147 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT668800 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT669818 STOML1 stomatin like 1 2 2
MIRT670490 DCUN1D2 defective in cullin neddylation 1 domain containing 2 2 2
MIRT670615 NPHP1 nephrocystin 1 2 2
MIRT670892 CYTIP cytohesin 1 interacting protein 2 2
MIRT670943 LIPG lipase G, endothelial type 2 2
MIRT671268 MTRNR2L5 MT-RNR2-like 5 2 2
MIRT671903 GBP4 guanylate binding protein 4 2 2
MIRT672239 ABHD15 abhydrolase domain containing 15 2 2
MIRT672326 C9orf3 chromosome 9 open reading frame 3 2 2
MIRT673113 MFSD2A major facilitator superfamily domain containing 2A 2 2
MIRT674412 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 2 2
MIRT677718 IRF1 interferon regulatory factor 1 2 2
MIRT678585 PPP1R3B protein phosphatase 1 regulatory subunit 3B 2 2
MIRT678726 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT679338 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT679614 RRP36 ribosomal RNA processing 36 2 2
MIRT679695 SLC1A5 solute carrier family 1 member 5 2 4
MIRT679715 RPL24 ribosomal protein L24 2 2
MIRT680065 CD96 CD96 molecule 2 2
MIRT683379 ESR2 estrogen receptor 2 2 2
MIRT683683 MICA MHC class I polypeptide-related sequence A 2 2
MIRT683865 OCIAD1 OCIA domain containing 1 2 2
MIRT684073 TLR7 toll like receptor 7 2 2
MIRT684126 CEP104 centrosomal protein 104 2 2
MIRT684485 GPR137B G protein-coupled receptor 137B 2 2
MIRT684736 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT684778 MYO1F myosin IF 2 2
MIRT685028 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT685189 DCTN5 dynactin subunit 5 2 2
MIRT685307 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT685514 MSH3 mutS homolog 3 2 2
MIRT685702 BHMT2 betaine--homocysteine S-methyltransferase 2 2 2
MIRT685944 PTGIS prostaglandin I2 synthase 2 2
MIRT686311 VPS53 VPS53, GARP complex subunit 2 2
MIRT686686 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT687641 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT687923 HOOK3 hook microtubule tethering protein 3 2 2
MIRT688117 GEMIN8 gem nuclear organelle associated protein 8 2 2
MIRT688460 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 2 2
MIRT688629 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT688823 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT689117 ZBTB25 zinc finger and BTB domain containing 25 2 2
MIRT689166 ZNF665 zinc finger protein 665 2 2
MIRT690070 MBD1 methyl-CpG binding domain protein 1 2 2
MIRT690733 IRAK4 interleukin 1 receptor associated kinase 4 2 2
MIRT691324 KIAA1841 KIAA1841 2 2
MIRT691517 ZNF682 zinc finger protein 682 2 2
MIRT691607 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT692314 RFK riboflavin kinase 2 2
MIRT692376 LY6G5B lymphocyte antigen 6 family member G5B 2 2
MIRT692436 METTL8 methyltransferase like 8 2 2
MIRT692782 SYNPO2L synaptopodin 2 like 2 2
MIRT693136 THEM4 thioesterase superfamily member 4 2 2
MIRT693422 TECPR2 tectonin beta-propeller repeat containing 2 2 2
MIRT693871 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT694049 PRIM1 DNA primase subunit 1 2 2
MIRT694092 KIAA0930 KIAA0930 2 2
MIRT694190 ZNF347 zinc finger protein 347 2 2
MIRT695177 SLC25A33 solute carrier family 25 member 33 2 2
MIRT696180 GNB5 G protein subunit beta 5 2 2
MIRT697387 ZMAT3 zinc finger matrin-type 3 2 2
MIRT698924 SPEM1 spermatid maturation 1 2 2
MIRT699314 SLC35F5 solute carrier family 35 member F5 2 4
MIRT701106 PAPD5 poly(A) RNA polymerase D5, non-canonical 2 2
MIRT701575 MYPN myopalladin 2 2
MIRT701825 MRPL37 mitochondrial ribosomal protein L37 2 2
MIRT702047 METTL21A methyltransferase like 21A 2 2
MIRT703034 HAS2 hyaluronan synthase 2 2 4
MIRT704143 DNAL1 dynein axonemal light chain 1 2 2
MIRT704759 CDKN2AIPNL CDKN2A interacting protein N-terminal like 2 2
MIRT705079 C4orf29 abhydrolase domain containing 18 2 2
MIRT705346 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT706104 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT709070 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT709534 ZBED1 zinc finger BED-type containing 1 2 2
MIRT712356 NAT14 N-acetyltransferase 14 (putative) 2 2
MIRT713713 PAOX polyamine oxidase 2 2
MIRT714304 ZNF454 zinc finger protein 454 2 2
MIRT714919 PPP1R12C protein phosphatase 1 regulatory subunit 12C 2 2
MIRT715792 TBL3 transducin beta like 3 2 2
MIRT717376 RBM41 RNA binding motif protein 41 2 2
MIRT719069 ACOX1 acyl-CoA oxidase 1 2 2
MIRT724548 HAUS2 HAUS augmin like complex subunit 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-7107-5p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-7107-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-7107-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-7107-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-7107-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-7107-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission