pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4419b |
Genomic Coordinates | chr12: 128244506 - 128244573 |
Description | Homo sapiens miR-4419b stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | hsa-miR-4419b |
Sequence | 42| GAGGCUGAAGGAAGAUGG |59 |
Evidence | Experimental |
Experiments | Illumina |
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | ZNF587 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | ZF6 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | zinc finger protein 587 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_032828 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on ZNF587 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of ZNF587 (miRNA target sites are highlighted) |
>ZNF587|NM_032828|3'UTR 1 GTGCAGTGAATATGGGAAATCGTTTGCTGAAGCATCCCGTCTCGTTAAACACAGGAGAGTTCATACTGGAGAAAGGCCTT 81 ATGAGTGCTGTCAATGTGGAAAACATCAGAATGTCTGCTGTCCTCGGTCTTAAGCGACTTCGTGTTGAGATGGAGTCTTG 161 TTCTGTCACCCAGGCTGGAGTGCAGTGGTGCAGTCTTGGCTCGCTGCAACTTGGGCCTCCTGGGTTCATGCAATCCTCCT 241 ACCTCAGCCTCCTGAGTAGCTGGGATTATGAGTACACACCACCACGCCCAGCTAATTTTTGTGTTTTTAGTGGAGATGGG 321 GTTTTACCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAAGTGATCCACCCACCTTGACTCCCAAAGTGCTGAAAT 401 TACAGGCATGAGCCTCTGCACCTGGCCTTCATTCTTTTCGTATTGCTTAGAATATGACATGCTGAACCAGGCATGGTGGC 481 TCATGCTTGTAAACCTGATGCTTTGGGAGGACAAGGTGGTTCATTGGAGGCCAGGAGTTAGAGATCAGCCTGGGCAACAT 561 AGCCAGACCTCCTCTCTACAAAAAGAAAAAAGAATGACATGCTTCTTGTTTTTGTCTGTTATAAATGAAACTGCTATATT 641 TGAATGCAGTTGTTCATGTAGGTATGTTTCACTATGGTAATATGGTGGTGTGCAGTGCCTGAGTCACGTGATAGATTAAA 721 GTACAACTCTTTTTTGAGACAGAGTCTCACTCTGTCACCCAGGCGGGAGTTAGGTGGCATGATTTCGGCTCACTGCAACC 801 TCTGCCTCCCAAGTTCAACTGATTCTTCTGCCTCAGCCTCCCGAGTAGCAGGGATTACCGGTGTGCACCACCATGCCTGG 881 ATAACTTTTTTTTTTATTTCTATTAGCAATGGGGTTTCACCATGCTGGCCAGGCTTGTTATGAACTGACCTCAAGTGATC 961 TGCCTGCCTCAGCTTCTCAGGTGTGACCTACTGTGCTTGGCCTAATGTACAACTTTTTAAGCAATGCCAAACTATGACTT 1041 AAGAATGAAATTATTGCTCATTTGTATATCTATCTACCATCAGTGTCCAAGAATTTCTGTTCTATCTTACCAAGAGGGAG 1121 TATGGTTAGTATTTGAAATTGTTTATTATTTTAATAAGTGGTTATAACTTTTGAGTCAGTGGTTTATGTTTTGCATTTTT 1201 TTTGTTTTGAGACAAAGTCTCGCTCTGTCTCCCAGGCTAGAGTACCGTGGCACAATCTCAGCTCATTGCAACCTCTGCTT 1281 CCTGGGCTCAAGCACTCTGCCCACCTCAGCCTCCAGAGTAGCTGGAAATACAGGTATGCACCACCACAACTGGATAACTT 1361 TTGTATTTTCTGTAGAGAGGGTTTTACCTTTTTGCCCAGTCTGATCGCGAACTCCTGGGCTCAGGCGATCCACTTGCCTA 1441 GGCTCCAAAAGTGCTTGGTCTACAGGGGTGAGGCACCCTGCCTGGCCTCACCTGTAGGCTTGTTTTTTAAAATGAATTTT 1521 ATCTATTTCCCATTTCATTAATATATTTAAAAATAATGAAATAACAAAGACGTATGTTGGACTTCATTCATTCTTCAGTG 1601 ATGTCACTTTGCTGCAAGGAATATTTGGTTTTCTTTTTTTTTTTTTTTTCCAGATGGAGTCTAGCTCTGTCTCCTAAGCT 1681 ACAGTGAAGTGGCATGATCTCGGCCCACTGCAACCTCCACCTCCTGTGTTCAAGCGATTCTGCCTCAGCCTCCTGAGTAG 1761 CTGGGACTACAGGCATGTGCCATTATACCTGGCTAATTTTATTTATTTATTTTAGTAGAGATGGGGTTTCACCATGTTAC 1841 CCAGGCTGCTCTCTACCTTCTGAGCTCAAGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAGGTGTCAGCC 1921 ACTGTACCTGGCTGAATACTTGGTTTTCAGTACCACAAGAACTATGAGCTGGTTATCCACTTCATGTGGAATCATAAGCG 2001 TCCCAAAGTGACAATACATATAGATTGCCAGGCAGTGAAACAGTTAAGATGCCACCATAGCTTTCTTTTCAACATCTTTC 2081 TAAGATTACCTTACTATTTCTTTTGTTCCAAGTTTGTACTTCCTCACAGTTCTCACATATGGAAAGGATACACACTTTGT 2161 AGAAACAAGAACTTTATGTTATCCAAGTTCTAGGATAGCCATGAGCTCCAATTATCTCAGAGCTCTGAGTCCTCTACTCA 2241 ATACCCATTGAGATTTATGTGTTCTGAGGCTTTTGTCTTCTAGCTACTTACTTCATTCTCCATGGGTAACGTCATTCATC 2321 CACATTAACTAATTTCCTCACTCCAAGCTCTTTTCTAGAGATAATCTCCAGTCCCTGTGCAGAAACTGTCATTGCACTTT 2401 CTGCTGAAATGGCAGTTTCTTCTCAGCAAGGTGAGATTATGGAATCCAGAATCTTTTTTCAGGGGTCACATGCCCATTTC 2481 CCCACTTGCATGAATGTCGACACTGCAGCCACAGTTTTGGCCGTAAATGTGAATTTGGCAAGTAACCACTGTTCCCAGGG 2561 AAATGTCCCAATCAGAAGAAGATTATCTGGGACACTGATACTGACAGGGAGATGGGACATTCTGAGGGACCCGGAGGCAG 2641 GGTGCCACCTCCTCAACTTCCCTGAGGGCTGCCTAGAATCTGTTTCCTCTCACTCTGAATTATTCTTCCTCTTATGGCTG 2721 ACCAAAAACATGGAACCTCACAAAGTCCACTGTAACAGCTTTATATTTGTGAAGTGAAGAACATGAAGACAGTTTCAAGC 2801 AAAGTTATTGAGTGGACACTTTGTGTTTTTTTTGAGAAGTCTCACTCTTTCACCCAGGCTGGAGTGCAGTGGCACGATCT 2881 CGGCTCACTGCAACTCCACCTCCCGGGTTCACGCCATTCTCTTGCCTCAGCCTCCTGAGTAGCTGGGACCACAAGCGCCC 2961 ACCACGTCAGCTTAATTTTTTTGTTTTGTTTCTTGAGACAGAGTCTTGCTCTCTTGCCCAGGTTGGAGTGCCGTGTCGCA 3041 ATCTCAGCTCACTGCAACTTCTACCTCCTGGATTCAAGCACTTCTCCTTGCCTCAGCCACCTCTTTAGCTGGGATTACAG 3121 GTGCGTGCCACCACACCCAGCTAATTTTTGTATTTTTAGCAGAGACCAGGTTTCACCATGTTGGTCAGGCTGGTCTCAAA 3201 CTCCTGACCTCGTGATCCACCCACCTCGGCCTCCCAAAGTGCTGGAATTACAGGCGTGAGCCACTGCACCTGGCCTGTAT 3281 TCTTTTCTTTAGTAGAGACGGGGTTTTACTGTATTTGCCAGGATGGTCTCGATCTCCAGACCTCGTGATCCGCCCGCCTT 3361 AGCCTCCCAAAGTGCTGGGATTATAGGCGTGAGCCAACACGCCCTGGCCACTTCTTGTCTTTGCAACATTTTTTAGATAT 3441 GTATTTGTGTTTTTTGGGGAGCTTAATTTGCTAATGGAATCTCTGTTATTTTCCTAACATGCTTGGTGGATACAAGAGTT 3521 AAGACTTCCTGTCCCGTTTAGTGTAACAAAAGAAAGTTAAGAAATGTGGATAAAAGATTGTAAGTTAGAAATGGCAAGAT 3601 AATCAGCTATATGAAGAATCTTGGCCAGGTGTGGTGGCTGAGGCCTGTAATCCCACCACTTTGGGAGGCTGAGGTGGGCG 3681 GATCACAAGGTCAGGAGTTCAAGACCACCCTGGCCAATATTGTGAATTCCTGTCTCTACTAAAAATACAAAAATTAGTCG 3761 GGCATGGTGGCGGGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCAGAAAATCGGTTGAACCTGGGAGGTGGAAGG 3841 TGCACTGAGCCAATATCACACCAGTGCACTCCAACCTGGTGACAGAGAGACACATCATCTCAAAAAAAAAAAAAAAACTC 3921 AATCCATAAATGTTATACTTTATAACTTTATAACAGCATGTTATATGGGCTTAGATATTATCCCTAAATTTTTTTTTTTT 4001 TTTTTTTTTTTGAGACAGAGTCTCACTCTGTCACCCAGGCTGAAGTGCAATGGCATGGTCTCGGCTCACTGCAACCTCCG 4081 CCTCCCAGGTTCAAGTGATTCTCTTGCCTCAGCCTCCCGAGTAGCTGGGCCTATAGGTTCCCTCCACCACGCCCAGCTAA 4161 TTTTTGTATTTTTAGTAGAGATGGGCTTTCACTACGTTAGCCAGGCTGGTCTCAAACTCCTGACCTCATGATCCACCCCC 4241 CTCGGCCTCCTAAAGTGCTGGGATTACAGGCATCTGCCACCGCACTCGGCTTATCCCTAGAAATCCTATGATAGCATGAT 4321 GTATAGGCACCTAAAGGCATGGCACTTGAGAAATGTGAATAAGATTGTAAGTTACAAATAGCAAGGTACAGTCAGATGTT 4401 AACAGTCTCAGCCCCTAAATGTCACCTTGTATTACAGCATGTTATATAAGCACATACAGGCACATACATGAAATAGTGAT 4481 ACTTCATTCTCAGTAATATCTTCATCCTTCTCACTGGAAAGATCTTTGATGATTTTTAATCAACATAGGAGTTTCAATGA 4561 TATCTAGAAGTTTAAAAGGGCTCGTTCAAACAAATTATGACCACACACACTGAAGAGTATGTTTGTCTCTTGTGGTGTAA 4641 ATTTTTTTTTATTACACCAAATTATGTTCACACAAAACCTTTGTAATCAGGGGGAATTAAAGAGCCTTCCTGGAAAATGG 4721 AGGTTGCAATCAGCCGAGATGGTGCCATCGCACTCTAGCCTGGGGAATAGAGTGAGATCCTGCCTCAAAAAAAACAAAAA 4801 AATTCTTTATTTTCTCCATAAACTACAGTTTATATAAGCAAAAGTTTCAGTACTAAGCAATTTTAGTCTCTGCAGTCTCT 4881 TGTCTTGAATTAATACAACTTTTGTTAATTCTCTTATGAAGTTAATCTTCCTGCTTGTATGTGAATTAAATATATGTCAA 4961 ACTTTTTTTGTACAAAAGATTCAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 84914.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 84914.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HCT116 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7
PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
CLIP-seq Support 1 for dataset GSM4903829 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Human neurons / CTLTD_shCTL_a |
Location of target site | NM_001204817 | 3UTR | CUCCUGAGUAGCUGGGACCACAAGCGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161238 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM4903830 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Human neurons / CTLTD_shCTL_b |
Location of target site | NM_001204817 | 3UTR | CUCCUGAGUAGCUGGGACCACAAGCGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161238 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM4903831 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Human neurons / 124TD_shELAVL3_a |
Location of target site | NM_032828 | 3UTR | CCUCAGCCUCCUGAGUAGCUGGGACUACAGGCAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161238 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM4903833 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_a |
Location of target site | NM_032828 | 3UTR | CCUCAGCCUCCUGAGUAGCUGGGACUACAGGCAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM4903835 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_c |
Location of target site | NM_001204817 | 3UTR | CGAUUCUGCCUCAGCCUCCUGAGUAGCUGGGACUACAGGCAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM4903836 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_a |
Location of target site | NM_032828 | 3UTR | CUCCUGAGUAGCUGGGACCACAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset GSM4903837 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_b |
Location of target site | NM_032828 | 3UTR | UGCCUCAGCCUCCUGAGUAGCUGGGACUACAGGCAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 8 for dataset GSM4903838 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_c |
Location of target site | NM_032828 | 3UTR | CUCAGCCUCCUGAGUAGCUGGGACUACAGGCAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 9 for dataset GSM545212 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000339656.5 | 3UTR | UUCACGCCAUUCUCUUGCCUCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 10 for dataset GSM545214 | |
---|---|
Method / RBP | PAR-CLIP / AGO3 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000339656.5 | 3UTR | UUCACGCCAUUCUCUUGCCUCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 11 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000339656.5 | 3UTR | UUCACGCCAUUCUCUUGCCUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 12 for dataset GSM545217 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-7 transfection |
Location of target site | ENST00000339656.5 | 3UTR | UUCACGCCAUUCUCUUGCCUCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 13 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000339656.5 | 3UTR | GUUCACGCCAUUCUCUUGCCUCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 14 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000339656.5 | 3UTR | UUCACGCCAUUCUCUUGCCUCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 15 for dataset GSM1065669 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
Location of target site | ENST00000339656.5 | 3UTR | UUCACGCCAUUCUCUUGCCUCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
390 hsa-miR-4419b Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT061343 | WEE1 | WEE1 G2 checkpoint kinase | ![]() |
![]() |
2 | 4 | ||||||
MIRT072743 | GLCE | glucuronic acid epimerase | ![]() |
![]() |
2 | 2 | ||||||
MIRT180549 | TXNIP | thioredoxin interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT186147 | ALG10B | ALG10B, alpha-1,2-glucosyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT271044 | PGAM5 | PGAM family member 5, mitochondrial serine/threonine protein phosphatase | ![]() |
![]() |
2 | 4 | ||||||
MIRT334761 | PPP1R15B | protein phosphatase 1 regulatory subunit 15B | ![]() |
![]() |
2 | 6 | ||||||
MIRT443279 | TSPAN15 | tetraspanin 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447047 | ZNF439 | zinc finger protein 439 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447351 | KIF6 | kinesin family member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448925 | CKS1B | CDC28 protein kinase regulatory subunit 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT452899 | PSD4 | pleckstrin and Sec7 domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453087 | SUMF2 | sulfatase modifying factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454071 | SLC35E3 | solute carrier family 35 member E3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456216 | LIX1L | limb and CNS expressed 1 like | ![]() |
![]() |
2 | 6 | ||||||
MIRT456951 | LRP10 | LDL receptor related protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458025 | MRPL12 | mitochondrial ribosomal protein L12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459999 | RFT1 | RFT1 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT460046 | CDCP1 | CUB domain containing protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460982 | STK17B | serine/threonine kinase 17b | ![]() |
![]() |
2 | 2 | ||||||
MIRT464405 | URM1 | ubiquitin related modifier 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466256 | TMBIM6 | transmembrane BAX inhibitor motif containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466536 | TBXA2R | thromboxane A2 receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT470922 | PLD5 | phospholipase D family member 5 | ![]() |
![]() |
2 | 8 | ||||||
MIRT472835 | MTMR10 | myotubularin related protein 10 | ![]() |
![]() |
2 | 6 | ||||||
MIRT473352 | MEMO1 | mediator of cell motility 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475504 | HSP90B1 | heat shock protein 90 beta family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478862 | CRISPLD2 | cysteine rich secretory protein LCCL domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480898 | BCL9L | B-cell CLL/lymphoma 9 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT482686 | NXN | nucleoredoxin | ![]() |
![]() |
2 | 4 | ||||||
MIRT484128 | C14orf142 | GON7, KEOPS complex subunit homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT486172 | TLE3 | transducin like enhancer of split 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT486539 | CLCN7 | chloride voltage-gated channel 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486588 | ZNF619 | zinc finger protein 619 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495475 | ALDOA | aldolase, fructose-bisphosphate A | ![]() |
![]() |
2 | 2 | ||||||
MIRT495536 | TXNRD2 | thioredoxin reductase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495566 | UNC5C | unc-5 netrin receptor C | ![]() |
![]() |
2 | 2 | ||||||
MIRT495719 | PADI1 | peptidyl arginine deiminase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495890 | CLOCK | clock circadian regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT495932 | SLC7A5P2 | solute carrier family 7 member 5 pseudogene 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496026 | ZBED3 | zinc finger BED-type containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496216 | PAX6 | paired box 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496349 | VAMP1 | vesicle associated membrane protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496354 | PPY | pancreatic polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT496400 | ZSCAN16 | zinc finger and SCAN domain containing 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496416 | PARVB | parvin beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT496458 | N6AMT1 | N-6 adenine-specific DNA methyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496519 | GINS2 | GINS complex subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496562 | SLC39A9 | solute carrier family 39 member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498605 | KRT8 | keratin 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT503434 | SLC25A45 | solute carrier family 25 member 45 | ![]() |
![]() |
2 | 6 | ||||||
MIRT503573 | AGAP9 | ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT503847 | ATP13A4 | ATPase 13A4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT504247 | LHPP | phospholysine phosphohistidine inorganic pyrophosphate phosphatase | ![]() |
![]() |
2 | 4 | ||||||
MIRT505606 | SLC35F1 | solute carrier family 35 member F1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT507749 | CERS2 | ceramide synthase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT508411 | C1orf210 | chromosome 1 open reading frame 210 | ![]() |
![]() |
2 | 6 | ||||||
MIRT508508 | RSRC1 | arginine and serine rich coiled-coil 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT508944 | AK4 | adenylate kinase 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT509460 | ZNF587 | zinc finger protein 587 | ![]() |
![]() |
2 | 6 | ||||||
MIRT509862 | ZNF641 | zinc finger protein 641 | ![]() |
![]() |
2 | 4 | ||||||
MIRT511397 | IKZF3 | IKAROS family zinc finger 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT512517 | BTBD19 | BTB domain containing 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT513507 | NAA50 | N(alpha)-acetyltransferase 50, NatE catalytic subunit | ![]() |
![]() |
2 | 6 | ||||||
MIRT514155 | TMEM145 | transmembrane protein 145 | ![]() |
![]() |
2 | 4 | ||||||
MIRT514486 | SLPI | secretory leukocyte peptidase inhibitor | ![]() |
![]() |
2 | 4 | ||||||
MIRT514521 | SHISA9 | shisa family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT514970 | KLLN | killin, p53-regulated DNA replication inhibitor | ![]() |
![]() |
2 | 4 | ||||||
MIRT515030 | IRAK4 | interleukin 1 receptor associated kinase 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT515963 | C9orf156 | tRNA methyltransferase O | ![]() |
![]() |
2 | 2 | ||||||
MIRT516092 | ZBTB8OS | zinc finger and BTB domain containing 8 opposite strand | ![]() |
![]() |
2 | 4 | ||||||
MIRT517223 | PRIM1 | DNA primase subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT517459 | PEX26 | peroxisomal biogenesis factor 26 | ![]() |
![]() |
2 | 4 | ||||||
MIRT517790 | EFCAB11 | EF-hand calcium binding domain 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517979 | DSCR3 | DSCR3 arrestin fold containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT519458 | CSTF1 | cleavage stimulation factor subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT519599 | ZNF805 | zinc finger protein 805 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520339 | UBXN2A | UBX domain protein 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT521345 | RPP14 | ribonuclease P/MRP subunit p14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT521571 | PTPLB | 3-hydroxyacyl-CoA dehydratase 2 | ![]() |
1 | 1 | |||||||
MIRT523382 | GSG2 | histone H3 associated protein kinase | ![]() |
![]() |
2 | 8 | ||||||
MIRT524106 | DNA2 | DNA replication helicase/nuclease 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524886 | ARHGAP11A | Rho GTPase activating protein 11A | ![]() |
![]() |
2 | 4 | ||||||
MIRT528772 | CD1D | CD1d molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT530665 | TRIM56 | tripartite motif containing 56 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531107 | PEX13 | peroxisomal biogenesis factor 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531575 | ILDR1 | immunoglobulin like domain containing receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535173 | PLEKHB2 | pleckstrin homology domain containing B2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT544168 | HEYL | hes related family bHLH transcription factor with YRPW motif-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT550582 | SLC2A5 | solute carrier family 2 member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT551039 | GDE1 | glycerophosphodiester phosphodiesterase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT551295 | MCF2L2 | MCF.2 cell line derived transforming sequence-like 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT551339 | MRE11A | MRE11 homolog, double strand break repair nuclease | ![]() |
![]() |
2 | 2 | ||||||
MIRT552092 | SLFN12L | schlafen family member 12 like | ![]() |
![]() |
2 | 6 | ||||||
MIRT555403 | PPM1L | protein phosphatase, Mg2+/Mn2+ dependent 1L | ![]() |
![]() |
2 | 2 | ||||||
MIRT557087 | HOXB3 | homeobox B3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559388 | ATP11C | ATPase phospholipid transporting 11C | ![]() |
![]() |
2 | 2 | ||||||
MIRT560305 | DFFA | DNA fragmentation factor subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT561028 | LIN7C | lin-7 homolog C, crumbs cell polarity complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT562460 | COX6B1 | cytochrome c oxidase subunit 6B1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT562982 | PARK7 | Parkinsonism associated deglycase | ![]() |
![]() |
2 | 2 | ||||||
MIRT563548 | PMPCA | peptidase, mitochondrial processing alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT564412 | EMILIN2 | elastin microfibril interfacer 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT569437 | PCGF3 | polycomb group ring finger 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572097 | EXOC8 | exocyst complex component 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575571 | Cd99 | CD99 antigen | ![]() |
![]() |
2 | 2 | ||||||
MIRT575789 | Tnfrsf10b | tumor necrosis factor receptor superfamily, member 10b | ![]() |
![]() |
2 | 2 | ||||||
MIRT576975 | Lmtk2 | lemur tyrosine kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610864 | ARSA | arylsulfatase A | ![]() |
![]() |
2 | 2 | ||||||
MIRT614061 | NTPCR | nucleoside-triphosphatase, cancer-related | ![]() |
![]() |
2 | 2 | ||||||
MIRT614141 | THAP1 | THAP domain containing 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT615235 | BROX | BRO1 domain and CAAX motif containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT617429 | ANP32E | acidic nuclear phosphoprotein 32 family member E | ![]() |
![]() |
2 | 4 | ||||||
MIRT618882 | MBL2 | mannose binding lectin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618984 | MRPS16 | mitochondrial ribosomal protein S16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619196 | SLC16A4 | solute carrier family 16 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620323 | AQP6 | aquaporin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621960 | STX7 | syntaxin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622057 | SSBP2 | single stranded DNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624930 | FBXW2 | F-box and WD repeat domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624986 | ZNF665 | zinc finger protein 665 | ![]() |
![]() |
2 | 4 | ||||||
MIRT625463 | ZNF681 | zinc finger protein 681 | ![]() |
![]() |
2 | 4 | ||||||
MIRT625497 | SMAD9 | SMAD family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625599 | KLHL23 | kelch like family member 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625668 | C2orf48 | chromosome 2 open reading frame 48 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625888 | INADL | PATJ, crumbs cell polarity complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT626161 | NFYA | nuclear transcription factor Y subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT626238 | ZNF749 | zinc finger protein 749 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626631 | SLC30A6 | solute carrier family 30 member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626994 | LINC00598 | long intergenic non-protein coding RNA 598 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627898 | OLFML2A | olfactomedin like 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT627988 | NDRG3 | NDRG family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628324 | CLPB | ClpB homolog, mitochondrial AAA ATPase chaperonin | ![]() |
![]() |
2 | 2 | ||||||
MIRT628549 | ZNF701 | zinc finger protein 701 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629464 | WIZ | widely interspaced zinc finger motifs | ![]() |
![]() |
2 | 2 | ||||||
MIRT630527 | BAZ2A | bromodomain adjacent to zinc finger domain 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT631487 | KLHL21 | kelch like family member 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT631957 | CDKAL1 | CDK5 regulatory subunit associated protein 1 like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT632178 | CCL22 | C-C motif chemokine ligand 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632282 | TVP23C | trans-golgi network vesicle protein 23 homolog C | ![]() |
![]() |
2 | 2 | ||||||
MIRT632321 | TMEM185B | transmembrane protein 185B | ![]() |
![]() |
2 | 2 | ||||||
MIRT632853 | IGF1 | insulin like growth factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632862 | HSPA2 | heat shock protein family A (Hsp70) member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633322 | LINC00346 | long intergenic non-protein coding RNA 346 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633398 | FBXW8 | F-box and WD repeat domain containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633930 | DNAH9 | dynein axonemal heavy chain 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634785 | CBFA2T2 | CBFA2/RUNX1 translocation partner 2 |