pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3123 |
Genomic Coordinates | chr1: 241132272 - 241132346 |
Description | Homo sapiens miR-3123 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3123 | ||||||||||||||
Sequence | 49| CAGAGAAUUGUUUAAUC |65 | ||||||||||||||
Evidence | Experimental | ||||||||||||||
Experiments | Illumina | ||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||
SNPs in miRNA |
|
||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | ZNF587 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | ZF6 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | zinc finger protein 587 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_032828 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on ZNF587 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of ZNF587 (miRNA target sites are highlighted) |
>ZNF587|NM_032828|3'UTR 1 GTGCAGTGAATATGGGAAATCGTTTGCTGAAGCATCCCGTCTCGTTAAACACAGGAGAGTTCATACTGGAGAAAGGCCTT 81 ATGAGTGCTGTCAATGTGGAAAACATCAGAATGTCTGCTGTCCTCGGTCTTAAGCGACTTCGTGTTGAGATGGAGTCTTG 161 TTCTGTCACCCAGGCTGGAGTGCAGTGGTGCAGTCTTGGCTCGCTGCAACTTGGGCCTCCTGGGTTCATGCAATCCTCCT 241 ACCTCAGCCTCCTGAGTAGCTGGGATTATGAGTACACACCACCACGCCCAGCTAATTTTTGTGTTTTTAGTGGAGATGGG 321 GTTTTACCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAAGTGATCCACCCACCTTGACTCCCAAAGTGCTGAAAT 401 TACAGGCATGAGCCTCTGCACCTGGCCTTCATTCTTTTCGTATTGCTTAGAATATGACATGCTGAACCAGGCATGGTGGC 481 TCATGCTTGTAAACCTGATGCTTTGGGAGGACAAGGTGGTTCATTGGAGGCCAGGAGTTAGAGATCAGCCTGGGCAACAT 561 AGCCAGACCTCCTCTCTACAAAAAGAAAAAAGAATGACATGCTTCTTGTTTTTGTCTGTTATAAATGAAACTGCTATATT 641 TGAATGCAGTTGTTCATGTAGGTATGTTTCACTATGGTAATATGGTGGTGTGCAGTGCCTGAGTCACGTGATAGATTAAA 721 GTACAACTCTTTTTTGAGACAGAGTCTCACTCTGTCACCCAGGCGGGAGTTAGGTGGCATGATTTCGGCTCACTGCAACC 801 TCTGCCTCCCAAGTTCAACTGATTCTTCTGCCTCAGCCTCCCGAGTAGCAGGGATTACCGGTGTGCACCACCATGCCTGG 881 ATAACTTTTTTTTTTATTTCTATTAGCAATGGGGTTTCACCATGCTGGCCAGGCTTGTTATGAACTGACCTCAAGTGATC 961 TGCCTGCCTCAGCTTCTCAGGTGTGACCTACTGTGCTTGGCCTAATGTACAACTTTTTAAGCAATGCCAAACTATGACTT 1041 AAGAATGAAATTATTGCTCATTTGTATATCTATCTACCATCAGTGTCCAAGAATTTCTGTTCTATCTTACCAAGAGGGAG 1121 TATGGTTAGTATTTGAAATTGTTTATTATTTTAATAAGTGGTTATAACTTTTGAGTCAGTGGTTTATGTTTTGCATTTTT 1201 TTTGTTTTGAGACAAAGTCTCGCTCTGTCTCCCAGGCTAGAGTACCGTGGCACAATCTCAGCTCATTGCAACCTCTGCTT 1281 CCTGGGCTCAAGCACTCTGCCCACCTCAGCCTCCAGAGTAGCTGGAAATACAGGTATGCACCACCACAACTGGATAACTT 1361 TTGTATTTTCTGTAGAGAGGGTTTTACCTTTTTGCCCAGTCTGATCGCGAACTCCTGGGCTCAGGCGATCCACTTGCCTA 1441 GGCTCCAAAAGTGCTTGGTCTACAGGGGTGAGGCACCCTGCCTGGCCTCACCTGTAGGCTTGTTTTTTAAAATGAATTTT 1521 ATCTATTTCCCATTTCATTAATATATTTAAAAATAATGAAATAACAAAGACGTATGTTGGACTTCATTCATTCTTCAGTG 1601 ATGTCACTTTGCTGCAAGGAATATTTGGTTTTCTTTTTTTTTTTTTTTTCCAGATGGAGTCTAGCTCTGTCTCCTAAGCT 1681 ACAGTGAAGTGGCATGATCTCGGCCCACTGCAACCTCCACCTCCTGTGTTCAAGCGATTCTGCCTCAGCCTCCTGAGTAG 1761 CTGGGACTACAGGCATGTGCCATTATACCTGGCTAATTTTATTTATTTATTTTAGTAGAGATGGGGTTTCACCATGTTAC 1841 CCAGGCTGCTCTCTACCTTCTGAGCTCAAGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAGGTGTCAGCC 1921 ACTGTACCTGGCTGAATACTTGGTTTTCAGTACCACAAGAACTATGAGCTGGTTATCCACTTCATGTGGAATCATAAGCG 2001 TCCCAAAGTGACAATACATATAGATTGCCAGGCAGTGAAACAGTTAAGATGCCACCATAGCTTTCTTTTCAACATCTTTC 2081 TAAGATTACCTTACTATTTCTTTTGTTCCAAGTTTGTACTTCCTCACAGTTCTCACATATGGAAAGGATACACACTTTGT 2161 AGAAACAAGAACTTTATGTTATCCAAGTTCTAGGATAGCCATGAGCTCCAATTATCTCAGAGCTCTGAGTCCTCTACTCA 2241 ATACCCATTGAGATTTATGTGTTCTGAGGCTTTTGTCTTCTAGCTACTTACTTCATTCTCCATGGGTAACGTCATTCATC 2321 CACATTAACTAATTTCCTCACTCCAAGCTCTTTTCTAGAGATAATCTCCAGTCCCTGTGCAGAAACTGTCATTGCACTTT 2401 CTGCTGAAATGGCAGTTTCTTCTCAGCAAGGTGAGATTATGGAATCCAGAATCTTTTTTCAGGGGTCACATGCCCATTTC 2481 CCCACTTGCATGAATGTCGACACTGCAGCCACAGTTTTGGCCGTAAATGTGAATTTGGCAAGTAACCACTGTTCCCAGGG 2561 AAATGTCCCAATCAGAAGAAGATTATCTGGGACACTGATACTGACAGGGAGATGGGACATTCTGAGGGACCCGGAGGCAG 2641 GGTGCCACCTCCTCAACTTCCCTGAGGGCTGCCTAGAATCTGTTTCCTCTCACTCTGAATTATTCTTCCTCTTATGGCTG 2721 ACCAAAAACATGGAACCTCACAAAGTCCACTGTAACAGCTTTATATTTGTGAAGTGAAGAACATGAAGACAGTTTCAAGC 2801 AAAGTTATTGAGTGGACACTTTGTGTTTTTTTTGAGAAGTCTCACTCTTTCACCCAGGCTGGAGTGCAGTGGCACGATCT 2881 CGGCTCACTGCAACTCCACCTCCCGGGTTCACGCCATTCTCTTGCCTCAGCCTCCTGAGTAGCTGGGACCACAAGCGCCC 2961 ACCACGTCAGCTTAATTTTTTTGTTTTGTTTCTTGAGACAGAGTCTTGCTCTCTTGCCCAGGTTGGAGTGCCGTGTCGCA 3041 ATCTCAGCTCACTGCAACTTCTACCTCCTGGATTCAAGCACTTCTCCTTGCCTCAGCCACCTCTTTAGCTGGGATTACAG 3121 GTGCGTGCCACCACACCCAGCTAATTTTTGTATTTTTAGCAGAGACCAGGTTTCACCATGTTGGTCAGGCTGGTCTCAAA 3201 CTCCTGACCTCGTGATCCACCCACCTCGGCCTCCCAAAGTGCTGGAATTACAGGCGTGAGCCACTGCACCTGGCCTGTAT 3281 TCTTTTCTTTAGTAGAGACGGGGTTTTACTGTATTTGCCAGGATGGTCTCGATCTCCAGACCTCGTGATCCGCCCGCCTT 3361 AGCCTCCCAAAGTGCTGGGATTATAGGCGTGAGCCAACACGCCCTGGCCACTTCTTGTCTTTGCAACATTTTTTAGATAT 3441 GTATTTGTGTTTTTTGGGGAGCTTAATTTGCTAATGGAATCTCTGTTATTTTCCTAACATGCTTGGTGGATACAAGAGTT 3521 AAGACTTCCTGTCCCGTTTAGTGTAACAAAAGAAAGTTAAGAAATGTGGATAAAAGATTGTAAGTTAGAAATGGCAAGAT 3601 AATCAGCTATATGAAGAATCTTGGCCAGGTGTGGTGGCTGAGGCCTGTAATCCCACCACTTTGGGAGGCTGAGGTGGGCG 3681 GATCACAAGGTCAGGAGTTCAAGACCACCCTGGCCAATATTGTGAATTCCTGTCTCTACTAAAAATACAAAAATTAGTCG 3761 GGCATGGTGGCGGGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCCAGAAAATCGGTTGAACCTGGGAGGTGGAAGG 3841 TGCACTGAGCCAATATCACACCAGTGCACTCCAACCTGGTGACAGAGAGACACATCATCTCAAAAAAAAAAAAAAAACTC 3921 AATCCATAAATGTTATACTTTATAACTTTATAACAGCATGTTATATGGGCTTAGATATTATCCCTAAATTTTTTTTTTTT 4001 TTTTTTTTTTTGAGACAGAGTCTCACTCTGTCACCCAGGCTGAAGTGCAATGGCATGGTCTCGGCTCACTGCAACCTCCG 4081 CCTCCCAGGTTCAAGTGATTCTCTTGCCTCAGCCTCCCGAGTAGCTGGGCCTATAGGTTCCCTCCACCACGCCCAGCTAA 4161 TTTTTGTATTTTTAGTAGAGATGGGCTTTCACTACGTTAGCCAGGCTGGTCTCAAACTCCTGACCTCATGATCCACCCCC 4241 CTCGGCCTCCTAAAGTGCTGGGATTACAGGCATCTGCCACCGCACTCGGCTTATCCCTAGAAATCCTATGATAGCATGAT 4321 GTATAGGCACCTAAAGGCATGGCACTTGAGAAATGTGAATAAGATTGTAAGTTACAAATAGCAAGGTACAGTCAGATGTT 4401 AACAGTCTCAGCCCCTAAATGTCACCTTGTATTACAGCATGTTATATAAGCACATACAGGCACATACATGAAATAGTGAT 4481 ACTTCATTCTCAGTAATATCTTCATCCTTCTCACTGGAAAGATCTTTGATGATTTTTAATCAACATAGGAGTTTCAATGA 4561 TATCTAGAAGTTTAAAAGGGCTCGTTCAAACAAATTATGACCACACACACTGAAGAGTATGTTTGTCTCTTGTGGTGTAA 4641 ATTTTTTTTTATTACACCAAATTATGTTCACACAAAACCTTTGTAATCAGGGGGAATTAAAGAGCCTTCCTGGAAAATGG 4721 AGGTTGCAATCAGCCGAGATGGTGCCATCGCACTCTAGCCTGGGGAATAGAGTGAGATCCTGCCTCAAAAAAAACAAAAA 4801 AATTCTTTATTTTCTCCATAAACTACAGTTTATATAAGCAAAAGTTTCAGTACTAAGCAATTTTAGTCTCTGCAGTCTCT 4881 TGTCTTGAATTAATACAACTTTTGTTAATTCTCTTATGAAGTTAATCTTCCTGCTTGTATGTGAATTAAATATATGTCAA 4961 ACTTTTTTTGTACAAAAGATTCAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 84914.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 84914.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HCT116 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7
PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
CLIP-seq Support 1 for dataset GSM4903829 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Human neurons / CTLTD_shCTL_a |
Location of target site | NM_001204817 | 3UTR | CCCAGGUUCAAGUGAUUCUCUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161238 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM4903835 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_c |
Location of target site | NM_001204817 | 3UTR | CGCCUCCCAGGUUCAAGUGAUUCUCUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM4903838 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_c |
Location of target site | NM_032828 | 3UTR | CCAGGUUCAAGUGAUUCUCUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM545212 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000339656.5 | 3UTR | UUCACGCCAUUCUCUUGCCUCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM545214 | |
---|---|
Method / RBP | PAR-CLIP / AGO3 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000339656.5 | 3UTR | UUCACGCCAUUCUCUUGCCUCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000339656.5 | 3UTR | UUCACGCCAUUCUCUUGCCUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset GSM545217 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-7 transfection |
Location of target site | ENST00000339656.5 | 3UTR | UUCACGCCAUUCUCUUGCCUCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 8 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000339656.5 | 3UTR | GUUCACGCCAUUCUCUUGCCUCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 9 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000339656.5 | 3UTR | UUCACGCCAUUCUCUUGCCUCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 10 for dataset GSM1065669 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
Location of target site | ENST00000339656.5 | 3UTR | UUCACGCCAUUCUCUUGCCUCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
113 hsa-miR-3123 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT058369 | TBCEL | tubulin folding cofactor E like | ![]() |
![]() |
2 | 4 | ||||||
MIRT059816 | EFNA1 | ephrin A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT066850 | TMEM19 | transmembrane protein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT071503 | CALM1 | calmodulin 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT073758 | NUBP1 | nucleotide binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT074324 | TNRC6A | trinucleotide repeat containing 6A | ![]() |
![]() |
2 | 10 | ||||||
MIRT094805 | LMNB1 | lamin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT099173 | MAP3K4 | mitogen-activated protein kinase kinase kinase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT099545 | ID4 | inhibitor of DNA binding 4, HLH protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT122643 | E2F3 | E2F transcription factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT180918 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT192844 | BLOC1S6 | biogenesis of lysosomal organelles complex 1 subunit 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT224984 | BAG4 | BCL2 associated athanogene 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT246065 | NRAS | NRAS proto-oncogene, GTPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT357085 | PRRC1 | proline rich coiled-coil 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT378170 | C5ORF51 | chromosome 5 open reading frame 51 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441636 | KDM5A | lysine demethylase 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT441802 | BCAS1 | breast carcinoma amplified sequence 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443019 | C21orf91 | chromosome 21 open reading frame 91 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443445 | SERPINB4 | serpin family B member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443661 | SERPINB3 | serpin family B member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443776 | STS | steroid sulfatase | ![]() |
![]() |
2 | 2 | ||||||
MIRT444663 | TSPAN14 | tetraspanin 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT444924 | KIAA1522 | KIAA1522 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445378 | FOXO1 | forkhead box O1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447920 | PAIP2B | poly(A) binding protein interacting protein 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT449202 | PTPLAD2 | 3-hydroxyacyl-CoA dehydratase 4 | ![]() |
1 | 1 | |||||||
MIRT449713 | TSPYL1 | TSPY like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450403 | TMEM47 | transmembrane protein 47 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450787 | PAPOLG | poly(A) polymerase gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT451381 | C19orf43 | telomerase RNA component interacting RNase | ![]() |
![]() |
2 | 2 | ||||||
MIRT452507 | WDR1 | WD repeat domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453264 | PARP11 | poly(ADP-ribose) polymerase family member 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454642 | FAM83H | family with sequence similarity 83 member H | ![]() |
![]() |
2 | 2 | ||||||
MIRT455513 | C6orf106 | chromosome 6 open reading frame 106 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456709 | LDB1 | LIM domain binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457231 | AP3D1 | adaptor related protein complex 3 delta 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT459235 | MRPS21 | mitochondrial ribosomal protein S21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460553 | IFNAR1 | interferon alpha and beta receptor subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT461424 | CTSL2 | cathepsin V | ![]() |
![]() |
2 | 3 | ||||||
MIRT462869 | CYP51A1 | cytochrome P450 family 51 subfamily A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467178 | SPTY2D1 | SPT2 chromatin protein domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469233 | RHOBTB3 | Rho related BTB domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474125 | LIPC | lipase C, hepatic type | ![]() |
![]() |
2 | 2 | ||||||
MIRT475509 | HSP90B1 | heat shock protein 90 beta family member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT478134 | DHX36 | DEAH-box helicase 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT481326 | ATP5A1 | ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle | ![]() |
![]() |
2 | 2 | ||||||
MIRT482003 | AMOTL2 | angiomotin like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482230 | AHCYL2 | adenosylhomocysteinase like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT483436 | RHOXF2B | Rhox homeobox family member 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT483824 | ZC3H12B | zinc finger CCCH-type containing 12B | ![]() |
![]() |
2 | 2 | ||||||
MIRT492051 | TNFSF9 | TNF superfamily member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT494114 | DLX6 | distal-less homeobox 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498882 | ZNF12 | zinc finger protein 12 | ![]() |
![]() |
2 | 10 | ||||||
MIRT499674 | NPHP3 | nephrocystin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT506932 | IGDCC4 | immunoglobulin superfamily DCC subclass member 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT509461 | ZNF587 | zinc finger protein 587 | ![]() |
![]() |
2 | 6 | ||||||
MIRT510048 | AKR1B10 | aldo-keto reductase family 1 member B10 | ![]() |
![]() |
2 | 4 | ||||||
MIRT514807 | NWD1 | NACHT and WD repeat domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT515217 | CRCP | CGRP receptor component | ![]() |
![]() |
2 | 2 | ||||||
MIRT515486 | INCENP | inner centromere protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT517765 | ZNF366 | zinc finger protein 366 | ![]() |
![]() |
2 | 4 | ||||||
MIRT518216 | TRMT10B | tRNA methyltransferase 10B | ![]() |
![]() |
2 | 2 | ||||||
MIRT519602 | ZNF805 | zinc finger protein 805 | ![]() |
![]() |
2 | 2 | ||||||
MIRT523570 | GGCX | gamma-glutamyl carboxylase | ![]() |
![]() |
2 | 4 | ||||||
MIRT525795 | SOD2 | superoxide dismutase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533055 | ZBTB37 | zinc finger and BTB domain containing 37 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534218 | SLC37A3 | solute carrier family 37 member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT535633 | NR2E1 | nuclear receptor subfamily 2 group E member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535863 | MRPL17 | mitochondrial ribosomal protein L17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536344 | LEFTY1 | left-right determination factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT537923 | DSTYK | dual serine/threonine and tyrosine protein kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT543114 | SKA2 | spindle and kinetochore associated complex subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544717 | ZNF529 | zinc finger protein 529 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544847 | BASP1 | brain abundant membrane attached signal protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT545536 | ARF3 | ADP ribosylation factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547124 | PHLPP2 | PH domain and leucine rich repeat protein phosphatase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548070 | GIGYF1 | GRB10 interacting GYF protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548446 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT548626 | DAZAP1 | DAZ associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT550259 | FAM120AOS | family with sequence similarity 120A opposite strand | ![]() |
![]() |
2 | 2 | ||||||
MIRT551940 | AKAP8 | A-kinase anchoring protein 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT552511 | ZIK1 | zinc finger protein interacting with K protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT554015 | SPIRE1 | spire type actin nucleation factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT556647 | KPNA2 | karyopherin subunit alpha 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT559744 | ACOX1 | acyl-CoA oxidase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560393 | TMEM254 | transmembrane protein 254 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562234 | HMGB2 | high mobility group box 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563325 | ORC4 | origin recognition complex subunit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563697 | RPS26 | ribosomal protein S26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565066 | USP25 | ubiquitin specific peptidase 25 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565349 | TMED2 | transmembrane p24 trafficking protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565624 | SLC31A1 | solute carrier family 31 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566379 | PNISR | PNN interacting serine and arginine rich protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT567575 | FEM1C | fem-1 homolog C | ![]() |
![]() |
2 | 2 | ||||||
MIRT569383 | DDX20 | DEAD-box helicase 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570037 | FAM228A | family with sequence similarity 228 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT573269 | DCAF10 | DDB1 and CUL4 associated factor 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573912 | PARP1 | poly(ADP-ribose) polymerase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620034 | ST6GALNAC3 | ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635606 | ZWILCH | zwilch kinetochore protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT644413 | FRMD6 | FERM domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652528 | TM9SF4 | transmembrane 9 superfamily member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656238 | MFSD6 | major facilitator superfamily domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661373 | DYRK4 | dual specificity tyrosine phosphorylation regulated kinase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662530 | PNPLA4 | patatin like phospholipase domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675551 | MALL | mal, T-cell differentiation protein like | ![]() |
![]() |
2 | 2 | ||||||
MIRT693650 | ACBD7 | acyl-CoA binding domain containing 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696348 | SLC35D2 | solute carrier family 35 member D2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705815 | AKNA | AT-hook transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT707632 | TARDBP | TAR DNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT717902 | COPS8 | COP9 signalosome subunit 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT723626 | SOBP | sine oculis binding protein homolog | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|