>HIST2H2AB|NM_175065|3'UTR
   1 TTAAGAGGCTTGACACCATACTCATTCACCCCAAAGGCTCTTTTAAGAGCCACCA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gaGGUCCCGGCUGGUGGGGUu 5' ||| :| :||||||| Target 5' caCCATACTCATTCACCCCAa 3'	14 - 34	147.00	-19.30

Mutant ID	Mutant Position	Mutant Source
rs1332586687	1	dbSNP
rs782134843	1	dbSNP
rs1028635793	2	dbSNP
rs1212829860	4	dbSNP
rs781752502	5	dbSNP
rs781984344	6	dbSNP
rs782503721	7	dbSNP
rs782496981	9	dbSNP
rs781796868	10	dbSNP
rs782716127	11	dbSNP
rs371300753	12	dbSNP
rs782354139	12	dbSNP
rs782147072	13	dbSNP
rs1203047229	14	dbSNP
rs12118591	15	dbSNP
rs781900619	16	dbSNP
rs1260645463	17	dbSNP
rs782078721	17	dbSNP
rs782777265	17	dbSNP
rs1485684161	18	dbSNP
rs781948997	19	dbSNP
rs376897558	20	dbSNP
rs1416328116	21	dbSNP
rs373976598	23	dbSNP
rs781931798	23	dbSNP
rs370085338	24	dbSNP
rs782425540	25	dbSNP
rs782251477	27	dbSNP
rs782306187	28	dbSNP
rs782348465	29	dbSNP
rs782225948	30	dbSNP
rs1452127784	32	dbSNP
rs782580161	33	dbSNP
rs1288465053	34	dbSNP
rs782291122	34	dbSNP
rs782459770	36	dbSNP
rs781890352	37	dbSNP
rs1416621689	43	dbSNP
rs1353467823	45	dbSNP
rs782009982	45	dbSNP
rs782384090	46	dbSNP
rs782230341	47	dbSNP
rs782680378	48	dbSNP
rs1307401719	50	dbSNP
rs782502396	51	dbSNP
rs902708888	53	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.