pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-216a |
Genomic Coordinates | chr2: 55988950 - 55989059 |
Description | Homo sapiens miR-216a stem-loop |
Comment | This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences . |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-216a-5p | ||||||||||||||||||||||||
Sequence | 19| UAAUCUCAGCUGGCAACUGUGA |40 | ||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||
Experiments | Cloned | ||||||||||||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Biomarker Information |
|
---|
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | MON1B | ||||||||||||||||||||
Synonyms | HSRG1, SAND2, SRG1 | ||||||||||||||||||||
Description | MON1 homolog B, secretory trafficking associated | ||||||||||||||||||||
Transcript | NM_014940 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on MON1B | |||||||||||||||||||||
3'UTR of MON1B (miRNA target sites are highlighted) |
>MON1B|NM_014940|3'UTR 1 TAGTTGGAGCTCCCAGACCAGGCAGTGCTGGGAGCAACCACCTTTGTTTTTTACCTTCTGTCTACCCTGGAAATGTGTGT 81 GGGGGTGTGTCTGTGGCCAGTCATTGTCTCCCTAAGCAATGGGGCAAGGTCTGAGGGCCCACCGATGAGAGAGATGGTGG 161 CAGCCGCCAGGCGAGCAGGCTGCTTTCCCTGCCCAGTCATGCACCTCCCCCTCTGGGGAAATCCTTAGGCCTCCCTCTCC 241 CTTCCCTCTGTCTCATCTCCTCCACTTGGATGATGCTCTAGCCTCTGTCAGGGACTGTCCCCTCCAAACTTGCTTCCGTG 321 GTCTGCCTCCTAGTTGAATCTCAGCCCTGAGTGTCCAGATCTGGCCAAGGTGTCTAGGGTGGCCCACGGGGGTGCTGGAA 401 TTGGCACTTCAGGGCCAGGCTATGCTTGGGACTGGCCTGAGGGTATTTTAAAGAAAAAAACTACATAAAAGGCCTAAAAG 481 TAAGACCCACAAGGATATTCCTTTGCCCTTCTTGTACTTTTTTCATCTTTACCCTGCCAGAAATGACCCGCCCTCAATGC 561 TGGCTGCTGCTAACATTAATGAGAAGGTGGCCTTCAGTGTCCACCTGTGGAACCCAGGACACAGCACCTGACTGCACACA 641 GTGGCTGAAATCCAGCATTTTTACATAGGAGATGCACTTAGCCTCTAAGCCTCGTTTTACTCATCTGTGAAACAGAGATA 721 AGTAACCCTCTCTCATGAACTCTTTGATGAGGATTTGTAAACGAAAACAGACTCGAACTATTGTGTACCACCACATAGCA 801 CATGCACGTCTGTCCCAGACTTTGACAACCTGCACAAGACAAGCAGCCTAAAGCAGGAGAGACCTCCCTAGGGTTTTGTG 881 TGTGTGCACACTACCCTCACTCCCCAACTGGCCATTACCCTAGTTCTGCCCTTGTTTGTGGAGTTACAGCCTCAAGGTTG 961 TAGCATGTGTGCTGGCAATCAGGGCCGCAGTGTGTTCTGCGCCTGCCCAGAGCTGACTCCTGATTTAACCGCTGGCGTAA 1041 CCGCGGGTTGCACGCATGCGTGCTGAAAAGCCTTTCACCCTCACGTGGTTTCTTTTTTAACCAGTCATCAAGCGAGGCTC 1121 GCGCGCAGGCCCCGCGTTGGAAAATGGCGGGGAAGCTGAAACCTCTGAATGTGGAGGCGCCAGAAGCTGCTGAGGAGGCT 1201 GAAGGTAGTGAGGGCAAGTGGGCTGCACTCCTTTCTCTCCAACCAGGGCAGAAAGGAGGGAGGATTCGTCCCATTACAAT 1281 AATGAAATAATGATATTCTAATTTTTTTAAATAAAATGTTAAGCCTTTTGTTATTGAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 22879.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000248248.3 | 3UTR | CAUAUUCUUAUCACCGAGAUUAACUUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545217 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-7 transfection |
Location of target site | ENST00000248248.3 | 3UTR | CAUAUUCUUAUCACCGAGAUUAACUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000248248.3 | 3UTR | AAUUAACAGGCAUAUUCUUAUCACCGAGAUUAACUUUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM1065668 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
Location of target site | ENST00000248248.3 | 3UTR | CAUAUUCUUAUCACCGAGAUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM1065669 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
Location of target site | ENST00000248248.3 | 3UTR | CAUAUUCUUAUCACCGAGAUUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
148 hsa-miR-216a-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT000534 | PTEN | phosphatase and tensin homolog | 4 | 3 | ||||||||
MIRT005018 | SIRT1 | sirtuin 1 | 3 | 1 | ||||||||
MIRT005964 | CDC42 | cell division cycle 42 | 2 | 1 | ||||||||
MIRT005969 | CD44 | CD44 molecule (Indian blood group) | 2 | 1 | ||||||||
MIRT007154 | SMAD7 | SMAD family member 7 | 1 | 1 | ||||||||
MIRT054887 | BECN1 | beclin 1 | 5 | 3 | ||||||||
MIRT067588 | METAP2 | methionyl aminopeptidase 2 | 2 | 6 | ||||||||
MIRT099144 | MYLIP | myosin regulatory light chain interacting protein | 2 | 12 | ||||||||
MIRT162313 | TGFBR2 | transforming growth factor beta receptor 2 | 2 | 2 | ||||||||
MIRT230668 | DFFA | DNA fragmentation factor subunit alpha | 2 | 2 | ||||||||
MIRT256274 | PHAX | phosphorylated adaptor for RNA export | 2 | 2 | ||||||||
MIRT386817 | RAD51L3-RFFL | RAD51L3-RFFL readthrough | 2 | 2 | ||||||||
MIRT386825 | RFFL | ring finger and FYVE like domain containing E3 ubiquitin protein ligase | 2 | 2 | ||||||||
MIRT438816 | HNF4A | hepatocyte nuclear factor 4 alpha | 1 | 1 | ||||||||
MIRT464699 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | 2 | 2 | ||||||||
MIRT465962 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | 2 | 2 | ||||||||
MIRT466046 | TMEM189 | transmembrane protein 189 | 2 | 2 | ||||||||
MIRT466482 | TECPR2 | tectonin beta-propeller repeat containing 2 | 2 | 7 | ||||||||
MIRT472209 | NGFRAP1 | brain expressed X-linked 3 | 2 | 4 | ||||||||
MIRT472562 | NACC1 | nucleus accumbens associated 1 | 2 | 4 | ||||||||
MIRT478921 | CPS1 | carbamoyl-phosphate synthase 1 | 2 | 2 | ||||||||
MIRT480121 | CALR | calreticulin | 2 | 2 | ||||||||
MIRT497754 | OXGR1 | oxoglutarate receptor 1 | 2 | 2 | ||||||||
MIRT497967 | TWISTNB | TWIST neighbor | 2 | 2 | ||||||||
MIRT502882 | CDK4 | cyclin dependent kinase 4 | 2 | 8 | ||||||||
MIRT510191 | MON1B | MON1 homolog B, secretory trafficking associated | 2 | 4 | ||||||||
MIRT512407 | CD84 | CD84 molecule | 2 | 2 | ||||||||
MIRT513739 | PSD3 | pleckstrin and Sec7 domain containing 3 | 2 | 4 | ||||||||
MIRT526257 | DROSHA | drosha ribonuclease III | 2 | 2 | ||||||||
MIRT528968 | FAM19A3 | family with sequence similarity 19 member A3, C-C motif chemokine like | 2 | 2 | ||||||||
MIRT529599 | C6orf132 | chromosome 6 open reading frame 132 | 2 | 2 | ||||||||
MIRT529776 | ZNF486 | zinc finger protein 486 | 2 | 2 | ||||||||
MIRT530110 | PSAPL1 | prosaposin like 1 (gene/pseudogene) | 2 | 2 | ||||||||
MIRT530504 | FADS6 | fatty acid desaturase 6 | 2 | 2 | ||||||||
MIRT531437 | PAK1 | p21 (RAC1) activated kinase 1 | 2 | 2 | ||||||||
MIRT534445 | SDR16C5 | short chain dehydrogenase/reductase family 16C member 5 | 2 | 2 | ||||||||
MIRT537286 | GABPB1 | GA binding protein transcription factor beta subunit 1 | 2 | 2 | ||||||||
MIRT538451 | CNNM2 | cyclin and CBS domain divalent metal cation transport mediator 2 | 2 | 2 | ||||||||
MIRT543085 | ACTB | actin beta | 2 | 2 | ||||||||
MIRT550982 | ZNF254 | zinc finger protein 254 | 2 | 2 | ||||||||
MIRT556259 | MAPRE2 | microtubule associated protein RP/EB family member 2 | 2 | 2 | ||||||||
MIRT556639 | LAMC1 | laminin subunit gamma 1 | 2 | 2 | ||||||||
MIRT559127 | C11orf57 | chromosome 11 open reading frame 57 | 2 | 2 | ||||||||
MIRT561405 | TUBB2A | tubulin beta 2A class IIa | 2 | 2 | ||||||||
MIRT569677 | SEC23B | Sec23 homolog B, coat complex II component | 2 | 4 | ||||||||
MIRT574660 | KLHL15 | kelch like family member 15 | 2 | 2 | ||||||||
MIRT575030 | Tecpr2 | tectonin beta-propeller repeat containing 2 | 2 | 5 | ||||||||
MIRT617683 | JRKL | JRK like | 2 | 2 | ||||||||
MIRT618540 | SEMA5A | semaphorin 5A | 2 | 2 | ||||||||
MIRT620805 | C1orf27 | chromosome 1 open reading frame 27 | 2 | 2 | ||||||||
MIRT621569 | ZBTB7A | zinc finger and BTB domain containing 7A | 2 | 2 | ||||||||
MIRT622133 | SP4 | Sp4 transcription factor | 2 | 2 | ||||||||
MIRT624913 | CTCFL | CCCTC-binding factor like | 2 | 2 | ||||||||
MIRT625010 | PAK4 | p21 (RAC1) activated kinase 4 | 2 | 2 | ||||||||
MIRT626644 | ZNF551 | zinc finger protein 551 | 2 | 2 | ||||||||
MIRT626646 | ATP5A1 | ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle | 2 | 2 | ||||||||
MIRT626672 | NOM1 | nucleolar protein with MIF4G domain 1 | 2 | 2 | ||||||||
MIRT627945 | NNT | nicotinamide nucleotide transhydrogenase | 2 | 2 | ||||||||
MIRT627963 | NLK | nemo like kinase | 2 | 2 | ||||||||
MIRT628767 | SRSF7 | serine and arginine rich splicing factor 7 | 2 | 2 | ||||||||
MIRT629261 | KDM2B | lysine demethylase 2B | 2 | 2 | ||||||||
MIRT629422 | ADM2 | adrenomedullin 2 | 2 | 2 | ||||||||
MIRT630238 | SORD | sorbitol dehydrogenase | 2 | 2 | ||||||||
MIRT631272 | CENPM | centromere protein M | 2 | 4 | ||||||||
MIRT631793 | CLK4 | CDC like kinase 4 | 2 | 2 | ||||||||
MIRT632058 | ATF7IP | activating transcription factor 7 interacting protein | 2 | 2 | ||||||||
MIRT632485 | RPS15A | ribosomal protein S15a | 2 | 2 | ||||||||
MIRT632611 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | 2 | 2 | ||||||||
MIRT632708 | MTA3 | metastasis associated 1 family member 3 | 2 | 2 | ||||||||
MIRT632815 | INO80 | INO80 complex subunit | 2 | 2 | ||||||||
MIRT635956 | PLA2G12A | phospholipase A2 group XIIA | 2 | 2 | ||||||||
MIRT636152 | UBXN2A | UBX domain protein 2A | 2 | 2 | ||||||||
MIRT636899 | C5orf45 | MRN complex interacting protein | 2 | 4 | ||||||||
MIRT636930 | AGAP9 | ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 | 2 | 2 | ||||||||
MIRT637457 | ZNF324B | zinc finger protein 324B | 2 | 2 | ||||||||
MIRT637900 | SLC19A3 | solute carrier family 19 member 3 | 2 | 2 | ||||||||
MIRT639826 | ZNF638 | zinc finger protein 638 | 2 | 2 | ||||||||
MIRT640445 | ERVMER34-1 | endogenous retrovirus group MER34 member 1, envelope | 2 | 2 | ||||||||
MIRT640681 | ARSK | arylsulfatase family member K | 2 | 2 | ||||||||
MIRT641611 | CAPN7 | calpain 7 | 2 | 2 | ||||||||
MIRT641676 | AKR7A2 | aldo-keto reductase family 7 member A2 | 2 | 2 | ||||||||
MIRT646786 | IL23R | interleukin 23 receptor | 2 | 2 | ||||||||
MIRT648352 | A2ML1 | alpha-2-macroglobulin like 1 | 2 | 2 | ||||||||
MIRT649144 | SPATA5 | spermatogenesis associated 5 | 2 | 2 | ||||||||
MIRT649254 | TRIM65 | tripartite motif containing 65 | 2 | 2 | ||||||||
MIRT652491 | TMEM178B | transmembrane protein 178B | 2 | 2 | ||||||||
MIRT653308 | SMU1 | DNA replication regulator and spliceosomal factor | 2 | 2 | ||||||||
MIRT653945 | SEPSECS | Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase | 2 | 2 | ||||||||
MIRT654212 | RNF19B | ring finger protein 19B | 2 | 2 | ||||||||
MIRT654839 | PPM1L | protein phosphatase, Mg2+/Mn2+ dependent 1L | 2 | 2 | ||||||||
MIRT655159 | PHF21A | PHD finger protein 21A | 2 | 2 | ||||||||
MIRT655316 | PDCD11 | programmed cell death 11 | 2 | 2 | ||||||||
MIRT655375 | PAX3 | paired box 3 | 2 | 2 | ||||||||
MIRT657301 | HOXB5 | homeobox B5 | 2 | 2 | ||||||||
MIRT657593 | GRIN2A | glutamate ionotropic receptor NMDA type subunit 2A | 2 | 2 | ||||||||
MIRT658460 | FAM117B | family with sequence similarity 117 member B | 2 | 2 | ||||||||
MIRT658716 | ELOVL4 | ELOVL fatty acid elongase 4 | 2 | 2 | ||||||||
MIRT661640 | UGT2B28 | UDP glucuronosyltransferase family 2 member B28 | 2 | 2 | ||||||||
MIRT661712 | MTO1 | mitochondrial tRNA translation optimization 1 | 2 | 4 | ||||||||
MIRT661833 | ZNF793 | zinc finger protein 793 | 2 | 2 | ||||||||
MIRT663805 | BET1L | Bet1 golgi vesicular membrane trafficking protein like | 2 | 2 | ||||||||
MIRT663884 | CXorf56 | chromosome X open reading frame 56 | 2 | 2 | ||||||||
MIRT664672 | L2HGDH | L-2-hydroxyglutarate dehydrogenase | 2 | 2 | ||||||||
MIRT665814 | TMEM168 | transmembrane protein 168 | 2 | 2 | ||||||||
MIRT668159 | GDE1 | glycerophosphodiester phosphodiesterase 1 | 2 | 2 | ||||||||
MIRT668430 | FAM20B | FAM20B, glycosaminoglycan xylosylkinase | 2 | 2 | ||||||||
MIRT672306 | GP2 | glycoprotein 2 | 2 | 2 | ||||||||
MIRT673101 | SYNPO2L | synaptopodin 2 like | 2 | 2 | ||||||||
MIRT673437 | APAF1 | apoptotic peptidase activating factor 1 | 2 | 2 | ||||||||
MIRT673584 | KDELC2 | KDEL motif containing 2 | 2 | 2 | ||||||||
MIRT673718 | SLU7 | SLU7 homolog, splicing factor | 2 | 2 | ||||||||
MIRT673777 | MRPL17 | mitochondrial ribosomal protein L17 | 2 | 2 | ||||||||
MIRT674316 | IMP4 | IMP4, U3 small nucleolar ribonucleoprotein | 2 | 2 | ||||||||
MIRT674820 | FAM229B | family with sequence similarity 229 member B | 2 | 2 | ||||||||
MIRT675179 | BPTF | bromodomain PHD finger transcription factor | 2 | 2 | ||||||||
MIRT675586 | WWC1 | WW and C2 domain containing 1 | 2 | 2 | ||||||||
MIRT675812 | MED28 | mediator complex subunit 28 | 2 | 2 | ||||||||
MIRT677632 | ALG1 | ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase | 2 | 2 | ||||||||
MIRT683914 | PSMB9 | proteasome subunit beta 9 | 2 | 2 | ||||||||
MIRT687135 | QPCTL | glutaminyl-peptide cyclotransferase like | 2 | 2 | ||||||||
MIRT691973 | PLCXD1 | phosphatidylinositol specific phospholipase C X domain containing 1 | 2 | 2 | ||||||||
MIRT693078 | AS3MT | arsenite methyltransferase | 2 | 2 | ||||||||
MIRT694084 | RNASEH2B | ribonuclease H2 subunit B | 2 | 2 | ||||||||
MIRT696292 | IER3IP1 | immediate early response 3 interacting protein 1 | 2 | 2 | ||||||||
MIRT696541 | C3 | complement C3 | 2 | 2 | ||||||||
MIRT701955 | MITF | melanogenesis associated transcription factor | 2 | 2 | ||||||||
MIRT703276 | GNG12 | G protein subunit gamma 12 | 2 | 2 | ||||||||
MIRT706852 | DNAJB13 | DnaJ heat shock protein family (Hsp40) member B13 | 2 | 2 | ||||||||
MIRT706993 | XPO5 | exportin 5 | 2 | 2 | ||||||||
MIRT710716 | KRTAP6-1 | keratin associated protein 6-1 | 2 | 2 | ||||||||
MIRT711305 | ACOX1 | acyl-CoA oxidase 1 | 2 | 2 | ||||||||
MIRT711514 | ESCO1 | establishment of sister chromatid cohesion N-acetyltransferase 1 | 2 | 2 | ||||||||
MIRT711648 | LIPG | lipase G, endothelial type | 2 | 2 | ||||||||
MIRT711772 | CCDC59 | coiled-coil domain containing 59 | 2 | 2 | ||||||||
MIRT714280 | COQ7 | coenzyme Q7, hydroxylase | 2 | 2 | ||||||||
MIRT715048 | PRPF38A | pre-mRNA processing factor 38A | 2 | 2 | ||||||||
MIRT716934 | INCENP | inner centromere protein | 2 | 2 | ||||||||
MIRT717220 | OTUD3 | OTU deubiquitinase 3 | 2 | 2 | ||||||||
MIRT717865 | BICD2 | BICD cargo adaptor 2 | 2 | 2 | ||||||||
MIRT718836 | SNX20 | sorting nexin 20 | 2 | 2 | ||||||||
MIRT720243 | GPBP1 | GC-rich promoter binding protein 1 | 2 | 2 | ||||||||
MIRT721969 | MCM8 | minichromosome maintenance 8 homologous recombination repair factor | 2 | 2 | ||||||||
MIRT724000 | LMTK2 | lemur tyrosine kinase 2 | 2 | 2 | ||||||||
MIRT725193 | SDAD1 | SDA1 domain containing 1 | 2 | 2 | ||||||||
MIRT731669 | CBL | Cbl proto-oncogene | 3 | 1 | ||||||||
MIRT732776 | AQP4 | aquaporin 4 | 3 | 0 | ||||||||
MIRT733158 | ITGA5 | integrin subunit alpha 5 | 1 | 0 | ||||||||
MIRT735623 | TLR4 | toll like receptor 4 | 4 | 0 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|