miRTarBase - #MIRT510371


—
pre-miRNA Information
pre-miRNA hsa-mir-4672   
Genomic Coordinates chr9: 127869415 - 127869495
Description Homo sapiens miR-4672 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4672
Sequence 51| UUACACAGCUGGACAGAGGCA |71
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1234304182 2 dbSNP
rs1012722802 6 dbSNP
rs1212523496 9 dbSNP
rs1027978850 10 dbSNP
rs1212553533 14 dbSNP
rs895240447 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF703   
Synonyms NLZ1, ZEPPO1, ZNF503L, ZPO1
Description zinc finger protein 703
Transcript NM_025069   
Expression
Putative miRNA Targets on ZNF703
3'UTR of ZNF703
(miRNA target sites are highlighted)		 
>ZNF703|NM_025069|3'UTR
   1 CTACAGCTCTTCCTCCACCCCAGCCCCCTCACCCTCCTCCCTCTCCCTCCTCCTCCCTCCCCACCTGCCGTCGCCGCTGC
  81 AACCTCCACTACTGCTTGACCCTGCCGGGATTCCCCACCCAGCCCTTCCCCACCGGACTGTGTATTTATTTACTATAATG
 161 TTAGCTTACAAGCTGGGAATATAAGTGCATTAACGGCCCACATGAGTCAATGGTATGCAAAAAGTCTGTGTTCTCCCAAA
 241 TAATAATATTAATCCCACAAATAACGACATGATCCCCGCCCCTGTTCCTTTCTGTTATTTTTTCTTAGATATAAGTTTTA
 321 CATTTTTTATTCCTTTTCCTCTTTTTTTGGTTTTGATTGGTTTGGTTTGAGGGAGAGTTGGGGTCTTTGGGTTCTTCTAG
 401 ACGTTTTGTTTTCCCTTCCTGGGGAGTTTCTTGCATGAGTCTTAACTTAAAACTACGTTTCCGCCTTCTCTTTTTCCCTC
 481 TTCCCCCTTCATTCCCTCTTGTTTCCTTCCATTTGCGGTTCTGTTTTTGTTTTTTGTTTTGTTTTGTTTTGTTTTTTCCT
 561 TTGTTGTACAAGTAACAGAGAGGAGGTTTTTTTTGTAACTCATTTTGGGGGTGGAGGGGGCCACCTGGGTGGCAGGGGCC
 641 CTGGAGCTCTATTGACCTGGTACACTGCTCCGGGACTCCTCCCCCGCCACCCTCCGCGCATAGGGTCCTTGGTCTGGACC
 721 CTGCCCCCCAAAAGTAGGGCCTTGCTCCTCTACCTTGCTCTGAGCACGGAGAGCCCTGACCCCACCAGTAGGCTCGCCCC
 801 CAGAAGGGCCCAAGTGGCCGTCTACCGTCACCTTCCAGACTCCCGCCCCTAACACCCAGTGGCTACAGTGCGCCTGTCGG
 881 GGCACCTGGAGCGCTCACCTGGTTGAATTCAAAGTCCCAGAAGGCCCCGCTGGCGTGAAGCCGGCCCCTTACATTTTGCG
 961 AAGTGCATTATAGTCCTTGTTTTTCTCTCCCTCGTGGGGGCAACGACCCCTCCCCTGGCAGTAGGGGTGGGGTAGGTGAC
1041 TCTCGCTAGATCCCTCCAAAGCAGACCGGTGGCGATGTCAGCGGATGTCACGAGCTCGTTAGCTGCGTTCGGGGAAGGTT
1121 GGGGCGTCAGGGAGCTCTCGGATCACAGCAGCCCCCGCCCTCTCCTAGGCCTGGCCCGGCAGAGCCCCCAGAGTGGACCC
1201 CCCAGCGACTGGGGTCTTCTCCCCACTCCTCCCTCCTTCTGGTCTGATGCGGCAGCGCGGGGGCTGCGGGGCCTGTTTGG
1281 GACGAACAGAGCTCTCCCTTGGTAAGACTTATTTTGTTAATAAATGGAATACTTGGCTATATTCACAAAAAAAAAAAAAA
1361 AAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acGGA--GACAGGUC-GACACAUu 5'
            |||  |   ||:| ||||||| 
Target 5' gcCCTTCCCCACCGGACTGTGTAt 3'
 122 - 145 149.00 -15.90
2 
miRNA  3' acggagacaggUC-GACACAuu 5'
                     || ||||||  
Target 5' ggtatgcaaaaAGTCTGTGTtc 3'
 212 - 233 122.00 -10.03
3 
miRNA  3' acgGAGACAGGUCGACACAUu 5'
             |||| |: | ||| ||| 
Target 5' gagCTCTATTGACCTG-GTAc 3'
 644 - 663 110.00 -7.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20490249 23 COSMIC
COSN20351046 32 COSMIC
COSN31482367 48 COSMIC
COSN31596653 78 COSMIC
COSN22216313 121 COSMIC
COSN30136014 133 COSMIC
COSN22843478 141 COSMIC
COSN1364456 156 COSMIC
COSN9261970 617 COSMIC
COSN9633931 633 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs376953907 4 dbSNP
rs1409309777 5 dbSNP
rs371595233 20 dbSNP
rs1440103828 22 dbSNP
rs1323714671 23 dbSNP
rs748436262 24 dbSNP
rs770009701 25 dbSNP
rs1459425933 26 dbSNP
rs746466106 26 dbSNP
rs777801803 28 dbSNP
rs1252109926 30 dbSNP
rs745700830 32 dbSNP
rs556292374 33 dbSNP
rs775541797 34 dbSNP
rs374425918 35 dbSNP
rs879302835 36 dbSNP
rs1248523654 39 dbSNP
rs1474796450 40 dbSNP
rs768335637 41 dbSNP
rs776272824 43 dbSNP
rs771471821 46 dbSNP
rs1405561139 49 dbSNP
rs761337910 51 dbSNP
rs1166164114 52 dbSNP
rs764952437 53 dbSNP
rs1204342650 55 dbSNP
rs1251046255 57 dbSNP
rs1455125774 60 dbSNP
rs1386248910 62 dbSNP
rs1157894130 63 dbSNP
rs1420631710 64 dbSNP
rs577870677 65 dbSNP
rs951258485 70 dbSNP
rs1263002194 71 dbSNP
rs1188847630 76 dbSNP
rs1376673071 78 dbSNP
rs545243995 87 dbSNP
rs1174908296 89 dbSNP
rs977629097 90 dbSNP
rs924920851 94 dbSNP
rs1369253161 95 dbSNP
rs969216082 98 dbSNP
rs933313428 105 dbSNP
rs1429748626 107 dbSNP
rs375901508 108 dbSNP
rs980599033 119 dbSNP
rs117603140 123 dbSNP
rs1437219134 128 dbSNP
rs1362720090 130 dbSNP
rs766880543 131 dbSNP
rs191816327 134 dbSNP
rs927400221 135 dbSNP
rs1392419022 136 dbSNP
rs1161134935 137 dbSNP
rs957637590 139 dbSNP
rs943408026 149 dbSNP
rs990088172 156 dbSNP
rs767453916 169 dbSNP
rs1173110056 175 dbSNP
rs1385423564 182 dbSNP
rs1247732557 187 dbSNP
rs913209041 189 dbSNP
rs1037809808 197 dbSNP
rs142963445 203 dbSNP
rs1236605839 217 dbSNP
rs374640411 236 dbSNP
rs898315111 238 dbSNP
rs1253180612 239 dbSNP
rs531400511 240 dbSNP
rs1339992793 246 dbSNP
rs1025976177 256 dbSNP
rs550903756 259 dbSNP
rs887071327 260 dbSNP
rs1332658108 266 dbSNP
rs569385296 267 dbSNP
rs533358210 272 dbSNP
rs1385902121 278 dbSNP
rs912739539 282 dbSNP
rs942875555 283 dbSNP
rs1039898967 284 dbSNP
rs1207790679 288 dbSNP
rs182447049 289 dbSNP
rs369871528 295 dbSNP
rs1174859702 298 dbSNP
rs1207195921 307 dbSNP
rs1035333726 312 dbSNP
rs1198379188 313 dbSNP
rs1376308265 313 dbSNP
rs1252692952 323 dbSNP
rs898225925 323 dbSNP
rs764673929 329 dbSNP
rs150704948 340 dbSNP
rs1046777378 342 dbSNP
rs886750347 342 dbSNP
rs1012600321 347 dbSNP
rs1021358090 348 dbSNP
rs879117598 349 dbSNP
rs1387846455 350 dbSNP
rs1448326579 351 dbSNP
rs1171785522 352 dbSNP
rs1375249955 356 dbSNP
rs1456736800 357 dbSNP
rs1013509983 361 dbSNP
rs533957463 366 dbSNP
rs1024862750 376 dbSNP
rs969659048 384 dbSNP
rs1407417587 387 dbSNP
rs1369456043 390 dbSNP
rs1002039638 398 dbSNP
rs1416685016 401 dbSNP
rs1400428572 402 dbSNP
rs1172379789 403 dbSNP
rs1395662133 410 dbSNP
rs750017537 418 dbSNP
rs749890809 420 dbSNP
rs957492096 423 dbSNP
rs1318755700 424 dbSNP
rs1472276238 431 dbSNP
rs1258352847 435 dbSNP
rs1211421111 436 dbSNP
rs990171936 439 dbSNP
rs760005949 440 dbSNP
rs1296233762 441 dbSNP
rs186808029 441 dbSNP
rs1309123681 442 dbSNP
rs977597799 445 dbSNP
rs1289807800 447 dbSNP
rs567439394 457 dbSNP
rs924774070 458 dbSNP
rs954948658 463 dbSNP
rs1226215526 465 dbSNP
rs1335223385 467 dbSNP
rs1293380105 472 dbSNP
rs1450741252 474 dbSNP
rs1339218772 476 dbSNP
rs140703579 481 dbSNP
rs913240042 486 dbSNP
rs1401621748 488 dbSNP
rs555416426 491 dbSNP
rs1157161787 492 dbSNP
rs1456916234 494 dbSNP
rs987048401 495 dbSNP
rs577816390 497 dbSNP
rs942886349 499 dbSNP
rs192269945 502 dbSNP
rs1235633855 503 dbSNP
rs943375448 506 dbSNP
rs763850902 514 dbSNP
rs1037777936 516 dbSNP
rs920712514 517 dbSNP
rs1039860055 518 dbSNP
rs1328065059 522 dbSNP
rs920059482 528 dbSNP
rs1229537062 529 dbSNP
rs1376395143 530 dbSNP
rs931095206 531 dbSNP
rs1013248793 532 dbSNP
rs1046807252 532 dbSNP
rs375632115 532 dbSNP
rs886780097 532 dbSNP
rs753431745 545 dbSNP
rs1186547387 552 dbSNP
rs1434898959 552 dbSNP
rs1231731438 555 dbSNP
rs931132453 567 dbSNP
rs543610464 580 dbSNP
rs1413192590 585 dbSNP
rs1046384340 587 dbSNP
rs905088128 587 dbSNP
rs1046854832 588 dbSNP
rs554142404 589 dbSNP
rs758725978 591 dbSNP
rs572348679 594 dbSNP
rs879744296 595 dbSNP
rs1463311467 596 dbSNP
rs1157257872 598 dbSNP
rs1388121162 599 dbSNP
rs1431587110 600 dbSNP
rs1020319301 601 dbSNP
rs1290638111 602 dbSNP
rs1377063969 603 dbSNP
rs894130590 611 dbSNP
rs34221783 627 dbSNP
rs1012569545 629 dbSNP
rs1344914478 630 dbSNP
rs1296131523 632 dbSNP
rs1228085125 638 dbSNP
rs866853410 639 dbSNP
rs1372241250 657 dbSNP
rs1021325362 666 dbSNP
rs377726605 668 dbSNP
rs542659635 671 dbSNP
rs1020315068 672 dbSNP
rs1355896813 675 dbSNP
rs1329639174 682 dbSNP
rs1234867245 684 dbSNP
rs1431769034 686 dbSNP
rs1265883774 687 dbSNP
rs1468154299 689 dbSNP
rs1166691149 695 dbSNP
rs1448623844 697 dbSNP
rs1425639506 698 dbSNP
rs1315903172 701 dbSNP
rs1487307314 706 dbSNP
rs1245823744 729 dbSNP
rs999016446 730 dbSNP
rs964339462 732 dbSNP
rs373113534 735 dbSNP
rs1228340624 737 dbSNP
rs920108051 737 dbSNP
rs10092194 750 dbSNP
rs1258776715 762 dbSNP
rs987723987 766 dbSNP
rs1367155841 768 dbSNP
rs543549219 769 dbSNP
rs778207826 772 dbSNP
rs1407532094 774 dbSNP
rs1306057484 775 dbSNP
rs1429069059 777 dbSNP
rs567302268 789 dbSNP
rs973442352 794 dbSNP
rs36107033 796 dbSNP
rs1177947556 797 dbSNP
rs1161540457 798 dbSNP
rs1431291394 800 dbSNP
rs1046050582 801 dbSNP
rs144579109 802 dbSNP
rs867670257 804 dbSNP
rs868131644 809 dbSNP
rs1483873471 811 dbSNP
rs1355964348 815 dbSNP
rs1258347645 817 dbSNP
rs367856231 821 dbSNP
rs908353027 827 dbSNP
rs551658308 833 dbSNP
rs1372343668 836 dbSNP
rs1224038876 845 dbSNP
rs1009354342 846 dbSNP
rs1020350427 848 dbSNP
rs1209462574 850 dbSNP
rs1057039363 854 dbSNP
rs1379795173 865 dbSNP
rs1304550834 872 dbSNP
rs1008237870 881 dbSNP
rs1019629832 884 dbSNP
rs1281682241 886 dbSNP
rs1409056648 895 dbSNP
rs894434779 897 dbSNP
rs1180812155 915 dbSNP
rs796682507 924 dbSNP
rs566842218 925 dbSNP
rs1486900783 935 dbSNP
rs1180679058 936 dbSNP
rs867051844 942 dbSNP
rs1203624750 944 dbSNP
rs1232724029 945 dbSNP
rs964350330 960 dbSNP
rs1012787117 962 dbSNP
rs1470704934 966 dbSNP
rs1179213767 978 dbSNP
rs1267810918 981 dbSNP
rs1042665844 985 dbSNP
rs1323631086 997 dbSNP
rs904208867 1004 dbSNP
rs781123779 1005 dbSNP
rs527948576 1006 dbSNP
rs745981399 1009 dbSNP
rs1320995341 1014 dbSNP
rs1437082825 1016 dbSNP
rs747075217 1016 dbSNP
rs1385992844 1020 dbSNP
rs890617304 1026 dbSNP
rs1457952262 1032 dbSNP
rs548977103 1037 dbSNP
rs1009515265 1038 dbSNP
rs1017868230 1045 dbSNP
rs1423752614 1046 dbSNP
rs567277573 1048 dbSNP
rs964920666 1049 dbSNP
rs1306080710 1050 dbSNP
rs1463852679 1053 dbSNP
rs142705003 1055 dbSNP
rs1247613639 1058 dbSNP
rs550292133 1062 dbSNP
rs908318951 1064 dbSNP
rs1299543991 1068 dbSNP
rs1364980371 1069 dbSNP
rs1027628913 1070 dbSNP
rs950801014 1073 dbSNP
rs949136170 1074 dbSNP
rs1298324362 1075 dbSNP
rs572589965 1078 dbSNP
rs1230301849 1079 dbSNP
rs1362828510 1084 dbSNP
rs982231617 1085 dbSNP
rs571635737 1092 dbSNP
rs926319129 1099 dbSNP
rs1291303818 1112 dbSNP
rs1423521547 1114 dbSNP
rs1391287743 1115 dbSNP
rs1349400288 1128 dbSNP
rs750931279 1140 dbSNP
rs1447990790 1145 dbSNP
rs538855592 1149 dbSNP
rs1389979432 1151 dbSNP
rs983543421 1153 dbSNP
rs928071761 1157 dbSNP
rs1438787110 1158 dbSNP
rs1053748970 1161 dbSNP
rs1207006593 1167 dbSNP
rs1245219341 1172 dbSNP
rs1468155020 1173 dbSNP
rs1194502852 1176 dbSNP
rs1397033329 1177 dbSNP
rs1275239791 1179 dbSNP
rs1207241925 1180 dbSNP
rs1339760700 1184 dbSNP
rs893707422 1186 dbSNP
rs938525096 1188 dbSNP
rs1332454978 1189 dbSNP
rs1298787597 1192 dbSNP
rs1166115899 1196 dbSNP
rs1370655848 1198 dbSNP
rs1310346488 1199 dbSNP
rs992580043 1200 dbSNP
rs915752091 1206 dbSNP
rs948608141 1207 dbSNP
rs1410333207 1208 dbSNP
rs1042970170 1217 dbSNP
rs1173511217 1221 dbSNP
rs890263063 1224 dbSNP
rs1376101027 1226 dbSNP
rs758859288 1227 dbSNP
rs1330560109 1229 dbSNP
rs553981316 1232 dbSNP
rs1472932025 1236 dbSNP
rs1128779 1240 dbSNP
rs1392008962 1248 dbSNP
rs879602554 1252 dbSNP
rs1184174703 1256 dbSNP
rs1439778973 1257 dbSNP
rs1482043029 1260 dbSNP
rs1041491309 1265 dbSNP
rs1200784806 1268 dbSNP
rs572379302 1277 dbSNP
rs997250673 1278 dbSNP
rs1222556221 1280 dbSNP
rs934352890 1284 dbSNP
rs751968586 1285 dbSNP
rs1432213704 1293 dbSNP
rs1052867150 1305 dbSNP
rs890242822 1313 dbSNP
rs1335683726 1325 dbSNP
rs1004436969 1330 dbSNP
rs1216699505 1332 dbSNP
rs1288261271 1338 dbSNP
rs1015775953 1340 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 80139.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 80139.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000331569.4 | 3UTR | UAUUUAUUUACUAUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000331569.4 | 3UTR | UAUUUAUUUACUAUAAUGUUAGCUUACAAGCUGGGAAUAUAAGUGCAUUAACGGCCCACAUGAGUCAAUGGUAUGCAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000331569.4 | 3UTR | UAUUUAUUUACUAUAAUGUUAGCUUACAAGCUGGGAAUAUAAGUGCAUUAACGGCCCACAUGAGUCAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000331569.4 | 3UTR | UAUUUAUUUACUAUAAUGUUAGCUUACAAGCUGGGAAUAUAAGUGCAUUAACGGCCCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000331569.4 | 3UTR | UGUAUUUAUUUACUAUAAUGUUAGCUUACAAGCUGGGAAUAUAAGUGCAUUAACGGCCCACAUGAGUCAAUGGUAUGCAAAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000331569.4 | 3UTR | GUGUAUUUAUUUACUAUAAUGUUAGCUUACAAGCUGGGAAUAUAAGUGCAUUAACGGCCCACAUGAGUCAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
126 hsa-miR-4672 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT060585 CCND1 cyclin D1 2 2
MIRT063968 ZNF678 zinc finger protein 678 2 2
MIRT078062 PCTP phosphatidylcholine transfer protein 2 2
MIRT084370 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT095611 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT096511 BRIX1 BRX1, biogenesis of ribosomes 2 4
MIRT121793 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT129470 CHEK1 checkpoint kinase 1 2 4
MIRT149009 PKN2 protein kinase N2 2 2
MIRT169592 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT177382 WAC WW domain containing adaptor with coiled-coil 2 4
MIRT214659 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 2 2
MIRT322680 BAG4 BCL2 associated athanogene 4 2 4
MIRT332490 CD81 CD81 molecule 2 6
MIRT338986 CPSF6 cleavage and polyadenylation specific factor 6 2 2
MIRT353814 PCBP1 poly(rC) binding protein 1 2 2
MIRT449368 ANTXR2 anthrax toxin receptor 2 2 2
MIRT459867 KIAA1191 KIAA1191 2 2
MIRT466272 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT467049 SRSF1 serine and arginine rich splicing factor 1 2 4
MIRT469925 PTPRJ protein tyrosine phosphatase, receptor type J 2 6
MIRT470361 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT471076 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 2 2
MIRT472472 NAP1L1 nucleosome assembly protein 1 like 1 2 4
MIRT478137 DHX33 DEAH-box helicase 33 2 2
MIRT479414 CDKN1B cyclin dependent kinase inhibitor 1B 2 4
MIRT496523 ID2 inhibitor of DNA binding 2, HLH protein 2 2
MIRT510371 ZNF703 zinc finger protein 703 2 6
MIRT512861 TESK2 testis-specific kinase 2 2 2
MIRT512974 PPP1R14C protein phosphatase 1 regulatory inhibitor subunit 14C 2 4
MIRT513313 ASB6 ankyrin repeat and SOCS box containing 6 2 4
MIRT521882 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 2 4
MIRT522184 NR2C2 nuclear receptor subfamily 2 group C member 2 2 4
MIRT528381 TRAF3IP1 TRAF3 interacting protein 1 2 2
MIRT532412 ART4 ADP-ribosyltransferase 4 (Dombrock blood group) 2 2
MIRT533027 ZBTB5 zinc finger and BTB domain containing 5 2 2
MIRT533438 TRPC5 transient receptor potential cation channel subfamily C member 5 2 2
MIRT533919 TATDN2 TatD DNase domain containing 2 2 2
MIRT537568 ESYT2 extended synaptotagmin 2 2 2
MIRT538955 BMP2K BMP2 inducible kinase 2 2
MIRT539042 ATXN1L ataxin 1 like 2 4
MIRT539626 CD19 CD19 molecule 2 8
MIRT545720 SPTLC2 serine palmitoyltransferase long chain base subunit 2 2 2
MIRT546013 WDR26 WD repeat domain 26 2 4
MIRT549703 RBM23 RNA binding motif protein 23 2 4
MIRT551162 UBTF upstream binding transcription factor, RNA polymerase I 2 4
MIRT552078 MESDC2 mesoderm development LRP chaperone 2 4
MIRT552530 ZIC5 Zic family member 5 2 2
MIRT552670 YY1 YY1 transcription factor 2 4
MIRT554225 SLC24A2 solute carrier family 24 member 2 2 2
MIRT554356 SFXN5 sideroflexin 5 2 4
MIRT555279 PPTC7 PTC7 protein phosphatase homolog 2 4
MIRT555642 PHF13 PHD finger protein 13 2 2
MIRT558365 DIDO1 death inducer-obliterator 1 2 4
MIRT558630 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT559238 BEND4 BEN domain containing 4 2 2
MIRT559556 ARF6 ADP ribosylation factor 6 2 2
MIRT561686 RAB1A RAB1A, member RAS oncogene family 2 2
MIRT562668 ANKRD40 ankyrin repeat domain 40 2 2
MIRT565689 SESN3 sestrin 3 2 2
MIRT566238 PTBP3 polypyrimidine tract binding protein 3 2 2
MIRT567699 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT573858 C9orf78 chromosome 9 open reading frame 78 2 2
MIRT574156 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT575869 Kif5c kinesin family member 5C 2 3
MIRT576180 Muc15 mucin 15 2 5
MIRT606886 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 2 6
MIRT606908 ZBTB20 zinc finger and BTB domain containing 20 2 4
MIRT606914 MUC15 mucin 15, cell surface associated 2 7
MIRT607250 FAM216B family with sequence similarity 216 member B 2 4
MIRT607562 KIF5C kinesin family member 5C 2 3
MIRT609075 SMIM15 small integral membrane protein 15 2 6
MIRT609160 ZNF415 zinc finger protein 415 2 4
MIRT609360 ACOT2 acyl-CoA thioesterase 2 2 2
MIRT609799 ZDHHC17 zinc finger DHHC-type containing 17 2 2
MIRT610368 GRIPAP1 GRIP1 associated protein 1 2 2
MIRT611341 KIAA2018 upstream transcription factor family member 3 2 4
MIRT611732 PRSS23 protease, serine 23 2 4
MIRT611826 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT611906 NNT nicotinamide nucleotide transhydrogenase 2 2
MIRT612377 TFCP2 transcription factor CP2 2 4
MIRT613482 LYRM7 LYR motif containing 7 2 2
MIRT613641 DUSP18 dual specificity phosphatase 18 2 4
MIRT613822 LANCL3 LanC like 3 2 4
MIRT613863 CBY3 chibby family member 3 2 4
MIRT613871 TMEM51 transmembrane protein 51 2 2
MIRT614688 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT615044 DCP2 decapping mRNA 2 2 2
MIRT616872 ARPC1B actin related protein 2/3 complex subunit 1B 2 4
MIRT617012 C16orf52 chromosome 16 open reading frame 52 2 2
MIRT618524 CCDC174 coiled-coil domain containing 174 2 2
MIRT621827 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT622108 SPRY4 sprouty RTK signaling antagonist 4 2 6
MIRT623111 NFATC2 nuclear factor of activated T-cells 2 2 2
MIRT626102 GNAI1 G protein subunit alpha i1 2 4
MIRT626416 ASAP2 ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 2 2
MIRT627656 RTF1 RTF1 homolog, Paf1/RNA polymerase II complex component 2 2
MIRT628333 CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion 2 2
MIRT629334 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 2 2
MIRT630426 LMX1A LIM homeobox transcription factor 1 alpha 2 2
MIRT630707 GDNF glial cell derived neurotrophic factor 2 2
MIRT632568 POLQ DNA polymerase theta 2 2
MIRT632798 KIAA2022 neurite extension and migration factor 2 2
MIRT634125 ZDHHC21 zinc finger DHHC-type containing 21 2 4
MIRT634299 SP1 Sp1 transcription factor 2 2
MIRT634406 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT636827 FSIP2 fibrous sheath interacting protein 2 2 2
MIRT638270 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT643060 CCDC149 coiled-coil domain containing 149 2 2
MIRT646160 SLC22A1 solute carrier family 22 member 1 2 2
MIRT648243 AGAP1 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 2 2
MIRT663402 SYT17 synaptotagmin 17 2 6
MIRT666042 STON2 stonin 2 2 2
MIRT670698 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT672337 TMEM79 transmembrane protein 79 2 4
MIRT672628 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT685229 F2RL1 F2R like trypsin receptor 1 2 2
MIRT693225 KIAA0907 KIAA0907 2 4
MIRT696142 RAB11FIP3 RAB11 family interacting protein 3 2 2
MIRT697908 TXNRD1 thioredoxin reductase 1 2 2
MIRT705315 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT712264 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT714080 ZNF532 zinc finger protein 532 2 2
MIRT715104 SORBS3 sorbin and SH3 domain containing 3 2 2
MIRT722237 RBM41 RNA binding motif protein 41 2 2
MIRT725113 SYNRG synergin gamma 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4672 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4672 Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-4672 Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-mir-4672 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-4672 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-4672 Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-4672 Oxaliplatin 6857599 NSC266046 approved sensitive cell line (HCT116)
hsa-miR-4672 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-4672 Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4672 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4672 Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-4672 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4672 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission