pre-miRNA Information
pre-miRNA hsa-mir-605   
Genomic Coordinates chr10: 51299573 - 51299655
Synonyms MIRN605, hsa-mir-605, MIR605
Description Homo sapiens miR-605 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-605-3p
Sequence 51| AGAAGGCACUAUGAGAUUUAGA |72
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 10 + 51299626 27587585, 28550310, 26028588, 26449202, 26487287, 29165639 MiREDiBase
A-to-I 14 10 + 51299636 29233923 MiREDiBase
A-to-I 20 10 + 51299642 18684997, 26449202, 27587585, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs759219082 5 dbSNP
rs1491224174 9 dbSNP
rs746611214 10 dbSNP
rs367648737 11 dbSNP
rs1359467239 14 dbSNP
rs1442565019 16 dbSNP
Putative Targets

Gene Information
Gene Symbol SRM   
Synonyms PAPT, SPDSY, SPS1, SRML1
Description spermidine synthase
Transcript NM_003132   
Expression
Putative miRNA Targets on SRM
3'UTR of SRM
(miRNA target sites are highlighted)
>SRM|NM_003132|3'UTR
   1 GCCCAGGCGCCACCACTGATGCCACCCAGGACCTCGGACCTTGGAGCCTGCGGGGTGCCTCGGCCCCTCCAGCCCCGGGC
  81 CGGACCTCCTGCTGGCTCTCGCCCACCAACCAAGTGTTACAAGCCCCAGAATGCTGCCCGGCCTGCCCTGCTGGGCGGAC
 161 TGTCTGTGTGTCTGTCTCTCTGGCGTTCCACCTCCAAGCCTATACCAGCTGTGTACAGCGCCATCTCTCTGCCTTCTGTT
 241 GCCCCTCACTCACCAAACACGTGTATTTATAGC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agauuUAGAGUAUCACGGAAGa 5'
               ||||| |  ||||||| 
Target 5' gcgccATCTC-T-CTGCCTTCt 3'
218 - 237 151.00 -15.20
2
miRNA  3' agaUUUAGA-GUAUCACGGAaga 5'
             :|: || |: :||||||   
Target 5' ttgGAGCCTGCGGGGTGCCTcgg 3'
41 - 63 115.00 -11.32
3
miRNA  3' agaUUUAGAGUAUCACGGA-AGa 5'
             :| | ||   |||:|| || 
Target 5' gcgGACTGTCTGTGTGTCTGTCt 3'
155 - 177 103.00 -9.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN18725161 29 COSMIC
COSN26996806 33 COSMIC
COSN30459520 48 COSMIC
COSN30160263 100 COSMIC
COSN31553433 134 COSMIC
COSN31540273 184 COSMIC
COSN20090135 245 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs372768637 4 dbSNP
rs199584135 8 dbSNP
rs561470319 9 dbSNP
rs1239098464 19 dbSNP
rs200634815 26 dbSNP
rs1178635287 28 dbSNP
rs1023504192 29 dbSNP
rs760368225 31 dbSNP
rs1231839766 33 dbSNP
rs373195872 35 dbSNP
rs767916198 35 dbSNP
rs752315747 36 dbSNP
rs1279636146 37 dbSNP
rs774308445 38 dbSNP
rs1340260865 41 dbSNP
rs1278204097 42 dbSNP
rs994177220 42 dbSNP
rs1456813332 43 dbSNP
rs768531929 44 dbSNP
rs749132015 47 dbSNP
rs77467436 51 dbSNP
rs560721204 52 dbSNP
rs545726135 53 dbSNP
rs1301759517 57 dbSNP
rs370155069 61 dbSNP
rs375761503 62 dbSNP
rs1437004407 63 dbSNP
rs1256135191 72 dbSNP
rs1205452947 73 dbSNP
rs867521702 76 dbSNP
rs1007503726 77 dbSNP
rs578193046 80 dbSNP
rs1310477391 82 dbSNP
rs1437145999 85 dbSNP
rs556816452 94 dbSNP
rs371576741 100 dbSNP
rs1043724420 101 dbSNP
rs1280352508 102 dbSNP
rs1442005344 106 dbSNP
rs947680481 109 dbSNP
rs1339311935 114 dbSNP
rs1470566169 120 dbSNP
rs912873426 133 dbSNP
rs1052780213 139 dbSNP
rs1256564371 140 dbSNP
rs938372508 145 dbSNP
rs1203713163 152 dbSNP
rs928409430 154 dbSNP
rs576041008 156 dbSNP
rs868152423 157 dbSNP
rs956578375 160 dbSNP
rs1175003898 162 dbSNP
rs1418041131 168 dbSNP
rs927693010 170 dbSNP
rs1397312225 172 dbSNP
rs1412257212 172 dbSNP
rs982430840 173 dbSNP
rs1298164697 178 dbSNP
rs752702385 182 dbSNP
rs969362735 184 dbSNP
rs983938338 185 dbSNP
rs554689439 196 dbSNP
rs1416005671 205 dbSNP
rs565375968 212 dbSNP
rs985090633 215 dbSNP
rs1249900157 219 dbSNP
rs950642423 220 dbSNP
rs901160851 227 dbSNP
rs1025559351 229 dbSNP
rs1259780453 232 dbSNP
rs1019639596 243 dbSNP
rs1461670581 244 dbSNP
rs147068029 256 dbSNP
rs547247009 260 dbSNP
rs1020146134 261 dbSNP
rs1318795742 264 dbSNP
rs1043216058 265 dbSNP
rs1305600674 265 dbSNP
rs1390188478 265 dbSNP
rs1332592659 272 dbSNP
rs947542876 274 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' agauuUAGAGUAUCACGGAAGa 5'
               ||||| |  ||||||| 
Target 5' ---ccAUCUC-U-CUGCCUUCu 3'
1 - 17
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 6723.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 6723.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000376957.2 | 3UTR | CCAUCUCUCUGCCUUCUGUUGCCCCUCACUCACCAAACACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000376957.2 | 3UTR | CCAUCUCUCUGCCUUCUGUUGCCCCUCACUCACCAAACACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000376957.2 | 3UTR | CCAUCUCUCUGCCUUCUGUUGCCCCUCACUCACCAAACACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000376957.2 | 3UTR | CCAUCUCUCUGCCUUCUGUUGCCCCUCACUCACCAAACACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714647
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repB
Location of target site ENST00000376957.2 | 3UTR | UCUCUCUGCCUUCUGUUGCCCCUCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000376957.2 | 3UTR | CCAUCUCUCUGCCUUCUGUUGCCCCUCACUCACCAAACACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
100 hsa-miR-605-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT061339 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT061584 BTG2 BTG anti-proliferation factor 2 2 6
MIRT076140 WDR81 WD repeat domain 81 2 2
MIRT079361 CCDC137 coiled-coil domain containing 137 2 2
MIRT079547 VAMP3 vesicle associated membrane protein 3 2 2
MIRT096242 CANX calnexin 2 2
MIRT243877 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT249186 AKIRIN1 akirin 1 2 8
MIRT273604 SP1 Sp1 transcription factor 2 2
MIRT316766 FOXC1 forkhead box C1 2 4
MIRT322410 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT370117 TRIB3 tribbles pseudokinase 3 2 2
MIRT392725 UBN2 ubinuclein 2 2 2
MIRT406910 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT407440 CTDSP1 CTD small phosphatase 1 2 2
MIRT441887 RD3 retinal degeneration 3 2 4
MIRT444979 C15orf52 chromosome 15 open reading frame 52 2 2
MIRT445241 FOXD4 forkhead box D4 2 2
MIRT445500 FOXD4L5 forkhead box D4 like 5 2 2
MIRT445503 FOXD4L4 forkhead box D4 like 4 2 2
MIRT447025 FOXD4L1 forkhead box D4 like 1 2 2
MIRT447743 TMCC3 transmembrane and coiled-coil domain family 3 2 2
MIRT448761 HDX highly divergent homeobox 2 2
MIRT450003 HAX1 HCLS1 associated protein X-1 2 2
MIRT452830 FAM131B family with sequence similarity 131 member B 2 2
MIRT452872 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT453506 ARRB1 arrestin beta 1 2 2
MIRT454169 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT458742 CES2 carboxylesterase 2 2 2
MIRT459166 HSPA6 heat shock protein family A (Hsp70) member 6 2 21
MIRT460246 IL17RB interleukin 17 receptor B 2 4
MIRT460514 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT460698 RNF157 ring finger protein 157 2 2
MIRT461481 METTL1 methyltransferase like 1 2 2
MIRT462617 C20orf27 chromosome 20 open reading frame 27 2 4
MIRT463233 ZNF131 zinc finger protein 131 2 2
MIRT465699 TNPO2 transportin 2 2 8
MIRT466304 TIMM22 translocase of inner mitochondrial membrane 22 2 2
MIRT468957 RPS14 ribosomal protein S14 2 6
MIRT469571 RARA retinoic acid receptor alpha 2 2
MIRT469685 RAB5B RAB5B, member RAS oncogene family 2 2
MIRT470800 PMP22 peripheral myelin protein 22 2 2
MIRT471649 PANK2 pantothenate kinase 2 2 4
MIRT471722 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT472281 NFIB nuclear factor I B 2 4
MIRT473680 MAPKBP1 mitogen-activated protein kinase binding protein 1 2 2
MIRT475859 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT477326 EPHA2 EPH receptor A2 2 2
MIRT477831 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478572 CTNND1 catenin delta 1 2 4
MIRT479634 CD81 CD81 molecule 2 2
MIRT481950 ANKRD11 ankyrin repeat domain 11 2 2
MIRT483696 ZNF74 zinc finger protein 74 2 6
MIRT488798 MALT1 MALT1 paracaspase 2 2
MIRT489066 STARD3 StAR related lipid transfer domain containing 3 2 2
MIRT492533 PSMD11 proteasome 26S subunit, non-ATPase 11 2 2
MIRT492857 NRARP NOTCH regulated ankyrin repeat protein 2 2
MIRT496793 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT500122 ZNF106 zinc finger protein 106 2 4
MIRT505359 TMEM167A transmembrane protein 167A 2 2
MIRT506786 KLHL15 kelch like family member 15 2 6
MIRT510692 SRM spermidine synthase 2 6
MIRT515841 CEP104 centrosomal protein 104 2 4
MIRT516448 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 2 4
MIRT528855 PKP1 plakophilin 1 2 2
MIRT533848 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT539025 ATXN7L1 ataxin 7 like 1 2 4
MIRT542872 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT546543 SATB2 SATB homeobox 2 2 2
MIRT554114 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 2
MIRT560569 ZNF460 zinc finger protein 460 2 2
MIRT560796 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT562836 GCFC2 GC-rich sequence DNA-binding factor 2 2 2
MIRT563109 IFRD2 interferon related developmental regulator 2 2 2
MIRT564177 MRPL49 mitochondrial ribosomal protein L49 2 2
MIRT564283 ASB1 ankyrin repeat and SOCS box containing 1 2 2
MIRT564350 USP22 ubiquitin specific peptidase 22 2 2
MIRT565279 TNFRSF21 TNF receptor superfamily member 21 2 2
MIRT565338 TMEM104 transmembrane protein 104 2 2
MIRT565905 SCAMP2 secretory carrier membrane protein 2 2 2
MIRT567108 ITGB1 integrin subunit beta 1 2 2
MIRT567601 FANCF Fanconi anemia complementation group F 2 2
MIRT567779 DGAT2 diacylglycerol O-acyltransferase 2 2 2
MIRT568075 CENPQ centromere protein Q 2 2
MIRT624304 COL12A1 collagen type XII alpha 1 chain 2 2
MIRT644395 CDKL1 cyclin dependent kinase like 1 2 2
MIRT661547 ZNF674 zinc finger protein 674 2 4
MIRT670949 IRAK3 interleukin 1 receptor associated kinase 3 2 2
MIRT672951 AKAP5 A-kinase anchoring protein 5 2 2
MIRT697426 ZFP36 ZFP36 ring finger protein 2 2
MIRT700793 PIAS2 protein inhibitor of activated STAT 2 2 2
MIRT702657 ITGA3 integrin subunit alpha 3 2 2
MIRT708945 FZR1 fizzy and cell division cycle 20 related 1 2 2
MIRT713657 PLCE1 phospholipase C epsilon 1 2 2
MIRT719239 CYSLTR2 cysteinyl leukotriene receptor 2 2 2
MIRT719951 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT722048 HLA-E major histocompatibility complex, class I, E 2 2
MIRT722201 URM1 ubiquitin related modifier 1 2 2
MIRT724790 C1D C1D nuclear receptor corepressor 2 2
MIRT734347 CYP2B6 cytochrome P450 family 2 subfamily B member 6 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-605 Anthranilamide-pyrazolo[1,5-a]pyrimidine NULL NULL Quantitative real-time PCR neuroblastoma cells 23992861 2013 up-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-605 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-605 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-605 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-605 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-605-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)

Error report submission