miRTarBase - #MIRT510730


—
pre-miRNA Information
pre-miRNA hsa-mir-7849   
Genomic Coordinates chr4: 146408583 - 146408688
Description Homo sapiens miR-7849 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7849-3p
Sequence 64| GACAAUUGUUGAUCUUGGGCCU |85
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1386078731 3 dbSNP
rs144001291 10 dbSNP
rs1334425573 16 dbSNP
rs557644637 20 dbSNP
Putative Targets

Gene Information
Gene Symbol SON   
Synonyms BASS1, C21orf50, DBP-5, NREBP, SON3, TOKIMS
Description SON DNA binding protein
Transcript NM_138927   
Other Transcripts NM_032195   
Expression
Putative miRNA Targets on SON
3'UTR of SON
(miRNA target sites are highlighted)		 
>SON|NM_138927|3'UTR
   1 TAAATGGAAGCGCTTACCAGCCCAGCTTTGCCAGCCCTAATAAGAAGCATGCTAAAGCCACAGCAGCTACTGTGGTTCTT
  81 CAAGCAATGGGCCTTGTACCAAAGGACCTCATGGCTAATGCCACTTGCTTCAGGAGTGCCTCACGTAGATAGATTGAGGT
 161 TTTATAATAATCATTTCAGAATTTTACTCTGCATCACAATGTATTTCCTCTTTAATGTTGTAAATATTTGGCAATTTAAG
 241 ACATTGTGTAAAAAGCAATCTGTAAAAACATCTCCAGGCTTTGATTTTTGTACCATGGAAATTGTATTTAACCATACAGG
 321 GTTTTGGTATGTTTATATTGTTTACCTTAGTGATGTATTTGTTTAAGTGGCTAACATCCAAACGACTGTTTGAAGGCATC
 401 AGAGTAATCTTCAGTGTGGAATGTTAAATAACGCTTTTATACTGTATTTTGTACTATGATGTAACTCCCCTTCCTTATGG
 481 CTAGGCTACTGTAACACTTGCCTGTAATCAGTGAAGGGCTGTGCACCTTGTACTATTTCACAATGGGTTCTGCTGGACAG
 561 ATAATGGGCCAGTGTTATTGAGGTGATCAAGATCTGTTCCACAGGGCTAATGCCACCATCTCCCCTCAAAATTTTGTAGA
 641 GGTTCTAAAAAGAAAGTGGTATGTTGTGTGATGATCAGCACTAAGTCCTGCATTCCTGTTAAAGCCACTTGGGTCATAAG
 721 AAGGGAGTAAAAAATGAAGTCTGACTAGAATTCTATTGCAGAGGCCAAGTACATTTAGTATGGCATTGAGTTGTGATATA
 801 GTTTTACTTTGATGTGCATTTTGAATTTCAGCTACACCTAGATAGACGTAAAATGATAATTAAAATGCTGTAACCAACTT
 881 ATCTAATAAAATTGGCAACCAGCCACTATTTTGTTGACTATGAGAAAGTTAAAAGTTTATGTTAATTTTTAGGGTCTGAT
 961 AGAATATTTCATGTGTATTACAGTGGTATTCATATGCTATGTCTCTAAACTTTATTTTCAAAAGCTTAAGGCCCAAATAC
1041 AAACTTCTCTGGAATAAACGTGGTGTTTTATTTTCTGGGTTATAAAGTGAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucCGGGUUCUAG--UUGUUAACAg 5'
            | |:|| |||  |||:| ||| 
Target 5' gtGGCTAACATCCAAACGACTGTt 3'
 367 - 390 122.00 -8.96
2 
miRNA  3' uccggguucuaguugUUAACAg 5'
                         |||||| 
Target 5' tttttgtaccatggaAATTGTa 3'
 285 - 306 120.00 -6.00
3 
miRNA  3' ucCGGGUUCUA----GUUGUUAACag 5'
            | |:|:| |    :|||| |||  
Target 5' atGGCTAGGCTACTGTAACACTTGcc 3'
 477 - 502 106.00 -10.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26573143 7 COSMIC
COSN30706709 13 COSMIC
COSN30121868 25 COSMIC
COSN30129692 36 COSMIC
COSN27006967 65 COSMIC
COSN9157164 65 COSMIC
COSN27006968 116 COSMIC
COSN1083078 126 COSMIC
COSN31492504 132 COSMIC
COSN31486687 145 COSMIC
COSN16269430 170 COSMIC
COSN16131579 190 COSMIC
COSN31545011 347 COSMIC
COSN31543305 353 COSMIC
COSN30541092 406 COSMIC
COSN10025855 605 COSMIC
COSN30174202 621 COSMIC
COSN20116848 768 COSMIC
COSN30540614 1024 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs73368009 2 dbSNP
rs1439218814 11 dbSNP
rs759482708 12 dbSNP
rs76429599 13 dbSNP
rs1217603314 26 dbSNP
rs775947529 75 dbSNP
rs948701702 84 dbSNP
rs1284948275 87 dbSNP
rs767234874 94 dbSNP
rs545711313 96 dbSNP
rs755909685 97 dbSNP
rs1298809919 99 dbSNP
rs564002568 104 dbSNP
rs1413481406 108 dbSNP
rs753464324 113 dbSNP
rs1224064656 116 dbSNP
rs756777793 117 dbSNP
rs1256037277 124 dbSNP
rs778576403 125 dbSNP
rs1366744692 133 dbSNP
rs747450046 137 dbSNP
rs1293042251 145 dbSNP
rs1306556046 146 dbSNP
rs1044410835 155 dbSNP
rs1227591515 164 dbSNP
rs1276171614 167 dbSNP
rs1484364975 168 dbSNP
rs769279227 170 dbSNP
rs781778483 172 dbSNP
rs748525732 174 dbSNP
rs770098618 175 dbSNP
rs764882230 180 dbSNP
rs773447937 181 dbSNP
rs1417714761 186 dbSNP
rs188609379 190 dbSNP
rs1171320313 192 dbSNP
rs1392138698 193 dbSNP
rs191712363 196 dbSNP
rs770940184 199 dbSNP
rs1376558225 200 dbSNP
rs1450713334 202 dbSNP
rs1334208870 207 dbSNP
rs1360435983 218 dbSNP
rs1011769596 228 dbSNP
rs1197689680 235 dbSNP
rs1456132880 237 dbSNP
rs1417123328 243 dbSNP
rs1021354070 245 dbSNP
rs953782448 246 dbSNP
rs1311558605 249 dbSNP
rs1276864630 252 dbSNP
rs184048098 253 dbSNP
rs1310057262 258 dbSNP
rs1446336889 270 dbSNP
rs1219624721 279 dbSNP
rs1398294790 285 dbSNP
rs1339140756 297 dbSNP
rs1272355282 304 dbSNP
rs1466919807 308 dbSNP
rs1358916490 318 dbSNP
rs1343099226 323 dbSNP
rs1019272545 330 dbSNP
rs1402941695 339 dbSNP
rs965453812 344 dbSNP
rs972665705 358 dbSNP
rs1437472983 384 dbSNP
rs1244550988 385 dbSNP
rs146483317 389 dbSNP
rs1482825990 392 dbSNP
rs1254020264 398 dbSNP
rs879219409 401 dbSNP
rs1486711887 403 dbSNP
rs1214273516 404 dbSNP
rs768357927 409 dbSNP
rs1286831091 421 dbSNP
rs1239465864 425 dbSNP
rs777032414 427 dbSNP
rs1317479653 429 dbSNP
rs1478140383 433 dbSNP
rs1378977475 434 dbSNP
rs1301404980 440 dbSNP
rs1455811808 449 dbSNP
rs1361692727 453 dbSNP
rs1195051139 470 dbSNP
rs1417380735 471 dbSNP
rs548352934 472 dbSNP
rs1375756855 476 dbSNP
rs149075032 479 dbSNP
rs1253831636 482 dbSNP
rs1349610196 485 dbSNP
rs1187974626 489 dbSNP
rs1172819961 493 dbSNP
rs1488593680 498 dbSNP
rs1262326286 505 dbSNP
rs1351685707 506 dbSNP
rs948834933 506 dbSNP
rs1294027321 507 dbSNP
rs1044914637 515 dbSNP
rs1321280941 516 dbSNP
rs928639477 519 dbSNP
rs143710156 525 dbSNP
rs1053340311 526 dbSNP
rs1297110008 533 dbSNP
rs1398685577 534 dbSNP
rs552921665 544 dbSNP
rs1293542035 545 dbSNP
rs1383310159 548 dbSNP
rs1320669828 573 dbSNP
rs1011715704 574 dbSNP
rs1043248912 575 dbSNP
rs1478053697 577 dbSNP
rs889988338 579 dbSNP
rs571197870 580 dbSNP
rs1006636016 583 dbSNP
rs1490804132 586 dbSNP
rs1019814548 589 dbSNP
rs1232754010 590 dbSNP
rs377261139 595 dbSNP
rs1263953616 597 dbSNP
rs900820349 608 dbSNP
rs1220667402 625 dbSNP
rs1275666068 628 dbSNP
rs1350069473 630 dbSNP
rs1238034473 635 dbSNP
rs1285484200 637 dbSNP
rs716 644 dbSNP
rs1277944479 647 dbSNP
rs1488558318 649 dbSNP
rs1323678880 653 dbSNP
rs1347863805 653 dbSNP
rs1385683349 658 dbSNP
rs1206876197 660 dbSNP
rs994259639 661 dbSNP
rs1465806385 667 dbSNP
rs1025488813 668 dbSNP
rs1168191104 669 dbSNP
rs1378087009 676 dbSNP
rs1481396650 676 dbSNP
rs1198057868 677 dbSNP
rs1432719245 682 dbSNP
rs1264938732 683 dbSNP
rs952639955 685 dbSNP
rs372386999 691 dbSNP
rs1257823912 693 dbSNP
rs1458337032 693 dbSNP
rs775938201 697 dbSNP
rs1347777341 704 dbSNP
rs1276011161 705 dbSNP
rs528775546 707 dbSNP
rs1023423033 708 dbSNP
rs969655596 714 dbSNP
rs1254478992 716 dbSNP
rs544306095 717 dbSNP
rs1375647526 718 dbSNP
rs1329077451 733 dbSNP
rs1470863883 744 dbSNP
rs1437509671 756 dbSNP
rs1157500568 757 dbSNP
rs1380434882 763 dbSNP
rs1171999141 765 dbSNP
rs201327991 767 dbSNP
rs398036380 767 dbSNP
rs71194852 767 dbSNP
rs377733624 769 dbSNP
rs1180510228 773 dbSNP
rs1440580559 781 dbSNP
rs1237743574 783 dbSNP
rs567957331 786 dbSNP
rs117504263 790 dbSNP
rs1388939253 795 dbSNP
rs1444534266 799 dbSNP
rs1279778790 818 dbSNP
rs556749490 832 dbSNP
rs1343404850 833 dbSNP
rs568724860 837 dbSNP
rs1240176750 838 dbSNP
rs988816636 838 dbSNP
rs1444892377 843 dbSNP
rs1306678003 845 dbSNP
rs539280674 847 dbSNP
rs947612755 848 dbSNP
rs761586316 860 dbSNP
rs889950116 876 dbSNP
rs1387001704 877 dbSNP
rs942889337 878 dbSNP
rs1160557493 880 dbSNP
rs557506569 882 dbSNP
rs572846891 886 dbSNP
rs372958112 898 dbSNP
rs1473865387 901 dbSNP
rs763163146 905 dbSNP
rs188943648 907 dbSNP
rs1441213337 913 dbSNP
rs1217947949 918 dbSNP
rs900933717 918 dbSNP
rs553341333 919 dbSNP
rs1254707357 920 dbSNP
rs56320855 921 dbSNP
rs993761570 929 dbSNP
rs1283416497 932 dbSNP
rs1456158820 934 dbSNP
rs574696119 946 dbSNP
rs1025268544 956 dbSNP
rs1342119175 956 dbSNP
rs888151880 960 dbSNP
rs1399320835 964 dbSNP
rs1005417502 977 dbSNP
rs1238213431 981 dbSNP
rs1316229184 988 dbSNP
rs1023531131 997 dbSNP
rs1162865395 999 dbSNP
rs1414739685 999 dbSNP
rs969225716 1001 dbSNP
rs1426223398 1005 dbSNP
rs1184523262 1008 dbSNP
rs1488219386 1011 dbSNP
rs1367219133 1030 dbSNP
rs1457899262 1034 dbSNP
rs1166066530 1042 dbSNP
rs764731922 1052 dbSNP
rs1223080212 1054 dbSNP
rs3178051 1055 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 6651.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 6651.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000290239.6 | 3UTR | UAUUUAACCAUACAGGGUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000290239.6 | 3UTR | UAUUUAACCAUACAGGGUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000290239.6 | 3UTR | UAUUUAACCAUACAGGGUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000290239.6 | 3UTR | UAUUUAACCAUACAGGGUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000290239.6 | 3UTR | GUAUUUAACCAUACAGGGUUUUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000290239.6 | 3UTR | UAUUUAACCAUACAGGGUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000290239.6 | 3UTR | UAUUUAACCAUACAGGGUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
69 hsa-miR-7849-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT062192 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT064755 CCND2 cyclin D2 2 8
MIRT076594 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT086027 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT091394 EIF4A2 eukaryotic translation initiation factor 4A2 2 2
MIRT104730 KLF10 Kruppel like factor 10 2 2
MIRT105345 SLC7A2 solute carrier family 7 member 2 2 2
MIRT105672 PNMA2 paraneoplastic Ma antigen 2 2 6
MIRT173218 TMEM64 transmembrane protein 64 2 2
MIRT228305 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT229503 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT243387 SKIL SKI like proto-oncogene 2 2
MIRT257404 E2F3 E2F transcription factor 3 2 2
MIRT301069 SLC16A14 solute carrier family 16 member 14 2 4
MIRT307327 CTNNB1 catenin beta 1 2 2
MIRT443182 DENND4C DENN domain containing 4C 2 2
MIRT469272 RHOB ras homolog family member B 2 8
MIRT475106 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 4
MIRT484134 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT491117 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 4
MIRT504856 HAUS3 HAUS augmin like complex subunit 3 2 4
MIRT505544 SNX16 sorting nexin 16 2 6
MIRT506752 LCOR ligand dependent nuclear receptor corepressor 2 8
MIRT507358 FAM129A family with sequence similarity 129 member A 2 6
MIRT507812 CDK6 cyclin dependent kinase 6 2 6
MIRT510730 SON SON DNA binding protein 2 6
MIRT521296 RRAGD Ras related GTP binding D 2 4
MIRT521371 RNF11 ring finger protein 11 2 6
MIRT525860 ARL13B ADP ribosylation factor like GTPase 13B 2 2
MIRT527352 FAM69C family with sequence similarity 69 member C 2 2
MIRT528796 RAB32 RAB32, member RAS oncogene family 2 2
MIRT530417 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT533425 TWF1 twinfilin actin binding protein 1 2 2
MIRT539512 ACSS3 acyl-CoA synthetase short chain family member 3 2 2
MIRT543660 ZNF589 zinc finger protein 589 2 4
MIRT544833 ZNF639 zinc finger protein 639 2 2
MIRT545266 TRIM36 tripartite motif containing 36 2 4
MIRT545425 SLC39A6 solute carrier family 39 member 6 2 2
MIRT546070 VEZF1 vascular endothelial zinc finger 1 2 2
MIRT546896 PTPRK protein tyrosine phosphatase, receptor type K 2 2
MIRT547932 HNRNPR heterogeneous nuclear ribonucleoprotein R 2 2
MIRT548836 CHD1 chromodomain helicase DNA binding protein 1 2 4
MIRT550937 ZNF100 zinc finger protein 100 2 2
MIRT551840 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT553749 TBC1D8 TBC1 domain family member 8 2 2
MIRT554070 SOBP sine oculis binding protein homolog 2 2
MIRT554254 SIX4 SIX homeobox 4 2 2
MIRT558254 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT559252 BBX BBX, HMG-box containing 2 4
MIRT561110 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT561412 TSN translin 2 2
MIRT562154 ID4 inhibitor of DNA binding 4, HLH protein 2 2
MIRT563324 ORC4 origin recognition complex subunit 4 2 2
MIRT563985 SLFN11 schlafen family member 11 2 2
MIRT571387 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT575040 Fasl Fas ligand (TNF superfamily, member 6) 1 1
MIRT610374 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT611045 FASLG Fas ligand 2 3
MIRT625440 RMDN1 regulator of microtubule dynamics 1 2 2
MIRT655071 PKIA cAMP-dependent protein kinase inhibitor alpha 2 2
MIRT656139 MSH6 mutS homolog 6 2 2
MIRT667042 PDE3A phosphodiesterase 3A 2 2
MIRT691264 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT699773 SEMA4D semaphorin 4D 2 2
MIRT707809 TSPAN6 tetraspanin 6 2 2
MIRT711125 CYYR1 cysteine and tyrosine rich 1 2 2
MIRT714107 RLIM ring finger protein, LIM domain interacting 2 2
MIRT717792 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT717929 ZNF546 zinc finger protein 546 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-7849-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-7849-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission