pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-302b |
Genomic Coordinates | chr4: 112648485 - 112648557 |
Description | Homo sapiens miR-302b stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | |||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-302b-5p | ||||||||||||||||||||||||||||||
Sequence | 11| ACUUUAACAUGGAAGUGCUUUC |32 | ||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||
Experiments | Cloned | DRVs in miRNA |
|
||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | PER1 | ||||||||||||||||||||
Synonyms | PER, RIGUI, hPER | ||||||||||||||||||||
Description | period circadian clock 1 | ||||||||||||||||||||
Transcript | NM_002616 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on PER1 | |||||||||||||||||||||
3'UTR of PER1 (miRNA target sites are highlighted) |
>PER1|NM_002616|3'UTR 1 ACTCCATTCTGGGACCATCTCCAGGAGTCCATGAGAGGCTTTCTTCTCCTATGTCCCAATTCTCAGAACTCAGATGTGGC 81 TAGACCAACCAGTGGGAAACTGCCCCAGCTTCTCCCACCATAGGGGGCCGGACCCCCATCACCAGCCTAGGATCCAGGGG 161 CTGCCTCTGGCCTCTTAGGGAGCAGAGAGCAGAACTCCGCAGCCCAGCCCAGAGGAGTGTCACCTCCCACCTTTGGAGAG 241 GAATCCTTCCCTCCCCTGGACAAAGTTGCTGACAAGCTGCTGAAGTGGCCTCTCCATATTCCAGCTGAGCCTGAATCTGA 321 CTCTTGAGGGTTGGGGCTGCACTTATTTATTGCGGGGAGACAGCTCTCTCTCCCACCTCCTCCCCAGATGGGAGGAGAGC 401 CTGAGGCCCAAGCAGGACCCGGGGGTTCCAGCCCCTAGCTGCTCTGGAGTGGGGGAGGTTGGTGGACCATGGAGTCCCTG 481 GTGCTGCCCCTCAGGTGGGACCCAGGCGTTCTCAGCTGTACCCTCTGCCGATGGCATTTGTGTTTTTGATATTTGTGTCT 561 GTTACTACTTTTTTAATACAAAAAGATAAAAACGCCCAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 5187.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Prostate Tissue |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760628. RNA binding protein: AGO2. Condition:AGO-CLIP-LAPC4_B
PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset GSM545212 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000317276.4 | 3UTR | ACGCCGGCGCCGUGGCUUAGCUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGUGCCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545214 | |
---|---|
Method / RBP | PAR-CLIP / AGO3 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000317276.4 | 3UTR | ACGCCGGCGCCGUGGCUUAGCUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGUGCCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000317276.4 | 3UTR | GGCGCCGUGGCUUAGCUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM545217 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-7 transfection |
Location of target site | ENST00000317276.4 | 3UTR | AAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000317276.4 | 3UTR | CGCCGGCGCCGUGGCUUAGCUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGUGCCUGAGUUAGCGGGGAGUGAUAUAUUAUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM1065669 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
Location of target site | ENST00000317276.4 | 3UTR | CGCCGGCGCCGUGGCUUAGCUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGUGCCUGA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
109 hsa-miR-302b-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT088427 | LCLAT1 | lysocardiolipin acyltransferase 1 | 2 | 4 | ||||||||
MIRT142406 | TNRC6A | trinucleotide repeat containing 6A | 2 | 2 | ||||||||
MIRT162006 | TFRC | transferrin receptor | 2 | 2 | ||||||||
MIRT170893 | PURB | purine rich element binding protein B | 2 | 2 | ||||||||
MIRT203348 | CCNT2 | cyclin T2 | 2 | 4 | ||||||||
MIRT207353 | TGOLN2 | trans-golgi network protein 2 | 2 | 2 | ||||||||
MIRT208232 | CNBP | CCHC-type zinc finger nucleic acid binding protein | 2 | 4 | ||||||||
MIRT214733 | HSPA9 | heat shock protein family A (Hsp70) member 9 | 2 | 2 | ||||||||
MIRT254842 | NUP50 | nucleoporin 50 | 2 | 2 | ||||||||
MIRT257285 | FOXC1 | forkhead box C1 | 2 | 2 | ||||||||
MIRT338890 | LLPH | LLP homolog, long-term synaptic facilitation | 2 | 2 | ||||||||
MIRT400032 | USP37 | ubiquitin specific peptidase 37 | 2 | 2 | ||||||||
MIRT404031 | ATP9A | ATPase phospholipid transporting 9A (putative) | 2 | 8 | ||||||||
MIRT405843 | EIF2S1 | eukaryotic translation initiation factor 2 subunit alpha | 2 | 2 | ||||||||
MIRT445847 | FPGT | fucose-1-phosphate guanylyltransferase | 2 | 2 | ||||||||
MIRT446350 | EML6 | echinoderm microtubule associated protein like 6 | 2 | 2 | ||||||||
MIRT446649 | BTBD7 | BTB domain containing 7 | 2 | 2 | ||||||||
MIRT447925 | SCRN1 | secernin 1 | 2 | 2 | ||||||||
MIRT448575 | PLCG1 | phospholipase C gamma 1 | 2 | 2 | ||||||||
MIRT463616 | ZBTB33 | zinc finger and BTB domain containing 33 | 2 | 4 | ||||||||
MIRT465782 | TMOD3 | tropomodulin 3 | 2 | 2 | ||||||||
MIRT470261 | PRR14L | proline rich 14 like | 2 | 2 | ||||||||
MIRT471090 | PIK3C2B | phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta | 2 | 2 | ||||||||
MIRT475612 | HMGB1 | high mobility group box 1 | 2 | 2 | ||||||||
MIRT476824 | FNDC3A | fibronectin type III domain containing 3A | 2 | 2 | ||||||||
MIRT483107 | TYRP1 | tyrosinase related protein 1 | 2 | 10 | ||||||||
MIRT500537 | XPO4 | exportin 4 | 2 | 2 | ||||||||
MIRT502525 | EPHA2 | EPH receptor A2 | 2 | 4 | ||||||||
MIRT510989 | PER1 | period circadian clock 1 | 2 | 4 | ||||||||
MIRT512540 | ZNF793 | zinc finger protein 793 | 2 | 4 | ||||||||
MIRT513868 | HOXA5 | homeobox A5 | 2 | 2 | ||||||||
MIRT520756 | TFDP1 | transcription factor Dp-1 | 2 | 6 | ||||||||
MIRT524304 | CTC1 | CST telomere replication complex component 1 | 2 | 8 | ||||||||
MIRT526306 | JAKMIP2 | janus kinase and microtubule interacting protein 2 | 2 | 2 | ||||||||
MIRT526378 | LSAMP | limbic system-associated membrane protein | 2 | 2 | ||||||||
MIRT527438 | COL4A3 | collagen type IV alpha 3 chain | 2 | 2 | ||||||||
MIRT527511 | ZNF134 | zinc finger protein 134 | 2 | 2 | ||||||||
MIRT528068 | HES2 | hes family bHLH transcription factor 2 | 2 | 2 | ||||||||
MIRT528367 | ZMYM1 | zinc finger MYM-type containing 1 | 2 | 4 | ||||||||
MIRT531804 | TFCP2L1 | transcription factor CP2 like 1 | 2 | 2 | ||||||||
MIRT532323 | DUSP4 | dual specificity phosphatase 4 | 2 | 2 | ||||||||
MIRT532431 | DHX33 | DEAH-box helicase 33 | 2 | 2 | ||||||||
MIRT534523 | SAR1A | secretion associated Ras related GTPase 1A | 2 | 2 | ||||||||
MIRT536660 | INIP | INTS3 and NABP interacting protein | 2 | 2 | ||||||||
MIRT538488 | CLOCK | clock circadian regulator | 2 | 2 | ||||||||
MIRT538593 | CDK6 | cyclin dependent kinase 6 | 2 | 2 | ||||||||
MIRT539706 | EIF3H | eukaryotic translation initiation factor 3 subunit H | 2 | 2 | ||||||||
MIRT540306 | GFPT1 | glutamine--fructose-6-phosphate transaminase 1 | 2 | 2 | ||||||||
MIRT546892 | PURA | purine rich element binding protein A | 2 | 2 | ||||||||
MIRT552738 | YRDC | yrdC N6-threonylcarbamoyltransferase domain containing | 2 | 2 | ||||||||
MIRT552781 | YIPF6 | Yip1 domain family member 6 | 2 | 2 | ||||||||
MIRT553742 | TBL1XR1 | transducin beta like 1 X-linked receptor 1 | 2 | 4 | ||||||||
MIRT553909 | SUMO2 | small ubiquitin-like modifier 2 | 2 | 2 | ||||||||
MIRT554540 | RRS1 | ribosome biogenesis regulator homolog | 2 | 2 | ||||||||
MIRT555319 | PPP2CB | protein phosphatase 2 catalytic subunit beta | 2 | 2 | ||||||||
MIRT555512 | PMEPA1 | prostate transmembrane protein, androgen induced 1 | 2 | 2 | ||||||||
MIRT556221 | MB21D2 | Mab-21 domain containing 2 | 2 | 2 | ||||||||
MIRT556292 | MAP3K5 | mitogen-activated protein kinase kinase kinase 5 | 2 | 2 | ||||||||
MIRT556606 | LDOC1L | retrotransposon Gag like 6 | 2 | 4 | ||||||||
MIRT556901 | ISOC1 | isochorismatase domain containing 1 | 2 | 2 | ||||||||
MIRT557675 | GATA6 | GATA binding protein 6 | 2 | 2 | ||||||||
MIRT560198 | GXYLT2 | glucoside xylosyltransferase 2 | 2 | 2 | ||||||||
MIRT560493 | BUB3 | BUB3, mitotic checkpoint protein | 2 | 2 | ||||||||
MIRT566069 | RCC2 | regulator of chromosome condensation 2 | 2 | 2 | ||||||||
MIRT568431 | GDNF | glial cell derived neurotrophic factor | 2 | 2 | ||||||||
MIRT570703 | FAM69A | family with sequence similarity 69 member A | 2 | 2 | ||||||||
MIRT571705 | RPL36A-HNRNPH2 | RPL36A-HNRNPH2 readthrough | 2 | 2 | ||||||||
MIRT573152 | ITGA9 | integrin subunit alpha 9 | 2 | 2 | ||||||||
MIRT574410 | TFAP2A | transcription factor AP-2 alpha | 2 | 2 | ||||||||
MIRT614823 | PVRL4 | nectin cell adhesion molecule 4 | 2 | 2 | ||||||||
MIRT616507 | COX7A2L | cytochrome c oxidase subunit 7A2 like | 2 | 2 | ||||||||
MIRT618301 | COL4A4 | collagen type IV alpha 4 chain | 2 | 2 | ||||||||
MIRT621188 | FAM153B | family with sequence similarity 153 member B | 2 | 2 | ||||||||
MIRT621594 | WT1 | Wilms tumor 1 | 2 | 2 | ||||||||
MIRT623814 | GGCX | gamma-glutamyl carboxylase | 2 | 2 | ||||||||
MIRT624407 | CCDC171 | coiled-coil domain containing 171 | 2 | 2 | ||||||||
MIRT625136 | CKAP2L | cytoskeleton associated protein 2 like | 2 | 2 | ||||||||
MIRT626121 | MRRF | mitochondrial ribosome recycling factor | 2 | 2 | ||||||||
MIRT626874 | AP3B1 | adaptor related protein complex 3 beta 1 subunit | 2 | 2 | ||||||||
MIRT627874 | PAN2 | PAN2 poly(A) specific ribonuclease subunit | 2 | 2 | ||||||||
MIRT633670 | FAM53B | family with sequence similarity 53 member B | 2 | 2 | ||||||||
MIRT634285 | SYAP1 | synapse associated protein 1 | 2 | 2 | ||||||||
MIRT640925 | POU2F1 | POU class 2 homeobox 1 | 2 | 2 | ||||||||
MIRT642028 | MYADM | myeloid associated differentiation marker | 2 | 2 | ||||||||
MIRT643031 | CHCHD7 | coiled-coil-helix-coiled-coil-helix domain containing 7 | 2 | 2 | ||||||||
MIRT646122 | SLC26A9 | solute carrier family 26 member 9 | 2 | 2 | ||||||||
MIRT646245 | SNAP47 | synaptosome associated protein 47 | 2 | 2 | ||||||||
MIRT652457 | TMEM2 | transmembrane protein 2 | 2 | 2 | ||||||||
MIRT657018 | KCNK5 | potassium two pore domain channel subfamily K member 5 | 2 | 2 | ||||||||
MIRT660586 | APP | amyloid beta precursor protein | 2 | 2 | ||||||||
MIRT664316 | CD209 | CD209 molecule | 2 | 2 | ||||||||
MIRT667113 | OLA1 | Obg like ATPase 1 | 2 | 2 | ||||||||
MIRT668773 | DCP2 | decapping mRNA 2 | 2 | 2 | ||||||||
MIRT698430 | TM4SF1 | transmembrane 4 L six family member 1 | 2 | 2 | ||||||||
MIRT700216 | REL | REL proto-oncogene, NF-kB subunit | 2 | 2 | ||||||||
MIRT710498 | CAPRIN1 | cell cycle associated protein 1 | 2 | 2 | ||||||||
MIRT711836 | AMOTL2 | angiomotin like 2 | 2 | 2 | ||||||||
MIRT713226 | GPR75 | G protein-coupled receptor 75 | 2 | 2 | ||||||||
MIRT714415 | TBC1D16 | TBC1 domain family member 16 | 2 | 2 | ||||||||
MIRT714490 | HSPA4 | heat shock protein family A (Hsp70) member 4 | 2 | 2 | ||||||||
MIRT715254 | F9 | coagulation factor IX | 2 | 2 | ||||||||
MIRT716250 | PALM2 | paralemmin 2 | 2 | 2 | ||||||||
MIRT717261 | BMPR2 | bone morphogenetic protein receptor type 2 | 2 | 2 | ||||||||
MIRT717730 | FGF1 | fibroblast growth factor 1 | 2 | 2 | ||||||||
MIRT719262 | CD44 | CD44 molecule (Indian blood group) | 2 | 2 | ||||||||
MIRT719398 | SLC15A4 | solute carrier family 15 member 4 | 2 | 2 | ||||||||
MIRT720653 | TMEM218 | transmembrane protein 218 | 2 | 2 | ||||||||
MIRT720777 | MSANTD3-TMEFF1 | MSANTD3-TMEFF1 readthrough | 2 | 2 | ||||||||
MIRT722059 | TMEFF1 | transmembrane protein with EGF like and two follistatin like domains 1 | 2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|