miRTarBase - #MIRT511143


—
pre-miRNA Information
pre-miRNA hsa-mir-452   
Genomic Coordinates chrX: 151959628 - 151959712
Synonyms MIRN452, hsa-mir-452, MIR452
Description Homo sapiens miR-452 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-452-3p
Sequence 58| CUCAUCUGCAAAGAAGUAAGUG |79
Evidence Experimental
Experiments Array-cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 X - 151959644 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs757928550 3 dbSNP
rs1324216965 6 dbSNP
rs1390793899 13 dbSNP
rs899383242 17 dbSNP
rs747858567 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MRPL17   
Synonyms L17mt, LIP2, MRP-L17, MRP-L26, RPL17L, RPML26
Description mitochondrial ribosomal protein L17
Transcript NM_022061   
Expression
Putative miRNA Targets on MRPL17
3'UTR of MRPL17
(miRNA target sites are highlighted)		 
>MRPL17|NM_022061|3'UTR
   1 CTGGATCTGAAGAGTCTGCAGCCCTTAATCAGTACCCATGATCACAGGCCTTTGGAGCACTTTTACTCTCTGAGAAGAAC
  81 TGGAGCTAGAGATGTAAAATGGACAGTCTTGATGGGGTTGAGAACCTTCTGGGGAGCCAGATGACCCTCTCTTTGCACAA
 161 TAGATAAAAGTCTTTATATGAATATATATAAATTTATTTATTTTTTCCTTCCTGTGGGATTTCTGGAGAATGAGAATTAT
 241 CCAAATGCTCAGTCTACCTGAGATAGTAAATTCATGGCTTATGCTTCTGGTCCTTAAATTTGGGTTATTTTTGGTTAGTG
 321 CAATTTTGTTTTTCTTAATGCCAGTTTACATGGGAATGCATCCTATAATTCCAAATGTTGCCAGAGGTGGTTGTGTTTTG
 401 ACATCTGGTCTCCTAGAGATGAGTGCTTGGGATTTCTTAGAGAAAGATTACTTCCTGACAGGGGTAGGGGAGTGACAATC
 481 TGCAAGTGAAACTTCCTTAAACAATCTAGTACCCTGCGAACCTTCAGGGGATACTGCAATCAGTCCTCTGTTTTGAGGCA
 561 GGATCACACATTACCTTAATGTGTTCCCTTCAACCCCCTGAATGGGCCTGGGAGGAGAGGACCCAAGAACTCAGATGTTC
 641 CACCAGTTTGGCCAAAGGGGTGGAGACATTCAGCAGAGGATGTTGGGCTCCAGGATAAGCTCCTTCCTCTTGGTGAGGGG
 721 AAGGGGTAAGAAAGAGGGTCTATGCGAGAGAAGGATTAGGAAATTAAACCTCCTAGGAATTTCCTGGAAGTTTTTATTGT
 801 TGTCAAATCTGGCCTCTCTGGGAACCCAGAAAAGGGAAATCCGGCTTCAGAATGTGAGAAGCTGGGAGCCCCTTTCTTGG
 881 CACAGCCAGGCTGCCGTTCCCTTGGGTTCAGAGGCTTTAGTAGGGTAGTAGTTATGGAAGGACTTAGAAAGGAGCCATCA
 961 GTCTTGGTCCAAACACTTGATAGCAGTGCCTGATAATTGCCATATCCCCAGTAAAGTGGGTAGAAGAGATTTTATCTTAG
1041 GCTCTATCTTCTGAGTGTATTTGGCCCACTGAACCCATCCACTGTCTGAGATAATAAGTAAGAGTAAGGGTAAAGGGATC
1121 ACTGGTGTAGCAGACATGGCTTCAGTGACAGAACGAACTATTCTGGTGCTAATTTAGCTGTAGCTGCCTTAGTCTGATAC
1201 TCATCTACTCCCAACAGAGCTCTTTATCTCTTTTTCTCTACTATGGTTTGTTCTTCACACTATAGCCAGAAAGCTCTTAT
1281 ATTTTAAATGAAATATAGTAGACACTCAAAACATTTATGAAATAAAGCTACAACTCTGCTTCTGCTAAAAAATATACCCC
1361 TCTTCTGTCTTAGCATGAATATCCACCCTAGCTAGGTATCTAGGAGTCATACCTAACTTCTAGAGAAACCACTTTCCTTA
1441 AAACCACATCTTTATTTTAAATAGATGGATTGTGGCTGGGCTCCTGTAGCTTTTCCTCTTAGACCCCAGAAATATATCTC
1521 CCTTTGGGACTTCCAACAGTTCCCTACATGCTTTTTGAGCATCTGCTAGTTCCCAGCATCAATTTAGGCAGAAGGGATAC
1601 AATATCCACTGTTCATCTAATAGAGACTAGAGATAAGAAACAACCTGTACCATCAATGAGCTCACAATAACAGGCCACTG
1681 CCACTACCACAGTGGCCTCAAGGGACACTGCTTCCCCTTTAATGTTTTGGTCC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gugaauGAAGAAAC----GUCUACUc 5'
                |||||  |    ||||||| 
Target 5' gagaacCTTCTGGGGAGCCAGATGAc 3'
 120 - 145 150.00 -12.10
2 
miRNA  3' guGAAUGAAGAAACGUCUACUc 5'
            |||  ||:|   :|||||: 
Target 5' atCTTTATTTTAAATAGATGGa 3'
 1448 - 1469 124.00 -8.30
3 
miRNA  3' gugaaugaagaaacGUCUACuc 5'
                        ||||||  
Target 5' aggacccaagaactCAGATGtt 3'
 618 - 639 120.00 -7.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30177105 12 COSMIC
COSN30488849 61 COSMIC
COSN19582342 70 COSMIC
COSN7017468 154 COSMIC
COSN30533989 186 COSMIC
COSN1136640 251 COSMIC
COSN7017466 297 COSMIC
COSN32057878 408 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs752567735 2 dbSNP
rs767023973 4 dbSNP
rs759272404 6 dbSNP
rs1044349 7 dbSNP
rs773929337 14 dbSNP
rs8109 15 dbSNP
rs1246307377 16 dbSNP
rs201098149 19 dbSNP
rs776984749 21 dbSNP
rs1188410146 23 dbSNP
rs147348960 24 dbSNP
rs1449460894 28 dbSNP
rs377743005 30 dbSNP
rs966343348 31 dbSNP
rs780490536 35 dbSNP
rs772225682 38 dbSNP
rs185356978 41 dbSNP
rs986564132 45 dbSNP
rs1326251597 47 dbSNP
rs1322508713 72 dbSNP
rs779721310 72 dbSNP
rs1432427883 73 dbSNP
rs1286668655 77 dbSNP
rs933913770 85 dbSNP
rs1317018427 91 dbSNP
rs142774585 96 dbSNP
rs1004586642 101 dbSNP
rs1447859993 105 dbSNP
rs1236554764 112 dbSNP
rs887520808 117 dbSNP
rs975140729 122 dbSNP
rs547924097 131 dbSNP
rs769492289 136 dbSNP
rs1387584495 141 dbSNP
rs1032785939 144 dbSNP
rs1163086406 147 dbSNP
rs11040957 151 dbSNP
rs1402148192 155 dbSNP
rs1404334024 156 dbSNP
rs1344953444 157 dbSNP
rs1387310055 158 dbSNP
rs1452683749 160 dbSNP
rs1338096070 161 dbSNP
rs1380559789 163 dbSNP
rs1301296966 164 dbSNP
rs868684212 165 dbSNP
rs967089913 170 dbSNP
rs543696764 171 dbSNP
rs1352493994 175 dbSNP
rs1225697821 176 dbSNP
rs150563527 178 dbSNP
rs949992434 186 dbSNP
rs913179246 188 dbSNP
rs3177170 190 dbSNP
rs3177171 191 dbSNP
rs896778139 191 dbSNP
rs796632737 192 dbSNP
rs200309634 194 dbSNP
rs564814204 194 dbSNP
rs898511528 195 dbSNP
rs1480362004 196 dbSNP
rs1267388310 197 dbSNP
rs3168317 201 dbSNP
rs1451699209 204 dbSNP
rs1004263215 207 dbSNP
rs1178043320 217 dbSNP
rs1403264040 225 dbSNP
rs1413844389 229 dbSNP
rs575839148 239 dbSNP
rs755020138 240 dbSNP
rs3741276 244 dbSNP
rs1287453262 255 dbSNP
rs116082059 257 dbSNP
rs1015215629 263 dbSNP
rs1224338870 265 dbSNP
rs1265147434 270 dbSNP
rs1040008962 277 dbSNP
rs1200394091 282 dbSNP
rs573351663 284 dbSNP
rs1274280143 292 dbSNP
rs760118498 302 dbSNP
rs193232650 303 dbSNP
rs1005546082 304 dbSNP
rs1180535476 307 dbSNP
rs935909082 313 dbSNP
rs951657022 316 dbSNP
rs1480598263 323 dbSNP
rs1321281440 326 dbSNP
rs925622618 331 dbSNP
rs201183341 334 dbSNP
rs1168454997 339 dbSNP
rs1398596276 350 dbSNP
rs1408117386 351 dbSNP
rs377534198 363 dbSNP
rs72894750 365 dbSNP
rs879268386 367 dbSNP
rs1438671311 377 dbSNP
rs967121123 382 dbSNP
rs1331790199 394 dbSNP
rs11824783 408 dbSNP
rs1045962504 410 dbSNP
rs1329436780 426 dbSNP
rs992360021 429 dbSNP
rs960849838 436 dbSNP
rs1391124119 452 dbSNP
rs1342160058 460 dbSNP
rs1033957002 461 dbSNP
rs1274377638 462 dbSNP
rs141714697 463 dbSNP
rs12283996 464 dbSNP
rs1017353152 465 dbSNP
rs1004169316 471 dbSNP
rs576354288 472 dbSNP
rs1478054233 477 dbSNP
rs187896844 478 dbSNP
rs1447650102 482 dbSNP
rs1167808991 485 dbSNP
rs1190564375 493 dbSNP
rs1426259903 497 dbSNP
rs935929045 500 dbSNP
rs925259769 506 dbSNP
rs1043729625 512 dbSNP
rs1051114417 513 dbSNP
rs1388909613 520 dbSNP
rs932054254 522 dbSNP
rs922073852 527 dbSNP
rs1226854700 531 dbSNP
rs1297454137 533 dbSNP
rs976653689 542 dbSNP
rs944851621 543 dbSNP
rs1459848975 545 dbSNP
rs1264888208 547 dbSNP
rs1487986776 550 dbSNP
rs116639596 554 dbSNP
rs1263220872 566 dbSNP
rs148064689 567 dbSNP
rs1269609062 568 dbSNP
rs925852896 570 dbSNP
rs1041441354 574 dbSNP
rs952290331 581 dbSNP
rs565455327 590 dbSNP
rs551817313 591 dbSNP
rs1321494909 596 dbSNP
rs1452346778 599 dbSNP
rs1027307296 604 dbSNP
rs979795753 605 dbSNP
rs1336717958 607 dbSNP
rs1415604563 611 dbSNP
rs184764594 619 dbSNP
rs569544361 621 dbSNP
rs1384244590 622 dbSNP
rs1024100043 623 dbSNP
rs1398292208 624 dbSNP
rs980925885 626 dbSNP
rs1321425438 629 dbSNP
rs551295068 630 dbSNP
rs1165588478 632 dbSNP
rs1014423600 633 dbSNP
rs891593119 634 dbSNP
rs1450814838 636 dbSNP
rs73399240 637 dbSNP
rs1182637353 652 dbSNP
rs1000046549 655 dbSNP
rs562294289 665 dbSNP
rs1017134595 666 dbSNP
rs904476307 671 dbSNP
rs1179982060 675 dbSNP
rs1419401947 679 dbSNP
rs1182842029 683 dbSNP
rs1414519418 706 dbSNP
rs1455820395 706 dbSNP
rs1158594891 707 dbSNP
rs1406917240 709 dbSNP
rs539918469 727 dbSNP
rs1468033471 733 dbSNP
rs1244806838 737 dbSNP
rs144586459 742 dbSNP
rs1378925758 745 dbSNP
rs545978432 746 dbSNP
rs900504068 752 dbSNP
rs1227398166 759 dbSNP
rs998238073 760 dbSNP
rs1325001166 775 dbSNP
rs1207965712 782 dbSNP
rs1040423278 793 dbSNP
rs944798957 797 dbSNP
rs1480901629 806 dbSNP
rs908011052 807 dbSNP
rs141827250 809 dbSNP
rs930870335 812 dbSNP
rs1471771459 817 dbSNP
rs1298567546 821 dbSNP
rs1245605383 823 dbSNP
rs1181645861 828 dbSNP
rs1430083593 830 dbSNP
rs1434927691 836 dbSNP
rs765492574 842 dbSNP
rs920883168 843 dbSNP
rs191090825 846 dbSNP
rs186681483 848 dbSNP
rs904471850 856 dbSNP
rs1041642111 860 dbSNP
rs1369144412 862 dbSNP
rs979764766 866 dbSNP
rs759690381 876 dbSNP
rs1299964045 879 dbSNP
rs776784621 879 dbSNP
rs1024399716 880 dbSNP
rs574667417 887 dbSNP
rs1482572088 891 dbSNP
rs1370704174 892 dbSNP
rs956002117 893 dbSNP
rs138831248 895 dbSNP
rs1000018626 896 dbSNP
rs534521553 902 dbSNP
rs764158461 906 dbSNP
rs1429636233 911 dbSNP
rs1170972521 914 dbSNP
rs1028156692 917 dbSNP
rs1429468472 921 dbSNP
rs997172373 925 dbSNP
rs12291868 930 dbSNP
rs868063206 935 dbSNP
rs144975670 936 dbSNP
rs3741277 940 dbSNP
rs1295244750 946 dbSNP
rs1341232676 946 dbSNP
rs983014013 955 dbSNP
rs1221866026 956 dbSNP
rs1047918779 960 dbSNP
rs930840517 961 dbSNP
rs1229223049 963 dbSNP
rs1246218138 967 dbSNP
rs920766494 970 dbSNP
rs1029626320 971 dbSNP
rs182485151 972 dbSNP
rs1246771201 988 dbSNP
rs372839585 990 dbSNP
rs16917015 992 dbSNP
rs1416403774 1000 dbSNP
rs1018350370 1006 dbSNP
rs1163560050 1026 dbSNP
rs1345293742 1028 dbSNP
rs115534214 1034 dbSNP
rs1351657977 1038 dbSNP
rs904335917 1040 dbSNP
rs1364430755 1056 dbSNP
rs1020104051 1057 dbSNP
rs1285740381 1074 dbSNP
rs1422245325 1077 dbSNP
rs745552475 1082 dbSNP
rs1289382734 1084 dbSNP
rs1330050779 1098 dbSNP
rs1210724529 1103 dbSNP
rs1266303854 1104 dbSNP
rs1165104721 1113 dbSNP
rs1188771800 1115 dbSNP
rs916899240 1122 dbSNP
rs992929193 1124 dbSNP
rs572939515 1129 dbSNP
rs1180952125 1131 dbSNP
rs937017253 1133 dbSNP
rs1458465657 1135 dbSNP
rs1156388642 1136 dbSNP
rs905638643 1137 dbSNP
rs1470270338 1147 dbSNP
rs1336041891 1148 dbSNP
rs955806226 1150 dbSNP
rs1037437544 1154 dbSNP
rs551985151 1155 dbSNP
rs11040956 1158 dbSNP
rs1433557355 1160 dbSNP
rs982878319 1163 dbSNP
rs1286536255 1165 dbSNP
rs528699864 1168 dbSNP
rs532272498 1170 dbSNP
rs1281298968 1171 dbSNP
rs1472846434 1179 dbSNP
rs922853915 1188 dbSNP
rs977191153 1210 dbSNP
rs1473405890 1219 dbSNP
rs141321309 1222 dbSNP
rs1179500785 1225 dbSNP
rs1410619008 1232 dbSNP
rs1268104960 1236 dbSNP
rs747400607 1236 dbSNP
rs1028125557 1240 dbSNP
rs1478049082 1240 dbSNP
rs138269176 1243 dbSNP
rs1487573047 1245 dbSNP
rs965697390 1250 dbSNP
rs1018932014 1251 dbSNP
rs968759167 1255 dbSNP
rs1009348576 1263 dbSNP
rs1222666717 1265 dbSNP
rs1316679321 1280 dbSNP
rs1282521766 1288 dbSNP
rs569532124 1292 dbSNP
rs1276663732 1294 dbSNP
rs1343559368 1295 dbSNP
rs1219151431 1296 dbSNP
rs1047804913 1305 dbSNP
rs994931273 1315 dbSNP
rs748625699 1328 dbSNP
rs1044605585 1332 dbSNP
rs1035601237 1333 dbSNP
rs1001631815 1338 dbSNP
rs948982618 1339 dbSNP
rs917522707 1344 dbSNP
rs1293747522 1349 dbSNP
rs905546140 1354 dbSNP
rs1169076774 1355 dbSNP
rs1391806470 1356 dbSNP
rs1427536591 1357 dbSNP
rs1056796177 1371 dbSNP
rs191357919 1375 dbSNP
rs934279866 1379 dbSNP
rs1005976124 1383 dbSNP
rs1057038391 1389 dbSNP
rs188572460 1392 dbSNP
rs1298939936 1393 dbSNP
rs1344898739 1395 dbSNP
rs978452846 1400 dbSNP
rs1431505183 1406 dbSNP
rs1274357951 1412 dbSNP
rs968457031 1420 dbSNP
rs1047259500 1423 dbSNP
rs930137483 1432 dbSNP
rs1264673894 1436 dbSNP
rs543470346 1449 dbSNP
rs1189173630 1459 dbSNP
rs570791521 1461 dbSNP
rs1447559688 1462 dbSNP
rs1246456758 1466 dbSNP
rs779287144 1467 dbSNP
rs574453935 1468 dbSNP
rs1458606853 1474 dbSNP
rs965318078 1478 dbSNP
rs1019988985 1483 dbSNP
rs1461025149 1484 dbSNP
rs1321275587 1486 dbSNP
rs1465669820 1500 dbSNP
rs554449625 1504 dbSNP
rs1433526813 1508 dbSNP
rs530299674 1514 dbSNP
rs1313426585 1516 dbSNP
rs950662399 1517 dbSNP
rs1246560738 1519 dbSNP
rs1263272019 1534 dbSNP
rs183574775 1536 dbSNP
rs558312079 1539 dbSNP
rs968831004 1540 dbSNP
rs1269464496 1544 dbSNP
rs1359384104 1547 dbSNP
rs1322164934 1550 dbSNP
rs1463539412 1560 dbSNP
rs1187779370 1561 dbSNP
rs1256609523 1567 dbSNP
rs1435501272 1569 dbSNP
rs994901916 1573 dbSNP
rs538752797 1582 dbSNP
rs1023121509 1589 dbSNP
rs1405164043 1595 dbSNP
rs988675133 1596 dbSNP
rs1160089631 1599 dbSNP
rs756352520 1600 dbSNP
rs750683474 1606 dbSNP
rs1288749938 1608 dbSNP
rs1403393356 1613 dbSNP
rs550818060 1621 dbSNP
rs1398195104 1624 dbSNP
rs576076058 1625 dbSNP
rs1310996852 1626 dbSNP
rs1334586268 1631 dbSNP
rs1228617359 1632 dbSNP
rs1289683296 1633 dbSNP
rs1057495630 1635 dbSNP
rs934925214 1637 dbSNP
rs1326383727 1641 dbSNP
rs1208067051 1645 dbSNP
rs902832826 1651 dbSNP
rs1035909131 1656 dbSNP
rs1176830051 1657 dbSNP
rs1001473790 1663 dbSNP
rs1475007905 1663 dbSNP
rs1414313243 1665 dbSNP
rs150457970 1671 dbSNP
rs772986562 1686 dbSNP
rs1378764998 1687 dbSNP
rs970345745 1697 dbSNP
rs767276524 1699 dbSNP
rs535878162 1702 dbSNP
rs1410067856 1705 dbSNP
rs1309415283 1711 dbSNP
rs947123529 1714 dbSNP
rs200384683 1721 dbSNP
rs886222895 1723 dbSNP
rs1313947749 1724 dbSNP
rs1230895144 1727 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 63875.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 63875.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000288937.6 | 3UTR | ACCCUCUCUUUGCACAAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000288937.6 | 3UTR | ACCCUCUCUUUGCACAAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000288937.6 | 3UTR | ACCCUCUCUUUGCACAAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000288937.6 | 3UTR | ACCCUCUCUUUGCACAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000288937.6 | 3UTR | CCAGAUGACCCUCUCUUUGCACAAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000288937.6 | 3UTR | ACCCUCUCUUUGCACAAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000288937.6 | 3UTR | CAGAUGACCCUCUCUUUGCACAAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.445 1.5e-2 -0.440 1.6e-2 24 Click to see details
GSE28260 Renal cortex and medulla -0.563 2.3e-2 -0.764 1.2e-3 13 Click to see details
GSE19350 CNS germ cell tumors -0.51 4.5e-2 0.154 3.2e-1 12 Click to see details
GSE32688 Pancreatic cancer 0.278 6.2e-2 0.434 6.5e-3 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.282 9.6e-2 -0.290 9.0e-2 23 Click to see details
GSE14794 Lymphoblastoid cells 0.134 1.0e-1 0.063 2.8e-1 90 Click to see details
GSE17306 Multiple myeloma -0.167 1.3e-1 0.423 1.2e-3 49 Click to see details
GSE38226 Liver fibrosis -0.25 1.4e-1 -0.194 2.0e-1 21 Click to see details
GSE26953 Aortic valvular endothelial cells 0.177 2.0e-1 0.229 1.4e-1 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.178 2.3e-1 0.074 3.8e-1 20 Click to see details
GSE21849 B cell lymphoma -0.114 2.8e-1 -0.003 4.9e-1 29 Click to see details
GSE27834 Pluripotent stem cells -0.052 4.2e-1 -0.018 4.7e-1 16 Click to see details
GSE17498 Multiple myeloma -0.031 4.2e-1 -0.009 4.8e-1 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.024 4.5e-1 -0.141 2.5e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.012 4.6e-1 -0.093 2.3e-1 64 Click to see details
GSE21687 Ependynoma primary tumors -0.012 4.6e-1 -0.093 2.3e-1 64 Click to see details
GSE21687 Ependynoma primary tumors -0.012 4.6e-1 -0.093 2.3e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KICH -0.465 0.01 -0.456 0.01 24 Click to see details
LUAD 0.555 0.04 0.564 0.04 11 Click to see details
KIRC 0.192 0.06 0.200 0.06 65 Click to see details
LIHC 0.196 0.09 0.220 0.06 49 Click to see details
BRCA 0.143 0.1 0.123 0.14 79 Click to see details
LUSC 0.196 0.12 0.180 0.14 38 Click to see details
HNSC 0.166 0.15 0.128 0.21 42 Click to see details
PRAD -0.147 0.16 -0.122 0.2 48 Click to see details
CESC 0.873 0.16 1.000 0.5 3 Click to see details
KIRP 0.181 0.16 0.313 0.04 31 Click to see details
ESCA 0.306 0.21 -0.067 0.43 9 Click to see details
STAD 0.122 0.26 0.164 0.2 29 Click to see details
BLCA 0.163 0.27 0.113 0.33 17 Click to see details
THCA 0.06 0.33 0.075 0.29 59 Click to see details
UCEC 0.037 0.44 0.075 0.38 19 Click to see details
CHOL 0.015 0.48 0.100 0.4 9 Click to see details
PAAD 0.026 0.49 0.400 0.3 4 Click to see details
PAAD 0.026 0.49 0.400 0.3 4 Click to see details
PAAD 0.026 0.49 0.400 0.3 4 Click to see details
PAAD 0.026 0.49 0.400 0.3 4 Click to see details
87 hsa-miR-452-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT150000 MIDN midnolin 2 10
MIRT330600 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT358701 SUB1 SUB1 homolog, transcriptional regulator 2 4
MIRT362854 EIF4H eukaryotic translation initiation factor 4H 2 2
MIRT447215 ATXN7 ataxin 7 2 2
MIRT466655 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 6
MIRT483979 PANK1 pantothenate kinase 1 2 8
MIRT485118 SF3B3 splicing factor 3b subunit 3 2 2
MIRT488864 AUTS8 Autism, susceptibility to, 8 2 2
MIRT492293 SH2B3 SH2B adaptor protein 3 2 2
MIRT492976 NCK2 NCK adaptor protein 2 2 2
MIRT497410 LRRC40 leucine rich repeat containing 40 2 2
MIRT511143 MRPL17 mitochondrial ribosomal protein L17 2 6
MIRT512650 MAP3K2 mitogen-activated protein kinase kinase kinase 2 2 2
MIRT513017 NSFL1C NSFL1 cofactor 2 6
MIRT520445 TSPAN2 tetraspanin 2 2 6
MIRT527995 NDNF neuron derived neurotrophic factor 2 2
MIRT528667 PDE4DIP phosphodiesterase 4D interacting protein 2 2
MIRT533512 TRIM71 tripartite motif containing 71 2 2
MIRT537404 FBXO47 F-box protein 47 2 2
MIRT538161 DCP2 decapping mRNA 2 2 2
MIRT539124 ARHGEF17 Rho guanine nucleotide exchange factor 17 2 2
MIRT540666 MIS18A MIS18 kinetochore protein A 2 4
MIRT542948 GDF11 growth differentiation factor 11 2 2
MIRT547534 MAML3 mastermind like transcriptional coactivator 3 2 2
MIRT559033 C20orf24 chromosome 20 open reading frame 24 2 4
MIRT559554 ARF6 ADP ribosylation factor 6 2 2
MIRT570177 RCBTB1 RCC1 and BTB domain containing protein 1 2 2
MIRT573149 ITGA9 integrin subunit alpha 9 2 2
MIRT575849 Rab1 RAB1A, member RAS oncogene family 1 1
MIRT611034 RRP1B ribosomal RNA processing 1B 2 2
MIRT616281 HMGB1 high mobility group box 1 2 2
MIRT618372 PRKG2 protein kinase, cGMP-dependent, type II 2 2
MIRT619540 PIWIL2 piwi like RNA-mediated gene silencing 2 2 2
MIRT622303 SGIP1 SH3 domain GRB2 like endophilin interacting protein 1 2 2
MIRT622590 PRRG4 proline rich and Gla domain 4 2 2
MIRT624441 CAMK2N1 calcium/calmodulin dependent protein kinase II inhibitor 1 2 2
MIRT637089 KLRD1 killer cell lectin like receptor D1 2 2
MIRT639084 ADCYAP1 adenylate cyclase activating polypeptide 1 2 2
MIRT639334 NINJ1 ninjurin 1 2 2
MIRT639798 EIF3E eukaryotic translation initiation factor 3 subunit E 2 2
MIRT640851 RAB3B RAB3B, member RAS oncogene family 2 2
MIRT641628 KIAA1244 ARFGEF family member 3 1 1
MIRT642634 EPPIN epididymal peptidase inhibitor 2 2
MIRT643053 EPPIN-WFDC6 EPPIN-WFDC6 readthrough 2 2
MIRT643416 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT645586 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT647393 FAM181B family with sequence similarity 181 member B 2 2
MIRT649411 CDC14B cell division cycle 14B 2 2
MIRT649477 CLDN16 claudin 16 2 2
MIRT651307 ZDHHC20 zinc finger DHHC-type containing 20 2 2
MIRT651387 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT653411 SLC7A2 solute carrier family 7 member 2 2 2
MIRT654084 RSPH4A radial spoke head 4 homolog A 2 2
MIRT654613 PTPRM protein tyrosine phosphatase, receptor type M 2 2
MIRT655338 PCP4L1 Purkinje cell protein 4 like 1 2 2
MIRT656173 MRPL44 mitochondrial ribosomal protein L44 2 2
MIRT657272 HS3ST3B1 heparan sulfate-glucosamine 3-sulfotransferase 3B1 2 2
MIRT657881 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 2
MIRT659875 CAPRIN1 cell cycle associated protein 1 2 2
MIRT662381 ICA1L islet cell autoantigen 1 like 2 4
MIRT666308 SLC22A3 solute carrier family 22 member 3 2 2
MIRT667274 NAV1 neuron navigator 1 2 2
MIRT667614 LIMCH1 LIM and calponin homology domains 1 2 2
MIRT674242 NUP62 nucleoporin 62 2 4
MIRT690386 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT693402 NUDT16 nudix hydrolase 16 2 2
MIRT702503 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT708632 STMN4 stathmin 4 2 2
MIRT708839 SCAND3 zinc finger BED-type containing 9 1 1
MIRT709016 HSBP1 heat shock factor binding protein 1 2 2
MIRT709235 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT710885 PARL presenilin associated rhomboid like 2 2
MIRT712262 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT712573 ATP2B4 ATPase plasma membrane Ca2+ transporting 4 2 2
MIRT715046 PRPF38A pre-mRNA processing factor 38A 2 2
MIRT718905 GALR1 galanin receptor 1 2 2
MIRT719368 FEM1A fem-1 homolog A 2 2
MIRT719495 SEC24B SEC24 homolog B, COPII coat complex component 2 2
MIRT719601 PRKX protein kinase, X-linked 2 2
MIRT719891 RRP36 ribosomal RNA processing 36 2 2
MIRT720063 ZNF449 zinc finger protein 449 2 2
MIRT721679 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT721724 VTI1A vesicle transport through interaction with t-SNAREs 1A 2 2
MIRT723370 ZNF470 zinc finger protein 470 2 2
MIRT724941 TXNL1 thioredoxin like 1 2 2
MIRT725302 NLRC5 NLR family CARD domain containing 5 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-452 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-452 Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-452 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 down-regulated
miR-452 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-mir-452 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-452-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-452-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-452-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-452-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (HCT8)
hsa-miR-452-3p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-452-3p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-452-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-452-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-452-3p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-452-3p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)

Error report submission