pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4491 |
Genomic Coordinates | chr11: 111347757 - 111347824 |
Description | Homo sapiens miR-4491 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4491 | ||||||||||||||||||||||||
Sequence | 46| AAUGUGGACUGGUGUGACCAAA |67 | ||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | HNRNPA0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | HNRPA0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | heterogeneous nuclear ribonucleoprotein A0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_006805 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on HNRNPA0 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of HNRNPA0 (miRNA target sites are highlighted) |
>HNRNPA0|NM_006805|3'UTR 1 AAGAAAATTTAAAATGCCTGGGAGTGGCTATAGGGGTAGCTCTTTCCAACAGCCCAAGTGGGGTCAACTCCTAAGCCCCA 81 CCCCCTCACACACACCGCCTTCCCTGTTTTGCCCTTGGGGGAGCCACTTCTAAGGCTGCTTACCCTTGGGGGTGTTCCTC 161 TATTTGCCTGCCACCTCTCTTGTCTCTCCCTCTGAAGATGGACTCGGCCCCACATACACATTTTTGTGTTACAGTCATTG 241 ATGGACTCTATTTTTTTATTATTACTTGGACCTTGGTCGTTTTTATACTAGCAAAATGTCTTGTTTTAATTTGTGTTTTT 321 TGGGGGGAGGGAGGGAGTGAACTTGCTGATTCTGTAGCAAAACCTGGGTGGGGGTTGGGGTGGGGGGTAGTTTACTTTGT 401 TGTAAGGACTTGATAACCTGGCTACAGCGTTTTCTATGAAATCTACTTGGATCCCATGCCTGAAATTTGGAAGCATATGT 481 ACAAAAATCATTTTTACGTTTTATTTTTAATAAATCATTGTGTTTGACCGTACATGTCTAACATTTTTTTTCTAGGATCC 561 ATTCCGTACCGTTTTTTAAGGGATATTTGTTTAAGACTTTACGTGTTAATTCTTTATTCTTGATGTGTACTTAGAGAAAC 641 TTAAGAGGTCCTGTGGTTTTTTTCCCCTCTCCTGTTGCCCTGCTAGTTGCGTGTTGAATTATATCCCTTACAGGCAAAAC 721 TTTTGAAGTGGTGGATGTGGCTTTTTAAACTCTTAAGTTTCTGTGCATCCATCTCTTGTACTAAGCGAATTGTTTATCAT 801 CTTGACATGGTTGGTCATTTCTATGACAATTTACTTCAAACTGTGTACTGTGTAGTTCTATATAGTTTGTGTTAAGCATG 881 TCATTCATATAAACTGTTTAAAATTTTTCAGATGGCCTAGTTTCATCCCTCTTACTGGTTTGTCTGTAATGAATGGTTAA 961 AAATAAGGGTTATATTTTACCCTCAAATGCGTTTTTGTACTTTCAGAGCAGGTTTAAACGTTTTTTTTTTTTTTTTCCTA 1041 TATCCGAACTGTTGGCCTCATGGAAATCCCTTTCCCGATCTTTGTAGCACCATCTACTGGCAGAATGGCAGAGTAGCTGC 1121 GAAACAATTTGTTTAAAAACTTGCTTAAGACAATTGCATCAGATTTGGAAGTTTTGCCATCAAAATTCTTTGCAGAATTG 1201 GAAGTTAACACATTTGCTTGTAACTGAGATGGGCTTCACAGGAATGTAGTTGCCAGTTCATATCACAATAGCCCTTTCTA 1281 TATGAGGTTTGAAAATGTAAACTGCTATGCATAGCTTGGGCAATAGCCCTAAATTGCTATGACAACTAATGAACCAGCTA 1361 CGTATACTGGTATTTTAGGTGCAAGTTGTAAAGCAAAATATCTGTGTATTCTGCTTGGTTAACAAATGTATATTTGTAGC 1441 CCTTTCCTGCAATAGCATTCAAGTTGTTGTTTATAAGAGAAGAACAAAAGTGATAATAGGTGAAAATTGCCTTTCTGGAT 1521 AGAAATAGAGAATAGCAACGTTTATGGATATCACAAATAAAGAATTCAATTCTTTACATGATTGAGTGAGAGTATGTATA 1601 ACCTGGTGGGTGGGTTCAGAGTACCTTTTAATCTAGTATGCTTAACTTGATGTTAATATTTAACTTAAATATTTGACTTA 1681 CATGTTGACGTTGAAGGCTCAAAGCTATACTAAGAAGCTTTCTGAAAGATTGGGCTTTAAAATAAAATAATATTTTAATA 1761 TTGAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 10949.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HCT116 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177608. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_10
PAR-CLIP data was present in ERX177609. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_11
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
CLIP-seq Support 1 for dataset GSM4903834 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_b |
Location of target site | NM_006805 | 3UTR | UCUAUUUGCCUGCCACCUCUCUUGUCUCUCCCUCUGAAGAUGGACUCGGCCCCACAUACACAUUUUUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM4903835 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_c |
Location of target site | NM_006805 | 3UTR | CUCUAUUUGCCUGCCACCUCUCUUGUCUCUCCCUCUGAAGAUGGACUCGGCCCCACAUACACAUUUUUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM4903838 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_c |
Location of target site | NM_006805 | 3UTR | CACAUACACAUUUUUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM545214 | |
---|---|
Method / RBP | PAR-CLIP / AGO3 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000314940.4 | 3UTR | CCCCACAUACACAUUUUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000314940.4 | 3UTR | AAGAUGGACUCGGCCCCACAUACACAUUUUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM1065669 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
Location of target site | ENST00000314940.4 | 3UTR | ACUCGGCCCCACAUACACAUUUUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
67 hsa-miR-4491 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT056779 | ARID5B | AT-rich interaction domain 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT061577 | BTG2 | BTG anti-proliferation factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT063828 | SRP9 | signal recognition particle 9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT102306 | DNAJB9 | DnaJ heat shock protein family (Hsp40) member B9 | ![]() |
![]() |
2 | 10 | ||||||
MIRT186634 | COX20 | COX20, cytochrome c oxidase assembly factor | ![]() |
![]() |
2 | 8 | ||||||
MIRT191243 | STYX | serine/threonine/tyrosine interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT195908 | SRSF11 | serine and arginine rich splicing factor 11 | ![]() |
![]() |
2 | 4 | ||||||
MIRT240343 | UBXN2B | UBX domain protein 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT271178 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT286219 | TMEM97 | transmembrane protein 97 | ![]() |
![]() |
2 | 4 | ||||||
MIRT314182 | OCLN | occludin | ![]() |
![]() |
2 | 4 | ||||||
MIRT323938 | AKAP2 | A-kinase anchoring protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT323940 | PALM2-AKAP2 | PALM2-AKAP2 readthrough | ![]() |
![]() |
2 | 4 | ||||||
MIRT340113 | TXLNA | taxilin alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT450333 | LRWD1 | leucine rich repeats and WD repeat domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451283 | ZNF101 | zinc finger protein 101 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451879 | SOD2 | superoxide dismutase 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT453577 | CRCP | CGRP receptor component | ![]() |
![]() |
2 | 2 | ||||||
MIRT454366 | ASAH2 | N-acylsphingosine amidohydrolase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454797 | STOML3 | stomatin like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459801 | POTED | POTE ankyrin domain family member D | ![]() |
![]() |
2 | 10 | ||||||
MIRT460911 | POLQ | DNA polymerase theta | ![]() |
![]() |
2 | 2 | ||||||
MIRT468082 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT470281 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471876 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476147 | GPR137C | G protein-coupled receptor 137C | ![]() |
![]() |
2 | 8 | ||||||
MIRT478056 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | ![]() |
![]() |
2 | 10 | ||||||
MIRT501054 | SMCR8 | Smith-Magenis syndrome chromosome region, candidate 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT501732 | OVOL1 | ovo like transcriptional repressor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT502214 | HSPB8 | heat shock protein family B (small) member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT505243 | UBE2D3 | ubiquitin conjugating enzyme E2 D3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT505957 | RAN | RAN, member RAS oncogene family | ![]() |
![]() |
2 | 6 | ||||||
MIRT507996 | BCL2L13 | BCL2 like 13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT510433 | ZNF207 | zinc finger protein 207 | ![]() |
![]() |
2 | 6 | ||||||
MIRT510827 | SBNO1 | strawberry notch homolog 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT511493 | HNRNPA0 | heterogeneous nuclear ribonucleoprotein A0 | ![]() |
![]() |
2 | 4 | ||||||
MIRT512129 | CREBL2 | cAMP responsive element binding protein like 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT514512 | SHISA9 | shisa family member 9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT516482 | RAB32 | RAB32, member RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT519514 | RBM22 | RNA binding motif protein 22 | ![]() |
![]() |
2 | 4 | ||||||
MIRT523367 | GTF2A1 | general transcription factor IIA subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524217 | DDI2 | DNA damage inducible 1 homolog 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT524649 | C4orf32 | family with sequence similarity 241 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT528297 | ZNF76 | zinc finger protein 76 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528577 | ITGB3BP | integrin subunit beta 3 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT530458 | SULT1B1 | sulfotransferase family 1B member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535774 | MYCN | MYCN proto-oncogene, bHLH transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT544239 | CCBL2 | kynurenine aminotransferase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546733 | RNF217 | ring finger protein 217 | ![]() |
![]() |
2 | 2 | ||||||
MIRT550360 | INCENP | inner centromere protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT553343 | TRPC3 | transient receptor potential cation channel subfamily C member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT556629 | LAPTM4A | lysosomal protein transmembrane 4 alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT558006 | FAM122B | family with sequence similarity 122B | ![]() |
![]() |
2 | 2 | ||||||
MIRT558994 | CA8 | carbonic anhydrase 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560418 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565717 | SESN3 | sestrin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566271 | PTAR1 | protein prenyltransferase alpha subunit repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568161 | CCDC6 | coiled-coil domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569753 | C2orf71 | chromosome 2 open reading frame 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573959 | FIGNL1 | fidgetin like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT574530 | PEG10 | paternally expressed 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609453 | CCDC149 | coiled-coil domain containing 149 | ![]() |
![]() |
2 | 2 | ||||||
MIRT614047 | THBS2 | thrombospondin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628418 | ATMIN | ATM interactor | ![]() |
![]() |
2 | 2 | ||||||
MIRT689556 | XPO6 | exportin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725598 | CDH7 | cadherin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT735561 | TRIM7 | tripartite motif containing 7 | ![]() |
![]() |
![]() |
3 | 0 |