>HIST3H2BB|NM_175055|3'UTR
   1 GGCGTTCCTCGGCGTCCTGAACCCAAAGGCTCTTTTCAGAGCCACCCA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uuuAGG----GUAGGGGUCCUUGGGg 5' ||| |:|||: |||||| Target 5' cgtTCCTCGGCGTCCT---GAACCCa 3'	3 - 25	125.00	-17.90
2	miRNA 3' uuuaGGGUAGGGGUCCUUGGGg 5' :|: |:| || |||| Target 5' aggcTCTTTTCAGAGCCACCCa 3'	27 - 48	90.00	-16.00

Mutant ID	Mutant Position	Mutant Source
COSN31493775	4	COSMIC
COSN26978874	9	COSMIC
COSN30465507	23	COSMIC
COSN1099315	25	COSMIC
COSN30179369	38	COSMIC
COSN31489006	38	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs778838640	3	dbSNP
rs1178307855	4	dbSNP
rs1376497903	6	dbSNP
rs1465950111	7	dbSNP
rs745923264	9	dbSNP
rs772263556	11	dbSNP
rs1418209171	12	dbSNP
rs1055921337	14	dbSNP
rs771599968	16	dbSNP
rs769030108	17	dbSNP
rs373175765	19	dbSNP
rs542607900	20	dbSNP
rs1232419368	22	dbSNP
rs773832581	23	dbSNP
rs758935627	24	dbSNP
rs201179358	25	dbSNP
rs1285645205	26	dbSNP
rs1488925536	29	dbSNP
rs1193027672	31	dbSNP
rs752166639	33	dbSNP
rs755726333	35	dbSNP
rs966990618	38	dbSNP
rs747748191	39	dbSNP
rs763744369	42	dbSNP
rs753574764	44	dbSNP
rs757104034	46	dbSNP
rs1297309433	47	dbSNP
rs778712559	48	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.