>HIST1H2BA|NM_170610|3'UTR
   1 GCCTGCTAAGTAAACGTCATTTCTAACCCAAAGGCTCTTTTCAGAGCCACTTA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gaccuaacuucucuuUUGGGUu 5' |||||| Target 5' gtaaacgtcatttctAACCCAa 3'	10 - 31	120.00	-7.80
2	miRNA 3' gaccuaacuucucuUUUGGGUU--- 5' |:| ||| Target 5' caaaggctcttttcAGAGCCACTTA 3'	29 - 53	80.00	-14.40
3	miRNA 3' gaccuaacuucucuuuUGGGUu 5' :||:: Target 5' ----------------GCCTGc 3'	1 - 6	52.00	-5.60

Mutant ID	Mutant Position	Mutant Source
rs1233993411	1	dbSNP
rs1273359871	2	dbSNP
rs141233331	3	dbSNP
rs769158779	3	dbSNP
rs759198179	4	dbSNP
rs376729685	5	dbSNP
rs1400206912	6	dbSNP
rs752279426	7	dbSNP
rs17320558	8	dbSNP
rs1206784562	10	dbSNP
rs569061647	11	dbSNP
rs1465226120	14	dbSNP
rs371711078	16	dbSNP
rs985411001	17	dbSNP
rs757112467	19	dbSNP
rs1426590265	20	dbSNP
rs781193138	20	dbSNP
rs1422626864	23	dbSNP
rs746032237	24	dbSNP
rs770060140	28	dbSNP
rs779958711	29	dbSNP
rs749410404	30	dbSNP
rs768669736	33	dbSNP
rs1321917090	36	dbSNP
rs1225857377	38	dbSNP
rs368207542	38	dbSNP
rs762445534	38	dbSNP
rs774792268	38	dbSNP
rs1333063525	42	dbSNP
rs931026751	49	dbSNP
rs1287927490	50	dbSNP
rs774895148	51	dbSNP
rs1230284858	52	dbSNP
rs768092519	53	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- Genome biology, 2013

BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.